Previous Article | Next Article 
Applied and Environmental Microbiology, October 1998, p. 3683-3689, Vol. 64, No. 10
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Estimation of the Relative Abundance of Different
Bacteroides and Prevotella Ribotypes
in Gut Samples by Restriction Enzyme Profiling of PCR-Amplified 16S
rRNA Gene Sequences
Jacqueline
Wood,1
Karen P.
Scott,1
Gorazd
Avgu
tin,2
C. James
Newbold,1 and
Harry J.
Flint1,*
Rowett Research Institute, Bucksburn,
Aberdeen AB21 9SB, United Kingdom,1 and
Zootechnical Department, Biotechnical Faculty, University
of Ljubljana, 1230 Domzale, Slovenia2
Received 20 April 1998/Accepted 14 July 1998
 |
ABSTRACT |
We describe an approach for determining the genetic composition of
Bacteroides and Prevotella
populations in gut contents based on selective amplification of 16S
rRNA gene sequences (rDNA) followed by cleavage of the amplified
material with restriction enzymes. The relative contributions of
different ribotypes to total Bacteroides and
Prevotella 16S rDNA are estimated after end labelling of
one of the PCR primers, and the contribution of
Bacteroides and Prevotella
sequences to total eubacterial 16S rDNA is estimated by measuring the
binding of oligonucleotide probes to amplified DNA.
Bacteroides and Prevotella 16S rDNA
accounted for between 12 and 62% of total eubacterial 16S rDNA in
samples of ruminal contents from six sheep and a cow. Ribotypes 4, 5, 6, and 7, which include most cultivated rumen Prevotella
strains, together accounted for between 20 and 86% of the total
amplified Bacteroides and
Prevotella rDNA in these samples. The most abundant Bacteroides or Prevotella ribotype
in four animals, however, was ribotype 8, for which there is only one
known cultured isolate, while ribotypes 1 and 2, which include many
colonic Bacteroides spp., were the most
abundant in two animals. This indicates that some abundant
Bacteroides and Prevotella groups
in the rumen are underrepresented among cultured rumen
Prevotella isolates. The approach described here provides a
rapid, convenient, and widely applicable method for comparing the
genotypic composition of bacterial populations in gut samples.
 |
INTRODUCTION |
Methods for enumerating gut
bacteria that are based on cultivation, isolation, and biochemical
testing are generally laborious and do not guarantee recovery of the
less easily cultivated species. This is a particular problem for
obligately anaerobic bacteria, which make up the great majority of
organisms present in densely populated gut habitats such as the rumen
and hind gut (13, 31). For this reason, there has been
increasing interest in the rapid enumeration of microbial groupings by
analysis of nucleic acids extracted from gut samples. Probing of
extracted RNA with radiolabelled or fluorescently labelled
oligonucleotide probes has been used in several studies (6, 14,
20, 30) but relies on developing panels of probes for different
groups from available sequence data. Sequencing of random PCR-amplified
16S rRNA gene (rDNA) clones has provided valuable information on total
eubacterial diversity for human fecal microflora (37).
However, more rapid approaches to the study of diversity that allow the
examination of large numbers of samples are required, and a
semiquantitative PCR detection approach based on serial dilution has
been reported for some of the predominant gut anaerobes
(35). The approach we take here is to perform selective PCR
amplification of 16S rRNA genes from the gram-negative anaerobic genera
Bacteroides and Prevotella by using
DNA extracted from gut samples and then to estimate the genotypic
composition of samples from restriction enzyme cleavage patterns
(restriction fragment length polymorphism [RFLP]) of the amplified
DNA (PCR-RFLP). 16S rDNA PCR-RFLP approaches have proved valuable for
typing isolated bacterial strains (see, e.g., references
10 and 15) and assessing the
diversity of cloned, amplified 16S rDNA sequences from bacteria at
hydrothermal vents (23), but they do not appear to have been
applied previously to sequences directly amplified from mixed gut
communities.
Members of the Bacteroides-Cytophaga-Flexibacter
phylum (25, 38) are often reported to be among the most
numerous culturable microbes present in the rumen and hind gut, where
they play important roles in the breakdown of protein and carbohydrate
and, in some cases, act as opportunistic pathogens (28).
Rumen Prevotella spp. form a diverse group that is distinct
from the human hind-gut Bacteroides spp. based
on 16S rRNA sequencing and other criteria (3, 18, 29). The
single species recognized formerly, Prevotella ruminicola,
contained considerable variation, and its recently proposed
reclassification into four species, P. ruminicola,
P. bryantii, P. brevis, and
P. albensis (4), is followed here.
 |
MATERIALS AND METHODS |
Bacteria.
The origins of the Prevotella spp. have
been described previously (3, 19).
Bacteroides uniformis 1004 was obtained from A. Salyers, University of Illinois; B. vulgatus 10583, B. ovatus 11153, and B. levii 11028 were obtained from the
National Collection of Type Cultures, Aberdeen, United Kingdom;
B. vulgatus 1447 was from the DSM collection, Braunschweig,
Germany. Bacteria were grown anaerobically (8) at 38°C in
M2GSC medium (22) under O2-free CO2.
Animals and diets.
DNA was extracted from samples of rumen
fluid removed from cannulated animals (one cow and six sheep). Unless
otherwise stated, the samples were obtained 2 h after the morning
feed and the microbial DNA was immediately extracted. Diet 1 consisted
of 500 g of grass hay, 299.5 g of barley, 100 g of molasses,
91 g of white fishmeal, and 9.1 g of mineral-vitamin mixture
per kg (cow, 4 to 5 kg, once daily; sheep 1, 0.7 kg, twice daily). Diet
2 consisted of 300 g of grass hay and 150 g of grass nut
(sheep 2 and 3, fed twice daily). Sheep 4 was a defaunated animal that
received diet 1 (1.4 kg, once daily). Diet 3 consisted of 400 g of
bruised barley, 100 g of hay, twice daily, and diet 4 consisted of
200 g of bruised barley and 300 g of hay, twice daily (sheep
5 and 6).
DNA extraction.
DNA was extracted from isolated strains as
described previously (2, 3). DNA was extracted from rumen
and fecal samples by a modification of the method of Stahl et al.
(30). A sterile 2-ml screw-cap Eppendorf tube was half
filled with sterile zirconium beads, 0.1 mm in diameter, and 1 ml of
sample was added so that the tube was filled completely. The sample was
beaten with a mini bead beater (Biospec Products) for 30 s and
then chilled on ice for at least 1 min. This procedure was carried out
six times, and the sample was then added immediately to an equal volume
of 1:1 (vol/vol) phenol-chloroform and vortexed. Further extractions were performed until the aqueous phase no longer appeared cloudy. Nucleic acids were recovered from the aqueous phase by ethanol precipitation and resuspended in a suitable volume of sterile distilled
H2O (dH2O).
Humic material had to be removed from the DNA extracted from rumen
fluid and feces prior to PCR amplification. This was achieved by
passing the DNA through an Elutip-d column as specified by the
manufacturer (Schleicher and Schuell, Dassel, Germany). The DNA was
then precipitated in 2 volumes of ethanol and resuspended in sterile
dH2O. This procedure had to be performed at least twice to
obtain DNA of a quality suitable for amplification.
Oligonucleotide primers and probes.
The universal
eubacterial primers fD1 (5'-AGAGTTTGATCCTGGCTCAG, positions
7 to 26 in the Escherichia coli 16S rRNA gene
[7]) and rP2 (ACGGCTACCTTGTTACGACTT,
positions 1513 to 1494) are those used in reference
36. The Uni16S primer (ACGGGCGGTGTGTACAAGGCC, positions 1383 to 1402) is that used in reference
30. The Bacteroides- and
Prevotella-specific primer BacPre
(GAGTACGCCGGCAACGGTGA, positions 887 to 907) its reverse
complement rBacPre (TCACCGTTGCCGGCGTACTC), and the
P. ruminicola 23-specific probe
(ATCTTGAGTGAGTTCGATGTTGG, positions 650-673) are those used
in reference 3. For end labelling of primers or
probes, 100 ng of the oligonucleotide was diluted to a final volume of
16 µl with sterile dH2O, incubated at 70°C for 1 min,
and immediately placed on ice. T4 polynucleotide kinase buffer, 50 µCi of [
-32P]ATP, and 10 U of T4 polynucleotide
kinase were added in a final volume of 25 µl, and the mixture was
incubated for 30 min at 37°C. The reaction was stopped by heating to
70°C for 10 min. Unincorporated 32P was removed by
passing the mixture through Chroma spin-10 columns (Clontech) as
specified by the manufacturer.
PCR amplification of ruminal 16S rDNA and PCR-RFLP analysis.
Approximately 200 to 250 ng of chromosomal DNA was amplified with a
Techne PHC-3 thermal cycler in a 100-µl reaction mix containing 0.04 mM each deoxynucleoside triphosphate, 20 pmol of each primer, and 1×
reaction buffer, 0.5 U of Taq polymerase. Reaction
conditions for the amplification with the forward fD1 primer and the
reverse rBacPre primer involved an initial cycle of 94°C for 5 min,
60°C for 2 min, and 72°C for 2 min, followed by 29 cycles of 94°C
for 2 min, 60°C for 30 s, and 72°C for 2 min, with a final
cycle step at 72°C for 10 min. Amplification with the universal
primers, fD1 and rP2, was performed under the same conditions, except
that the annealing temperature was 57°C.
For PCR-RFLP analysis, PCR products were digested to completion with
the appropriate enzyme and analyzed by electrophoresis
in either 1.5%
agarose or 3% MetaPhor agarose (Flowgen) gels.
Radioactive bands
resulting from 5'-end labelling of the rBacPre
primer were analyzed
with a Packard InstantImager after the gel
was dried.
Some additional sequencing of 16S rDNA amplified from isolated
Prevotella strains was undertaken with an ABI373 automated
sequencer to extend the previous partial-sequence information.
Estimation of Bacteroides and
Prevotella DNA by hybridization.
PCR products were
transferred to positively charged nylon membranes (Boehringer Mannheim)
by Southern blotting. After transfer, the DNA was fixed to the membrane
by UV cross-linking at 120 mJ. The membranes were prehybridized for 3 to 4 h at 65°C in 0.2 volume of 20× Denhardt's solution (0.2 mg of bovine serum albumin, 0.2 mg of Ficoll, and 0.2 mg of
polyvinylpyrrolidone in 10 ml of sterile dH2O)-0.2 volume
of 1% herring sperm DNA-0.2 volume of 25× SSC (1× SSC is 0.15 M
NaCl plus 0.015 M sodium citrate)-0.06 volume of 5% sodium dodecyl
sulfate (SDS)-0.34 volume of sterile dH2O. This solution
was boiled for 2 to 3 min and then chilled on ice for 2 to 3 min before
being added to the membrane. Labelled oligonucleotide (100 ng) was then
added, and the membrane was incubated overnight at 54°C. Hybridized
membranes were washed twice with 2× SSC-0.1% SDS and twice with
0.1× SSC-0.1% SDS, all for 15 min at 54°C. The membranes were then
sealed in a bag and placed in a Packard InstantImager or exposed to
X-ray film.
Nucleotide sequence accession number.
The sequence for
P. bryantii B14 is available as accession
no. AJ00647.
 |
RESULTS |
Restriction enzyme profiles of 16S rDNA sequences amplified with a
PCR primer combination specific for Bacteroides
and Prevotella spp.
The aim of this work was to derive
information on the relative abundance in the community of
different Bacteroides and
Prevotella ribotypes from restriction enzyme cleavage of 16S
rDNA sequences amplified from gut samples. A universal eubacterial
primer, fD1 (36), and rBacPre, the reverse complement
of a primer specific for Prevotella spp. and
Bacteroides spp. (3), were used to amplify a 900-bp portion of the 16S rRNA gene. The recognition spectrum of the rBacPre oligonucleotide was established by using the
Checkprobe program, which confirmed a 100% match for all 26 species of
Prevotella and Bacteroides listed in
the Ribosomal database (17), except for B. levii
and B. splanchnicus, which showed a 90% match. Seven
species not belonging to either of these genera (two
Flectobacillus, Flexibacter, Runella,
two Cytophaga, and Thermonema) were also
recognized, but none of these have been found in rumen contents.
The rBacPre-plus-fD1 primer combination was used to amplify 16S rDNA
sequences from isolated strains, and restriction enzyme
cleavage
patterns were analyzed for the enzymes
HhaI,
AatII, and
StuI, which were predicted from
computer analysis to discriminate
between
Prevotella species
(Fig.
1). Combining the results obtained
with the three enzymes, it was possible to define 11 ribotypes
for the
26 rumen
Prevotella and 6
Bacteroides
strains studied
(Table
1). It should be
noted that certain species of human colonic
or oral origin, not studied
here, are predicted to belong to additional
ribotypes that were not
detected in this work (Table
1, footnote
b).

View larger version (100K):
[in this window]
[in a new window]
|
FIG. 1.
Restriction enzyme cleavage of PCR amplification
products from 16S rDNA. Cleavage of amplified sequences from isolated
strains P. bryantii B14 (lane 2),
P. ruminicola 23 (lane 3), P. brevis
GA33 (lane 4), P. albensis M384 (lane 5), and B. vulgatus 1447 (lane 6) by HhaI (A), AatII
(B), and StuI (C) are shown. Lanes 7 to 13 show
HhaI-cut amplification products from rumen samples derived
from a cow (lane 7) and from sheep 1 to 4 (lanes 8 to 11) and human and
porcine fecal samples (lanes 12 and 13, respectively). Size markers
(1-kb ladder [Gibco BRL]) are shown in lanes 1 and 14.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Restriction fragment patterns obtained from rumen
Prevotella isolates and from colonic
Bacteroides spp. after cleavage of an 896- to 898-bp region of 16S rDNA amplified with the rBacPre-plus-fD1
primer set
|
|
Analysis of 16S rDNA sequences amplified from rumen
samples.
DNA suitable for PCR amplification with the
rBacPre-plus-fD1 primer combination was extracted from rumen
samples as described in Materials and Methods. When the amplified
products were cleaved with HhaI, AatII, or
StuI, most of the products of restriction enzyme cleavage
correlated with bands obtained for the isolated strains (Fig. 1). The
relatively simple banding patterns obtained and the ability to
correlate these bands with ribotypes of isolated strains are consistent
with highly specific amplification by the rBacPre-plus-fD1 primer pair.
The 323-bp band obtained after HhaI cleavage, predicted
for ribotypes 4 and 6, was shown to hybridize with a signature
oligonucleotide probe designed to recognize strains related to
P. ruminicola 23, which belongs to ribotype 4. No
hybridization was obtained for the same probe when the amplified DNA
was cut with TaqI, which is known to cut within the target
site for the P. ruminicola 23 probe (results not
shown).
As a test for bias in amplification, DNA was extracted from mixtures
containing different proportions of
P. ruminicola 23
and
P. bryantii B
14 cells and amplified
with the rBacPre-plus-fD1
primer set. No evidence of bias was found,
since the intensity
of diagnostic bands for each strain reflected the
relative contributions
of the input cells (Fig.
2). The same result was obtained when
purified DNA from the two strains was mixed in different proportions
and subjected to amplification (results not shown).

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 2.
StuI digests of PCR amplification products
obtained from mixtures of P. ruminicola 23 and
P. bryantii B14 cells, using the
rBacPre-plus-fD1 primer combination. Lanes: 1 B14 DNA only;
11, 23 DNA only; 2 to 10 contained B14 and 23 cells in the
ratios 9:1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, and 1:9, respectively.
|
|
Estimating the relative abundance of different
Bacteroides and Prevotella rDNA
ribotypes.
PCR amplifications in which the rBacPre primer was end
labelled with [
-32P]dATP were next performed. This
simplifies the banding pattern, since only one terminal fragment is
labelled, and also allowed the proportional contributions of particular
labelled bands to the total radioactivity present in the amplified PCR
product to be estimated by using a Packard
scanner (Fig.
3). Since only one 32P atom
is present per fragment, detection is independent of fragment size. The
sizes of the labelled restriction fragments were predicted by computer
analysis for all of the Bacteroides and
Prevotella spp. that gave an exact match with the rBacPre
primer (Table 1). This confirmed that the ribotypes that include
P. ruminicola 23 and P. brevis GA33
(ribotypes 4 and 6, respectively) do not include any other known
organisms that give a PCR product with the rBacPre-plus-fD1 primer
combination. Ribotypes 5 and 7 are predicted to include some other
Prevotella spp. in addition to P. bryantii
B14 and P. albensis M384 (Table 1). The
end-labelling approach could not distinguish between ribotypes 7 and 11 or between ribotypes 3 and 9, and these pairs are treated together
here, as are ribotypes 1 and 2.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 3.
Detection of 32P-labelled fragments derived
from digestion of 16S rDNA sequences amplified with rBacPre and
end-labelled fD1 primer. Lanes: 1 to 4 PCR-amplified fragments from
P. bryantii B14, P. ruminicola 23, P. brevis GA33, and P. albensis M384, respectively, cut with HhaI; 5 to 9, HhaI-cut amplification products from rumen samples derived
from a cow (lane 5) and from sheep 1 to 4 (lanes 6 to 9); 10 and 11, human and porcine fecal samples. Material in lane 7 was incompletely
digested in this gel.
|
|
The relative abundance of the six most common ribotypes in rumen
samples is shown in Table
2 for four
sheep and one cow and
in Table
3 for two
further sheep. Ribotypes 4, 5, 6, and 7 plus
11, which include the
best-defined rumen
Prevotella species, together
accounted
for between 20 and 86% of the total amplified material
from these
animals. Up to 47% was due to ribotype 8, for which
only one cultured
rumen isolate (
P. ruminicola TC2-3) is currently
available. Ribotype 8 may represent a genetically divergent group
that
is underrepresented because its members are difficult to
culture, and
the functional properties of this group are largely
unknown.
Surprisingly, between 10 and 56% of ruminal material
was due to
representatives of ribotypes 1 plus 2, which include
Bacteroides and
Porphyromonas spp.
Other recent studies have found
evidence for
Bacteroides-related organisms in rumen contents
(
5,
12).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Estimation of the relative abundance of different
Bacteroides and Prevotella ribotypes
in amplified 16S rDNA sequences from gut samples
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Changes in Bacteroides and
Prevotella ribotypes with diet and sampling time in rumen
liquor from two sheep
|
|
To examine the stability of the rumen community with respect to
Bacteroides and
Prevotella ribotypes,
rumen samples were taken
from two sheep before and after a change in
diet (Table
3). The
results reveal a considerable difference initially
in the strain
profiles of the two animals. Apart from a consistent
increase
in ribotypes 1 plus 2, the effects of the dietary shift were
quite
different in the two animals. A likely explanation for this is
that the two sheep harbored functionally distinct strains belonging
to
the same ribotypes.
A human fecal sample gave a low proportion (<10%) of bands
characteristic of
Prevotella ribotypes and a high
proportion (90%)
of bands of ribotypes 1 plus 2, corresponding
to
Bacteroides spp.
A fecal sample from a pig
gave significant proportions of ribotypes
1 plus 2, 5, and 7 plus 11, which include
Bacteroides spp.,
P. bryantii B
14, and
P. albensis M384, but no detectable material
closely related to
ribotypes 4 and 6, which include
P. ruminicola 23 and
P. brevis GA33, respectively (Table
2).
Prevotella strains
apparently related to ruminal isolates
have been isolated from
the large intestinal contents of pigs
(
27).
Contribution of Bacteroides and
Prevotella 16S rDNA sequences to total eubacterial
16S rDNA.
To estimate the amount of
Bacteroides and Prevotella DNA
relative to total eubacterial DNA, two universal eubacterial primers, fD1 and rP2 (36), were used to amplify most of the 16S
rRNA gene. Amplified material was transferred to filters by Southern blotting and probed with a general eubacterial oligonucleotide, Uni16S (30), or with the
Bacteroides- and Prevotella-specific oligonucleotide BacPre. The approximate proportion of
Bacteroides and Prevotella 16S rDNA,
shown in Tables 2 and 3, was calculated from the relative binding of
these two probes to material amplified from gut samples and from pure
cultures, correcting for any differences in probe-specific activity or
hybridization kinetics (Fig. 4). Bacteroides and Prevotella sequences
were estimated to account for between 12 and 62% of total eubacterial
16S rDNA in the rumen samples examined here (Tables 2 and 3).

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 4.
Estimation of the contribution of
Bacteroides and Prevotella 16S rDNA
to total eubacterial 16S rDNA sequences. Amplified sequences were
transferred onto a filter by Southern blotting and probed with either
the Uni16S eubacterial probe (A) or the BacPre probe (B). Lanes: 1, amplified DNA from P. ruminicola 23 control; 2 to 5, DNA from four different sheep rumen samples. To obtain the data shown
in the final columns in Tables 2 and 3, radioactivity was estimated for
each band by using a Packard beta scanner. The proportion of
eubacterial 16S rDNA sequences due to
Bacteroides and Prevotella was
estimated as (ae/ab) × (bb/be) where
ae and be are the counts
obtained for the control and unknown cultures, respectively, with the
universal eubacterial probe uni16S, and ab and
bb are the corresponding counts obtained with
the BacPre probe.
|
|
Combining the estimates of the relative abundance of
Prevotella and
Bacteroides ribotypes
with the estimated contribution
of
Prevotella and
Bacteroides sequences to total eubacterial rDNA
allows calculation of the contributions of individual
Prevotella ribotypes. For example, the greatest abundance
for ribotypes 4,
5, 6, and 7 plus 11 was 9, 27, 13, and 13%
respectively, as percentages
of total eubacterial 16S rDNA in the rumen
samples studied here.
 |
DISCUSSION |
The four ribotypes that include the major rumen
Prevotella species identified previously by culture
approaches were present as a significant proportion of
Bacteroides and Prevotella 16S rDNA
sequences in all seven ruminant animals examined here and accounted for
20 to 86% of Bacteroides and
Prevotella rDNA or 4 to 43% of the total eubacterial rDNA.
At present, the largest single group of cultured rumen
Prevotella strains (9) is probably represented by
ribotype 4. Among Prevotella isolates from silage-fed cattle
studied by van Gylswyk (33), more than 50% were
P. ruminicola belonging to ribotype 4 (3).
On the other hand, isolations of strains showing dipeptidyl
aminopeptidase I (DAPI) activity (thought to be characteristic of
rumen Prevotella strains) from sheep fed similar diets
and held at the same site as those studied here (19) yielded
mainly P. bryantii, P. brevis, or
P. albensis. The present observation that ribotypes 5 and 6 were more abundant than ribotype 4 in sheep rumen samples is
therefore consistent with the results of previous isolation studies. On
the other hand, the most abundant Bacteroides
and Prevotella ribotypes in six of the seven animals
(ribotypes 8 and 1 plus 2) are represented by very few cultured strains
of rumen origin. Recent investigations through random sequencing of
amplified 16S rDNA from the rumen have indicated a greater diversity of
Bacteroides and Prevotella spp. than
previously recognized (5, 12). It appears, therefore, that
certain groupings may be underrepresented among cultured strains
because of difficulties in their recovery through cultivation. Studies
of other ecosystems have revealed large discrepancies between viable
and direct microscopic microbial counts (1), although there
are reasons to expect that discrepancies would be smaller for gut
ecosystems in which a certain growth rate is required to prevent
washout from the system. The viable count from the rumen was previously
found to vary between 14 and 75% of the total direct count for cattle
fed two different diets, depending on the diet and the time after
feeding (16). These discrepancies may reflect a failure to
recover the full range of rumen microbial diversity, as well as changes
in the viability of known organisms (21).
It is possible that certain Bacteroides and
Prevotella strains are overrepresented in amplified 16S rDNA
due to PCR bias (32, 34), or differential extractability of
nucleic acids, but there was little evidence of this in the control
experiments reported here. PCR bias was detected by Wilson and
Blitchington (37), who obtained slightly different estimates
of relative sequence abundance after 35 cycles compared with 9 cycles
of PCR in amplifications of rDNA sequences from human fecal material,
although the amplified region was larger than in the present study. In
addition, the number of rRNA operons can vary among different bacteria
(11, 24, 26), and it is not known how much variation occurs
between strains of Bacteroides and
Prevotella. In general, such biases may prove less of a
problem when comparisons are being made, as here, within a phylogenetic
grouping than among dissimilar groupings.
The approach described here offers a simple, rapid, and convenient
method for obtaining information on the population structure of
bacteria present in gut ecosystems. In future, more convenient quantification should be possible, for example by using fluorescently labelled rather than radioactively labelled primers for PCR. Although it cannot be assumed that ribotype frequencies correspond precisely to
the abundance of different genotypes in the sample, for reasons discussed above, they can nevertheless provide important indicators of
population changes between samples. This simple profiling approach therefore appears ideally suited for testing hypotheses to explain in
vivo population dynamics and interanimal variability of important components of gut microbial communities. For the
Bacteroides and Prevotella group, it
should prove directly applicable to other anaerobic systems such as the
human and animal hind gut.
 |
ACKNOWLEDGMENTS |
This work was supported by the Scottish Office
Agriculture, Environment and Fisheries Department (SOAEFD) and by a
BBSRC studentship award to Jacqueline Wood.
We thank Freda McIntosh for her help with analysis of sheep rumen
samples and Jennifer Martin for DNA sequence determination.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Rowett Research
Institute, Greenburn Rd., Bucksburn, Aberdeen AB21 9SB, United Kingdom. Phone: 44(0) 1224 716651. Fax: 44(0) 1224 716687. E-mail:
hjf{at}rri.sari.ac.uk.
 |
REFERENCES |
| 1.
|
Amman, R. I.,
W. Ludwig, and K.-H. Schleifer.
1995.
Phylogenetic identification and in situ detection of individual microbial cells without cultivation.
Microbiol. Rev.
59:143-169[Abstract/Free Full Text].
|
| 2.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. M. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1994.
Current protocols in molecular biology, vol. 1.
John Wiley & Sons, Inc., New York, N.Y.
|
| 3.
|
Avgu tin, G.,
F. Wright, and H. J. Flint.
1994.
Genetic diversity and phylogenetic relationships among strains of Prevotella (Bacteroides) ruminicola from the rumen.
Int. J. Syst. Bacteriol.
44:246-255[Abstract/Free Full Text].
|
| 4.
|
Avgu tin, G.,
R. J. Wallace, and H. J. Flint.
1997.
Phenotypic diversity among rumen isolates of Prevotella ruminicola: proposal for Prevotella brevis sp. nov., Prevotella bryantii sp. nov., Prevotella albensis sp. nov., and redefinition of Prevotella ruminicola.
Int. J. Syst. Bacteriol.
47:284-288[Abstract/Free Full Text].
|
| 5.
|
Avgu tin, G.,
A. Ram ak,
M. Peterka,
F. V. Nekrep, and H. J. Flint.
1997.
Evolutionary relationships of the rumen bacteria belonging to the Cytophaga-Flexibacter-Bacteroides phylum, p. 27-28.
In
A. Chesson, C. S. Stewart, and H. J. Flint (ed.), Reproduction, nutrition and development. Supplement: Evolution of the rumen microbial ecosystem. Elsevier, Paris, France.
|
| 6.
|
Briesacher, S. L.,
T. May,
K. N. Grigsby,
M. S. Kerley,
R. V. Anthony, and J. A. Paterson.
1992.
Use of DNA probes to monitor nutritional effects on the ruminal prokaryotes and Fibrobacter succinogenes S85.
J. Anim. Sci.
70:289-295[Abstract].
|
| 7.
|
Brosius, J.,
T. J. Dull,
D. Sleeter, and H. F. Noller.
1981.
Gene organisation and primary structure of a ribosomal DNA operon from Escherichia coli.
J. Mol. Biol.
148:107-127[Medline].
|
| 8.
|
Bryant, M. P.
1972.
Commentary on the Hungate technique for culture of anaerobic bacteria.
Am. J. Clin. Nutr.
25:1324-1328[Free Full Text].
|
| 9.
|
Bryant, M. P.,
N. Small,
C. Bouma, and H. Chu.
1958.
Bacteroides ruminicola n. sp. and Succinimonas amylolytica, the new species and genus.
J. Bacteriol.
76:15-23[Free Full Text].
|
| 10.
|
Cardarelli-Leite, P.,
K. Blom,
C. M. Patton,
M. A. Nicholson,
A. G. Steigerwalt,
S. B. Hunter,
D. J. Brenner,
T. J. Barrett, and B. Swaminthan.
1996.
Rapid identification of Campylobacter species by restriction fragment length polymorphism analysis of a PCR-amplified fragment of the gene coding for 16S rRNA.
J. Clin. Microbiol.
34:62-67[Abstract].
|
| 11.
|
Farrelly, V.,
F. A. Rainey, and E. Stackebrandt.
1995.
Effect of genome size and rrn gene copy number on PCR amplification of 16S rRNA genes from a mixture of bacterial species.
Appl. Environ. Microbiol.
61:2798-2801[Abstract].
|
| 12.
|
Forster, R. J.,
M. F. Whitford,
C. E. Beard, and J. Gong.
1997.
An investigation of microbial diversity in the rumen of dairy cattle using comparative sequence analysis of cloned 16S rRNA genes, p. 28-29.
In
A. Chesson, C. S. Stewart, and H. J. Flint (ed.), Reproduction, nutrition and development. Supplement: evolution of the rumen microbial ecosystem. Elsevier, Paris, France.
|
| 13.
|
Hespell, R. B.,
D. E. Akin, and B. A. Dehority.
1996.
Bacteria, fungi and protozoa of the rumen, p. 59-141.
In
R. I. Mackie, B. A. White, and R. E. Isaacson (ed.), Gastrointestinal microbiology, vol. 2. Chapman and Hall, New York, N.Y.
|
| 14.
|
Krause, D. O., and J. B. Russell.
1996.
An rRNA approach for assessing the role of obligate amino acid-fermenting bacteria in ruminal amino acid deamination.
Appl. Env. Microbiol.
62:815-821[Abstract].
|
| 15.
|
Laguerre, G.,
M.-R. Allard,
F. Revoy, and N. Amrger.
1994.
Rapid identification of rhizobia by restriction fragment length polymorphism analysis of PCR-amplified 16S rRNA genes.
Appl. Environ. Microbiol.
60:56-63[Abstract/Free Full Text].
|
| 16.
|
Leedle, J. A. Z.,
M. P. Bryant, and R. B. Hespell.
1982.
Diurnal variations in bacterial numbers and fluid parameters in ruminal contents of animals fed low- or high-forage diets.
Appl. Environ. Microbiol.
44:402-412[Abstract/Free Full Text].
|
| 17.
|
Maidak, B. L.,
G. J. Olsen,
N. Larsen,
R. Overbak,
M. J. McCaughey, and C. R. Woese.
1996.
The ribosomal database project (RDP).
Nucleic Acids Res.
24:82-85[Abstract/Free Full Text].
|
| 18.
|
Mannarelli, B. M.,
L. D. Ericsson, and R. J. Stack.
1991.
Taxonomic relationships among strains of the anaerobic bacterium Bacteroides ruminicola determined by DNA and extracellular polysaccharide analysis.
Appl. Environ. Microbiol.
57:2975-2980[Abstract/Free Full Text].
|
| 19.
|
McKain, N.,
R. J. Wallace, and N. D. Watt.
1992.
Selective isolation of bacteria with dipeptidyl aminopeptidase I activity from the rumen.
FEMS Microbiol. Lett.
95:169-174.
|
| 20.
|
McSweeney, C. S.,
R. I. Mackie,
A. A. Odenyo, and D. A. Stahl.
1993.
Development of an oligonucleotide probe targeting 16S rRNA and its application for detection and quantification of the ruminal bacterium Synergistes jonesii in a mixed population chemostat.
Appl. Environ. Microbiol.
59:1607-1612[Abstract/Free Full Text].
|
| 21.
|
Mink, R. W., and R. B. Hespell.
1981.
Long-term nutrient starvation of continuously cultured (nutrient limited) Selenomonas ruminantium.
J. Bacteriol.
148:541-546[Abstract/Free Full Text].
|
| 22.
|
Miyazaki, K.,
J. C. Martin,
R. Marinsek-Logar, and H. J. Flint.
1997.
Degradation and utilization of xylans by the rumen anaerobe Prevotella bryantii (formerly P. ruminicola subsp. brevis) B14.
Anaerobe
3:375-381.
|
| 23.
|
Moyer, C. L.,
F. C. Dobbs, and D. M. Karl.
1994.
Estimation of diversity and community structure through restriction fragment length polymorphism distribution analysis of bacterial 16S rRNA genes from a microbial mat at an active, hydrothermal vent system, Loihi Seamount, Hawaii.
Appl. Environ. Microbiol.
60:871-879[Abstract/Free Full Text].
|
| 24.
|
Nübel, U.,
B. Engelen,
A. Felske,
J. Snaidar,
A. Weishuber,
R. I. Amann,
W. Ludwig, and H. Backhaus.
1996.
Sequence heterogeneities of gene encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis.
J. Bacteriol.
178:5636-5643[Abstract/Free Full Text].
|
| 25.
|
Paster, B. J.,
W. Ludwig,
W. G. Weisburg,
E. Stackbrandt,
R. B. Hespell,
C. M. Hatan,
K. Reichenbach,
O. Stetter, and C. R. Woese.
1985.
A phylogenetic grouping of the bacteroides, cytophagas and certain flavobacteria.
Syst. Appl. Microbiol.
6:34-42.
|
| 26.
|
Rainey, F. A.,
N. L. Ward-Rainey,
P. H. Janssen,
H. Hippe, and E. Stackebrandt.
1996.
Clostridium paradoxum DSM 7308T contains multiple 16S rRNA genes with heterogeneous intervening sequences.
Microbiology
142:2087-2095[Abstract/Free Full Text].
|
| 27.
|
Robinson, I. M.,
S. C. Whipp,
J. A. Bucklin, and M. J. Allison.
1984.
Characterization of predominant bacteria from the colons of normal and dysenteric pigs.
Appl. Environ. Microbiol.
48:964-969[Abstract/Free Full Text].
|
| 28.
|
Shah, H. N.
1992.
The genus Bacteroides and related taxa, p. 3593-3607.
In
A. Balows, H. G. Trüper, M. Dworkin, W. Harder, and K. H. Scheifer (ed.), The prokaryotes: a handbook on the biology of bacteria, isolation, identification, application, 2nd ed. Springer-Verlag, New York, N.Y.
|
| 29.
|
Shah, H. N., and M. D. Collins.
1990.
Prevotella, a new genus to include Bacteroides melaninogenicus and related species formerly classified in the genus Bacteroides.
Int. J. Syst. Bacteriol.
40:205-208[Abstract/Free Full Text].
|
| 30.
|
Stahl, D. A.,
B. Flesher,
H. R. Mansfield, and L. Montgomery.
1988.
Use of phylogenetically based hybridization probes for studies in ruminal microbial ecology.
Appl. Environ. Microbiol.
54:1079-1084[Abstract/Free Full Text].
|
| 31.
|
Stewart, C. S.,
H. J. Flint, and M. P. Bryant.
1997.
The rumen bacteria, p. 10-72.
In
P. N. Hobson, and C. S. Stewart (ed.), The rumen microbial ecosystem. Blackie, London, United Kingdom.
|
| 32.
|
Suzuki, M. T., and S. J. Giovannoni.
1996.
Bias caused by template annealing in the amplification of mixtures of 16S rRNA genes by PCR.
Appl. Environ. Microbiol.
62:625-630[Abstract].
|
| 33.
|
van Gylswyk, N. O.
1990.
Enumeration and presumptive identification of some functional groups of bacteria in the rumen of dairy cows fed grass silage based diets.
FEMS Microbiol. Ecol.
73:243-254.
|
| 34.
|
von Wintingerode, F.,
U. B. Göbel, and E. Stackebrandt.
1997.
Determination of microbial diversity in environmental samples: pitfalls of PCR-based rRNA analysis.
FEMS Microbiol. Rev.
21:213-229[Medline].
|
| 35.
|
Wang, R.-F.,
W.-W. Cao, and C. E. Cernaglia.
1996.
PCR detection and quantitation of predominant anaerobic bacteria in human and animal fecal samples.
Appl. Environ. Microbiol.
62:1242-1247[Abstract].
|
| 36.
|
Weisburg, W. G.,
S. M. Barns,
D. A. Pelletier, and D. J. Lane.
1991.
16S ribosomal DNA amplification for phylogenetic study.
J. Bacteriol.
173:697-703[Abstract/Free Full Text].
|
| 37.
|
Wilson, K. H., and R. B. Blitchington.
1996.
Human colonic biota studied by ribosomal DNA sequence analysis.
Appl. Environ. Microbiol.
62:2273-2278[Abstract].
|
| 38.
|
Woese, C. R.
1987.
Bacterial evolution.
Microbiol. Rev.
51:221-271[Free Full Text].
|
Applied and Environmental Microbiology, October 1998, p. 3683-3689, Vol. 64, No. 10
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Shanks, O. C., Kelty, C. A., Sivaganesan, M., Varma, M., Haugland, R. A.
(2009). Quantitative PCR for Genetic Markers of Human Fecal Pollution. Appl. Environ. Microbiol.
75: 5507-5513
[Abstract]
[Full Text]
-
Marti, R., Dabert, P., Pourcher, A.-M.
(2009). Pig Manure Contamination Marker Selection Based on the Influence of Biological Treatment on the Dominant Fecal Microbial Groups. Appl. Environ. Microbiol.
75: 4967-4974
[Abstract]
[Full Text]
-
Duncan, S. H., Aminov, R. I., Scott, K. P., Louis, P., Stanton, T. B., Flint, H. J.
(2006). Proposal of Roseburia faecis sp. nov., Roseburia hominis sp. nov. and Roseburia inulinivorans sp. nov., based on isolates from human faeces.. Int. J. Syst. Evol. Microbiol.
56: 2437-2441
[Abstract]
[Full Text]
-
Shanks, O. C., Santo Domingo, J. W., Lamendella, R., Kelty, C. A., Graham, J. E.
(2006). Competitive metagenomic DNA hybridization identifies host-specific microbial genetic markers in cow fecal samples.. Appl. Environ. Microbiol.
72: 4054-4060
[Abstract]
[Full Text]
-
Peu, P., Brugere, H., Pourcher, A.-M., Kerouredan, M., Godon, J.-J., Delgenes, J.-P., Dabert, P.
(2006). Dynamics of a Pig Slurry Microbial Community during Anaerobic Storage and Management.. Appl. Environ. Microbiol.
72: 3578-3585
[Abstract]
[Full Text]
-
Fogarty, L. R., Voytek, M. A.
(2005). Comparison of Bacteroides-Prevotella 16S rRNA Genetic Markers for Fecal Samples from Different Animal Species. Appl. Environ. Microbiol.
71: 5999-6007
[Abstract]
[Full Text]
-
Dick, L. K., Bernhard, A. E., Brodeur, T. J., Santo Domingo, J. W., Simpson, J. M., Walters, S. P., Field, K. G.
(2005). Host Distributions of Uncultivated Fecal Bacteroidales Bacteria Reveal Genetic Markers for Fecal Source Identification. Appl. Environ. Microbiol.
71: 3184-3191
[Abstract]
[Full Text]
-
Walker, N. D., McEwan, N. R., Wallace, R. J.
(2003). Cloning and functional expression of dipeptidyl peptidase IV from the ruminal bacterium Prevotella albensis M384T. Microbiology
149: 2227-2234
[Abstract]
[Full Text]
-
Fields, M. W., Russell, J. B.
(2001). The glucomannokinase of Prevotella bryantii B14 and its potential role in regulating {beta}-glucanase expression. Microbiology
147: 1035-1043
[Abstract]
[Full Text]
-
Barcenilla, A., Pryde, S. E., Martin, J. C., Duncan, S. H., Stewart, C. S., Henderson, C., Flint, H. J.
(2000). Phylogenetic Relationships of Butyrate-Producing Bacteria from the Human Gut. Appl. Environ. Microbiol.
66: 1654-1661
[Abstract]
[Full Text]
-
Pryde, S. E., Richardson, A. J., Stewart, C. S., Flint, H. J.
(1999). Molecular Analysis of the Microbial Diversity Present in the Colonic Wall, Colonic Lumen, and Cecal Lumen of a Pig. Appl. Environ. Microbiol.
65: 5372-5377
[Abstract]
[Full Text]