This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Polz, M. F.
Right arrow Articles by Cavanaugh, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Polz, M. F.
Right arrow Articles by Cavanaugh, C. M.
Agricola
Right arrow Articles by Polz, M. F.
Right arrow Articles by Cavanaugh, C. M.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, October 1998, p. 3724-3730, Vol. 64, No. 10
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Bias in Template-to-Product Ratios in Multitemplate PCR

Martin F. Polzdagger and Colleen M. Cavanaugh*

The Biological Laboratories, Harvard University, Cambridge, Massachusetts 02138

Received 13 April 1998/Accepted 13 July 1998

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Bias introduced by the simultaneous amplification of specific genes from complex mixtures of templates remains poorly understood. To explore potential causes and the extent of bias in PCR amplification of 16S ribosomal DNAs (rDNAs), genomic DNAs of two closely and one distantly related bacterial species were mixed and amplified with universal, degenerate primers. Quantification and comparison of template and product ratios showed that there was considerable and reproducible overamplification of specific templates. Variability between replicates also contributed to the observed bias but in a comparatively minor way. Based on these initial observations, template dosage and differences in binding energies of permutations of the degenerate, universal primers were tested as two likely causes of this template-specific bias by using 16S rDNA templates modified by site-directed mutagenesis. When mixtures of mutagenized templates containing AT- and GC-rich priming sites were used, templates containing the GC-rich permutation amplified with higher efficiency, indicating that different primer binding energies may to a large extent be responsible for overamplification. In contrast, gene copy number was found to be an unlikely cause of the observed bias. Similarly, amplification from DNA extracted from a natural community to which different amounts of genomic DNA of a single bacterial species were added did not affect relative product ratios. Bias was reduced considerably by using high template concentrations, by performing fewer cycles, and by mixing replicate reaction preparations.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The PCR has become an invaluable tool because of the speed and simplicity with which specific DNA segments can be amplified from a background of complex genomes (3, 5). In studies of molecular evolution (29) and microbial ecology (26) this property has facilitated the characterization of both single genes and families of related genes in single or multiple species. This is generally done by designing degenerate primers which target conserved regions of homologous genes, thereby accelerating the detection, amplification, and, ultimately, sequence analysis of the genes under study.

One of the most innovative applications of the PCR has been the cataloging of bacterial and archaeal species richness in the environment. Mixtures of 16S rRNA genes amplified from natural communities are considered representative of the native organisms from which they originated. This approach has revealed the existence of numerous uncultured microorganisms because it circumvents bias introduced by traditional culture-based methods (7), which typically detect only a fraction (<1%) of the total bacteria present in an environment (2). The protocols involve extraction of nucleic acids from an environmental sample, PCR amplification of the 16S rRNA genes with universal, degenerate primers, and separation of amplified products by cloning or by denaturing gradient gel electrophoresis (DGGE) (15). Subsequently, clones or bands on DGGE gels can be used in sequencing and in analyzing phylogenetic diversity. Since in most cases the ultimate goal is to obtain a picture of microbial community composition that is not affected by selective cultivation, the protocols include the implicit assumption that PCR amplification proceeds without major bias; that is, numerically important organisms in the environment are expected to be represented by dominant clones in libraries or by strong bands on DGGE gels.

The following two major classes of processes may skew template-to-product ratios based on theoretical modeling of PCR: (i) PCR selection and (ii) PCR drift (29). The first class comprises all mechanisms which inherently favor the amplification of certain templates due to properties of the genes, of their flanking sequences, or of the overall genome. Potentially important contributors to PCR selection among these mechanisms are preferential denaturation due to overall low GC content, higher binding efficiency of GC-rich permutations of degenerate primers, differential accessibility of rRNA genes within genomes, and correlation between amplification probabilities and gene copy numbers within genomes. The second type of bias is assumed to be caused by stochastic variation in the early cycles of the reaction (when amplification still proceeds largely from the genomic templates), and its outcome should therefore not be reproducible in replicate PCR amplifications. Bias in amplification from mixtures of 16S ribosomal DNAs (rDNAs) has only recently begun to be explored experimentally (4, 6, 21, 27).

In the most extensive study to date on bias in amplification of 16S rDNAs, Suzuki and Giovannoni (27) demonstrated that the importance of different bias-causing mechanisms may change over the course of an amplification. These authors used combinations of different primers to amplify pairs of PCR products. Under the conditions used, primer pairs with high amplification efficiency resulted in reactions entering the plateau phase (i.e., products arriving at saturation concentrations [10-7 M]) (23). Since templates which reach saturation concentrations essentially stop amplifying while others are still increasing (23), a kinetic bias towards 1:1 product ratios independent of the starting template concentrations was observed (27). However, primer pairs with lower amplification efficiency resulted in product concentrations below the saturation concentrations, and depending on the template pair, either the expected product ratio or bias was observed, for which no explanation could be given (27). Similarly, in an attempt to evaluate the effect of 16S rRNA gene copy number and genome size, Farrelly et al. (6) noted bias in amplifications from template pairs which could not be explained.

In the present study we investigated the potential extent, causes, and minimization of bias in PCR amplification from mixtures of 16S rDNA templates. Amplification of full-length genes with commonly used universal, degenerate primers was used to mimic realistic conditions in molecular diversity studies. In all experiments, bias due to template saturation (27) was avoided by adjusting reaction parameters so that the plateau phase was not reached. Initially, mixtures of genomic DNAs of different species were used to determine the relative contribution of PCR selection and PCR drift to bias in template-to-product ratios. The effect of varying the ratios of rDNA templates in reaction mixtures (gene dosage) and the effect of different AT-GC contents of the degenerate primers were investigated as potential major causes of PCR selection. In addition, the effect of the relative amount of a specific template in a complex mixture (genome dosage) on amplification efficiency was tested by adding different amounts of genomic DNA of one species to nucleic acids extracted from a natural community. Based on these experiments, we investigated alterations of reaction protocols that may reduce bias in amplification of multitemplate mixtures.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Bacterial strains and culture conditions. Vibrio fischeri ES1114 and Vibrio anguillarum 775 were generous gifts from Edward Ruby (University of Hawaii). Cells were grown at room temperature in SWT medium containing (per liter) 5 g of Bacto Tryptone (Difco), 3 g of yeast extract (Difco), 3 ml of glycerol, 700 ml of seawater, and 300 ml of distilled water. Escherichia coli INValpha F' was purchased from Invitrogen and was grown in Luria-Bertani broth (22).

Nucleic acid extraction. DNAs from both Vibrio strains and from E. coli were extracted and purified by the method of Jarrell et al. (8), with slight modifications (17). Purified DNA from Bacillus subtilis RL202 was a generous gift from Len Duncan (Harvard University). Community nucleic acids were extracted from a coastal microbial community (Woods Hole, Mass.). Cells from 20 liters of prefiltered (pore size, 1 µm) water were concentrated with a 0.22-µm-pore-size Micro Culture Capsule filter (Gelman Sciences) in September 1994 provided by Meredith Hullar (Harvard University). Cells were lysed by incubation with sodium dodecyl sulfate and proteinase K freeze-boiling cycles as described previously (16) followed by standard phenol-chloroform extraction (22).

PCR primers. Primers 27F and 1492R (Table 1) were used for amplification from genomic DNA and from PCR products in experiments performed to determine the causes and extent of bias; these primers are frequently used in molecular diversity studies because they result in a nearly full-length 16S rDNA product and are considered universal for the domain Bacteria and for the domains Archaea and Bacteria, respectively (11). Each primer contains a single degeneracy, which is between A and C at position 19 (E. coli numbering) in primer 27F and between T and C at position 1497 in primer 1492R (Table 1).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Designations and targets of amplification primers and hybridization probes

PCR templates. Amplifications with primers 27F and 1492R were conducted with the following template mixtures: (i) three bacterial genomic DNAs, (ii) purified PCR products of different mutagenized E. coli 16S rDNAs, and (iii) V. anguillarum DNA and nucleic acids extracted from the aquatic community.

(i) Genomic DNAs. In experiments performed to determine PCR drift and selection and reduction of bias, the template used consisted of a mixture of equal amounts (as determined by spectrophotometry) of total genomic DNAs of B. subtilis, V. anguillarum, and V. fischeri.

(ii) Mutagenized E. coli 16S rDNAs. The effects of primer degeneracies and gene dosage were determined with pairwise mixtures of three mutagenized E. coli 16S rDNA templates, Eco(GC), Eco(AT), and Eco(AT)m. Eco(GC) and Eco(AT) differed only at the single degenerate position in each of the priming sites for 27F and 1492R (Table 1). Eco(AT)m differed from Eco(AT) and from Eco(GC) as follows: six nucleotides in the middle of the molecule were altered by site-directed mutagenesis. Eco(GC) and Eco(AT)m templates were mixed in equal amounts in the primer degeneracy experiments, and Eco(AT) and Eco(AT)m were mixed at 1:1, 1:5, 1:10, and 1:20 ratios in the gene dosage experiments.

The three mutagenized templates were generated as follows. Nondegenerate versions of primers 27F and 1492R (Table 1) were used in two combinations, 27F(A)-1492R(T) and 27F(C)-1492R(C). The resulting PCR products, Eco(AT) and Eco(GC), were cloned. Subsequently, in a cloned Eco(AT) 16S rDNA fragment, nucleotides 450 to 455 were changed to their complements by using a PCR site-directed mutagenesis protocol (7a). First, a reaction was carried out with a mutagenesis primer (TTAACTTTACTGGGAAGCTCCCCGCTGA; positions 439 to 466) and primer 27F(A) (Table 1), which created a 458-bp product. This product was gel purified and used as a primer in a second reaction together with primer 1492R(T) (Table 1). The mutagenized 16S rDNA was cloned and is referred to below as Eco(AT)m.

The effects of primer degeneracies and gene dosage were tested by using PCR products amplified from the Eco(GC), Eco(AT), and Eco(AT)m clones as templates. These products were generated with primers M13 reverse and M13(-40), which resulted in 16S rRNA gene fragments flanked by roughly 200 bp of plasmid-derived sequence, allowing purification of amplification products from templates before blotting and quantitative analysis. In all cases, templates were generated from clones in which the 16S rDNAs had the same orientation to avoid any potential influence of different flanking sequences on primer hybridization during the PCR. PCR products were quantified by comparison with standards on an agarose gel by using the Eagle Eye gel imaging and quantification system (Stratagene).

(iii) V. anguillarum and community DNA. The influence of the relative amount of a specific template in a complex mixture on product distribution was tested with a mixture of V. anguillarum DNA and nucleic acids extracted from a natural community. Both types of nucleic acids were quantified spectrophotometrically, and the template mixture was generated by adding V. anguillarum DNA to final concentrations of 10, 1, and 0.1%.

PCR conditions. All reactions were performed with a Twin Block System and a Power Block I System thermal cycler (Ericomp). The reaction volume was either 100 or 25 µl, and each reaction mixture contained 1× PCR buffer (50 mM KCl, 10 mM Tris-HCl, 1% Triton X-100), each deoxynucleoside triphosphate at a concentration of 200 µM, 2.0 mM MgCl2, 5% acetamide (in reactions in which genomic DNA was the template), each primer at a concentration of 100 pM, and 0.025 U of Taq polymerase (Promega) per µl. Acetamide was included in the reaction mixtures containing genomic DNAs because it has been reported to increase denaturation of templates with high GC contents during the PCR temperature cycles (21). For replicate PCR amplifications, aliquots were taken from a single master mixture. The template concentration used was 0.1 ng of total genomic DNA per µl or 5 pg of purified PCR product per µl in 25-cycle amplifications and 5 ng of total genomic DNA per µl in 5- and 10-cycle amplifications.

All amplifications started with an initial denaturation step consisting of 94°C for 3 min; this was followed by cycles consisting of 1 min at 94°C, 1 min at 50°C, and 2 min at 72°C. To avoid bias associated with product saturation (27), the amounts of product accumulated after different numbers of cycles with each of the different template combinations were determined by spectrophotometry and by liquid scintillation counting of incorporated 32P-labeled dCTP (12). This showed that after 25 cycles the products were still being produced exponentially (data not shown). Thus, the number of cycles used in the experiments designed to identify the extent and possible mechanisms of bias was 25. In other experiments, the numbers of cycles were decreased to 5 and 10 in order to determine the effect of fewer cycles on product bias. To avoid false priming of the genomic templates at low temperatures (3, 5), a type of hot-start PCR was used. In each amplification tube, a lower reservoir containing water, buffer, and enzyme was created by sealing it off with 50 µl of molten Paraplast wax. After solidification of the wax, the rest of the reagents were added to the tube and sealed with an additional 50 µl of molten wax. This wax had a melting point of 56°C and floated to the top of the liquid during the initial denaturation step of the amplification.

Oligonucleotide probe design, labeling, and determination of Td and specificity. Specific oligonucleotide probes for the different bacterial species were designed based on an alignment obtained from the Ribosomal Database Project (RDP) (13). For differentiation of the Vibrio species and B. subtilis, a 20-nucleotide stretch was identified (positions 219 to 238 [E. coli numbering]) which had the same GC content (60%) (Table 1). Probes Eco and EcoM were designed to differentiate the native E. coli 16S rDNA template from mutagenized versions (Table 1).

The midpoint dissociation temperatures (Tds) of oligonucleotides were determined experimentally to optimize the relationship between signal strength and specificity of the probes as described by Raskin et al. (20), with modifications (18). Each nucleic acid type was blotted in duplicate with a Minifold I dot blotter (Schleicher & Schuell) onto Zetaprobe nylon membranes (Bio-Rad) by using the alkaline denaturation method performed according to the instructions supplied. The oligonucleotide probes were labeled with polynucleotide kinase (Gibco BRL) so that they contained 5 × 106 cpm/pmol and were purified with NenSorb 20 cartridges (Du Pont NEN). Hybridizations were performed at 30°C overnight in the recommended buffer (Zetaprobe) by using the specific probes. Subsequently, the membranes were washed twice for 15 min at the same temperature. Individual dots were then cut out and washed in 2 ml of wash buffer in 7-ml scintillation vials which had been prewarmed in water baths at temperatures ranging from 20 to 65°C at 2 to 5°C intervals. After 10 min the membranes were removed, and the amounts of radioactivity in the wash solutions and on the membranes were determined by liquid scintillation counting. The Tds were calculated by dividing the counts remaining on each membrane by the total counts for each temperature point. The resulting values were then plotted as percentages of probe washed off versus temperature, and the 50% value was considered the Td.

Probe specificity was determined (i) by hybridizing the Van, Vfi, and Bsu probes with a blot containing both genomic DNAs and PCR-generated 16S rDNAs of the three species and (ii) by hybridizing the Eco and EcoM probes with a blot containing PCR products of native and mutagenized E. coli 16S rDNAs. The blots were hybridized and washed by using the conditions specified above except that the 15-min specific wash was at the Td only. Specific labeling and background were determined by exposing membranes on Reflection NEF-496 (Du Pont) X-ray film and by quantification of the radioactivity by using a Fujix BAS200 phosphorimager and BAS2000 Image File Manager 2.1 analysis software.

Quantitative dot blot hybridizations. Quantitative dot blot hybridizations were carried out to determine 16S rDNA template and product ratios. Membranes were blotted with template and/or PCR product combinations and hybridized with specific probes as follows: (i) for PCR drift and PCR selection tests, three identical blots containing a mixture of three genomic templates (V. anguillarum, V. fischeri, and B. subtilis), five individual replicate amplifications (PCR 1 to 5), and a mixture of 10 replicate amplifications (PCR mixture) hybridized with probes Bsu, Van, and Vfi; (ii) for primer degeneracy tests, two identical blots containing a 1:1 mixture of Eco(GC) and Eco(AT)m mutagenized E. coli 16S rDNA templates and five replicate amplifications after 15, 25, and 35 cycles hybridized with probes Eco and EcoM; (iii) for gene dosage tests, two identical blots containing five replicate amplifications from 1:1, 1:5, 1:10, and 1:20 template mixtures of Eco(AT) and Eco(AT)m mutagenized E. coli 16S rDNA fragments hybridized with probes Eco and EcoM; (iv) for genome dosage tests, two identical blots containing three replicate amplifications from nucleic acids extracted from a natural community to which V. anguillarum DNA had been added at concentrations corresponding to 0.1, 1, and 10% of the total amount hybridized with probes Van and Eub; and (v) for a test of reduced cycle numbers, three identical blots containing the original three-genomic-template mixture (V. anguillarum, V. fischeri, and B. subtilis) and mixtures of 10 replicate amplifications after 5 and 10 cycles hybridized with probes Bsu, Van, and Vfi.

Before blotting, PCR products were purified from templates on 0.8% agarose gels (Qiaquick; Qiagen). In experiments in which 10 replicate PCR amplifications were mixed, the products of the reactions were concentrated individually by using Microcon 100 filtration devices (Amicon), purified, and eluted from 0.8% agarose gels. Then, after their concentrations were determined by spectrophotometry, subsamples of each of the 10 PCR amplifications containing equal amounts of DNA were mixed and blotted (PCR mixture).

In the experiments performed to explore PCR drift and PCR selection, three membranes containing nine replicate dots of each of the three classes of nucleic acids (template mix, PCR 1 to 5, and PCR mixture) were blotted. In the experiments designed to test the influence of reduced cycle numbers, three identical membranes containing eight replicate dots of the template mixture and the product mixture from 10 replicate PCR carried out for 5 and 10 cycles were blotted. This resulted in standard deviations for the replicate dots that were less than 5% of the mean for all samples spotted with nine and eight replicates. In all other experiments, two membranes were blotted with three replicate dots per class of nucleic acid. For 37 of the 76 samples in which three replicates were used the standard deviations were less than 5% of the mean. For most of the rest of the samples the standard deviations were less than 10%; the only exceptions were two samples which had standard deviations of 12 and 16%.

All hybridizations were carried out as described above, using a 10-fold molar excess of probe over target and 1 ml of hybridization buffer per dot. Bound probe was quantified by phosphorimaging, and average signals were calculated for each specific template or PCR product in the different classes of nucleic acids (e.g., B. subtilis in template mixture, in PCR mixture, or in replicate PCR). Subsequently, pairwise ratios of the averages (e.g., B. subtilis signal over V. fischeri signal in PCR mixure) were determined. To facilitate interpretation, the PCR product signals were normalized to the template mixture signal by calculating a constant factor for each template pair. For example, the ratio of 1.1 obtained from the hybridization intensities of the genomic mixture with the B. subtilis-V. anguillarum pair was multiplied by 0.91 to normalize it to 1.0. Subsequently, all other ratios (PCR mixture, PCR 1 to 5) determined for this species pair were multiplied by the same factor. In gene and genome dosage experiments in which PCR product ratios were compared to one another, signal ratios were corrected for differences in specific activities of the hybridization probes. Standard deviations of the ratios were calculated from all possible combinations of denominators and numerators in a given experiment and generally were less than 10% of the average.

Nucleic acid sequencing. The 16S rRNA genes of all three species were sequenced partially to ensure sequence identity between all of the strains used in this study and the strains represented in the RDP. Three clones of each species were sequenced by using primer 519R (11), which covers two of the most variable regions in the 16S rRNA molecule. Furthermore, sequences in the 1492R priming region of the two Vibrio species were determined since they were not available in the databases. A 16S rDNA fragment was amplified by PCR as specified above, except that primer 1525R (11) was used in place of 1492R. The resulting product was purified and cloned into the PCR II vector (Invitrogen, San Diego, Calif.). Three clones of each of the Vibrio species were sequenced by using primers 1406F and 1525R (11).

All of the clones resulting from the in vitro mutagenesis experiments were checked by sequencing for the correct, expected sequence by using M13 primers or internal 16S rDNA primers (11).

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Td and specificity of oligonucleotides. The experimentally determined Tds for oligonucleotide probes Bsu, Van, Vfi, Eco, and EcoM were 52.5, 53.0, 46.2, 49.0, and 44.1°C, respectively (data not shown). These temperatures were used in the high-temperature wash step of the quantitative dot blot hybridizations.

Under the conditions used, all of the probes reacted specifically with their target molecules (Fig. 1). No background was observed with probe-target mismatches with either the different genomic DNAs or the PCR. X-ray films remained completely clear after 5-h exposures. Likewise, quantification by phosphorimaging yielded background values only for the exposure times used for the quantitative analysis (data not shown).


View larger version (50K):
[in this window]
[in a new window]
 
FIG. 1.   Dot blot analyses showing the specificity of the oligonucleotide probes for their targets. (A) Genomic DNAs (left dots) and PCR-amplified 16S rDNAs (right dots) of B. subtilis, V. fischeri, and V. anguillarum were blotted together on three replicate membranes and hybridized with the specific probes Bsu, Van, and Vfi, respectively. (B) PCR-amplified 16S rDNAs of mutagenized plasmids Eco(GC), Eco(AT), and Eco(AT)m were blotted on two separate membranes and hybridized with the specific probes Eco and EcoM, respectively. The electronic image was taken from X-ray film exposed for 5 h.

Quantification of PCR bias. The underlying rationale of the initial experiments was that if bias in PCR amplifications is due to stochastic fluctuations (PCR drift), it would not be reproducible in replicate reactions, whereas if it is a property of the templates (PCR selection), the same pattern of bias would be observed in individual amplifications. When signal ratios for the different species pairs were compared, the ratios of the genomic templates never corresponded to the ratios of the PCR products (Table 2). If all three templates had been amplified with the same efficiency, all of the ratios should have been similar to the ratios of the genomic DNAs. The error due to between-dot variability in the hybridizations was small because a large number of replicates were blotted for all treatments. The largest bias was observed for B. subtilis 16S rDNA, which was amplified with much higher efficiency than the DNAs of the two Vibrio species. When the two Vibrio templates were compared, V. anguillarum DNA was amplified less than V. fischeri DNA and overall was the least-well-represented DNA (Table 2). A detailed comparison also revealed variation among the ratios of the individual PCR products (Table 2). Most values remained within ±0.3 unit of the PCR mixture. However, some extreme cases occurred, as illustrated by the B. subtilis-V. fischeri pair in PCR 5, which differed 1.2-fold.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Comparison of 16S rDNA gene template and PCR product ratios in simultaneous PCR amplifications of three bacterial genomes with degenerate primersa

The GC content of the priming region had a significant effect on the efficiency of amplification of the templates studied. In 1:1 mixtures of a pair of mutagenized E. coli 16S rDNAs [Eco(GC) and Eco(AT)m], the template with the GC-rich permutation in the priming site was consistently amplified better than the AT-rich permutation (Table 3). This unequal effectiveness of amplification increased with cycle number (Table 3); the average product ratios were 1.4, 1.7, and 2.2 after 15, 25, and 35 cycles, respectively.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 3.   Effect of primer degeneracies on PCR product ratiosa

Gene dosage alone had no discernible effect on product ratios (Fig. 2). Two mutagenized E. coli 16S rDNA templates, Eco(AT) and Eco(AT)m, which differed only in the six nucleotides recognized by probes Eco and EcoM, respectively, were mixed at ratios of 1:1, 1:5, 1:10, and 1:20. Least-squares linear regression analysis of the average product ratios for three replicate amplifications per ratio indicated that amplification was proportional to template representation (r2 = 0.998) (Fig. 2).


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 2.   Effect of gene dosage as determined by amplification with different template ratios of Eco(AT) and Eco(AT)m and quantification of product ratios by quantitative dot blotting with probes Eco and EcoM. Regression analysis showed that the relationship between template and product ratios was linear. The vertical bars indicate standard deviations.

Genome dosage also did not influence product ratios to a large and consistent extent under the conditions used (Table 4). V. anguillarum genomic DNA was added at concentrations equivalent to 10, 1, and 0.1% of the total DNA to DNA extracted from a natural microbial community and was amplified with the universal primers. The product ratios determined with the specific probe Van and the universal (eu)bacterial probe Eub (Table 1) (1) indicated that proportional amplification occurred (Table 4). The values for the product ratios at the 10% dilution were approximately 10 times higher than the values at the 1% dilution (Table 4). However, the coefficient of variation of the product ratios for the three replicate amplifications increased from 3% at the 10% dilution to 12% at the 1% dilution, indicating that there was a lower level of reproducibility at the lower template concentration. Ratios for the 0.1% dilution could not be determined because there was not enough V. anguillarum product.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 4.   Reproducibility of PCR amplification of a single template in a complex mixture of nucleic acids from a natural communitya

To test the hypothesis that accumulation of bias is largely template inherent and additive with every cycle, the effect of decreasing the number of cycles on PCR product ratios was examined. The same three-species mixture was used in these experiments. While the same pattern of overamplification was observed, the differences between template ratios and PCR mixture ratios were considerably smaller in all cases (Table 5). Indeed, the product ratio approached the template ratio when the numbers of cycles were 10 and 5 (Table 5).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 5.   Effect of lower number of cycles of the PCR on skewing of product ratiosa

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The results of this study indicate that PCR product ratios can be significantly biased in standard amplifications of mixed templates (Table 2). Under the experimental conditions used, mechanisms summarized under PCR drift appeared to cause little bias, but occasional extremes occurred (e.g., PCR 5 in Table 2). PCR selection emerged as the force driving unequal amplification of templates, and different binding energies of degenerate primers were a major contributor (Table 3). Considerable bias was observed even though the effects of PCR selection may have been counterbalanced to a large extent by kinetic bias as observed by Suzuki and Giovannoni (27) (i.e., progressive reduction in the amplification efficiency of specific products). Overall, the results suggest that product distributions are reproducible despite being biased in an a priori unpredictable fashion. In addition, the effects of PCR selection can be reduced by performing short-cycle PCR amplifications with high template concentrations (Table 5).

PCR drift. The observed deviations could be caused by (i) true PCR drift rooted in the reaction mechanism and (ii) errors perceived as PCR drift but really introduced by the experimenter. A low template concentration in the early cycles may lead to stochastic fluctuation in the interactions of PCR reagents, especially primer annealing to the genomic template. In the experiments presented here, PCR drift may actually have been minimized because templates were added at relatively high starting concentrations (Table 2). However, in other investigations performed to test the effect of low template concentrations, product distribution and yield exhibited very low reproducibility, and some specific products were missing from some replicate amplifications (4, 9, 14). Perceived PCR drift may stem from pipetting errors between replicates, from variations in the thermal profiles of different wells, or from unequal ramping temperatures in thermal cyclers, which may affect templates differentially. While the first possibility was minimized by using master mixtures, we have no means of differentiating the second possibility from true PCR drift. However, independent of the causes, the data emphasize the danger of using a single PCR amplification for analysis of microbial communities by cloning or DGGE because the variation between replicates is unpredictable and can be large (Table 2).

PCR selection. PCR selection may be caused to a large extent by differences in the GC content at degenerate positions in the primer target sites in the 16S rDNAs. This was indicated by the occurrence of bias in the product pairs of the three species and of the E. coli 16S rDNAs, which were mutagenized to differ essentially only in the amplification sites (Tables 2 and 3). The consistent overamplification of the B. subtilis template may also have been largely due to higher primer affinity for the priming region due to higher GC content. Inspection of the sequences in the RDP database and partial sequencing indicated that at both degenerate positions of the two primers B. subtilis has a G, whereas the two Vibrio species have an A or T (Fig. 3). This sequence variation is reflected in the widely used 16S rDNA amplification primers 27F and 1492R (11), each of which contains a single degeneracy (between A and C and between T and C, respectively) (Table 1; Fig. 3). Because both G and C form a triple hydrogen bond, the melting temperatures of the GC-rich permutations of both primers are theoretically about 2°C higher than the AT-rich permutation. Thus, at each annealing step a greater proportion of the templates containing GC complements in the priming region should hybridize to their matched primers. The alternative explanation for the observed continuous buildup of bias (Tables 2 and 3) is that AT-containing primers are more effective than GC-containing primers in forming mismatched hybrids. However, due to the much lower thermal stability of mismatches, this possibility appears less likely. The unexplained bias observed in other studies (6, 27) may also have been due to primer degeneracy effects, but interpretation of the data is hampered by a lack of sequence information in the databases for the templates used.


View larger version (14K):
[in this window]
[in a new window]
 
FIG. 3.   Alignment of the sequences of universal amplification primers 27F and 1492R and their target regions on the 16S rRNA genes of B. subtilis, V. fischeri, and V. anguillarum. The two primers each contain a single degeneracy (between C and T and between C and A, respectively). In the B. subtilis gene both priming sites contain a G at the degenerate site, which most likely results in a higher melting temperature for the primer-target duplex than the melting temperature for the two Vibrio genes, which contain an A and a T at the two positions.

PCR bias due to gene and genome dosage effects was not detected (Fig. 2, Table 4). Farrelly et al. (6) have suggested that such dosage effects cause bias (6) and have argued that 16S rDNAs from species with higher rrn operon numbers should be amplified better than 16S rDNAs from species with lower rrn operon numbers. Indeed, a similar explanation for the overamplification of the B. subtilis 16S rDNA from the mixture containing three species (Table 2) could not be ruled out a priori. Total genomic DNAs were mixed at a ratio of 1:1:1, and both operon number and genome size could have skewed the product distribution in favor of B. subtilis. This species has 10 rrn operons and a genome size of 4,165 kb (6); in contrast, V. fischeri has only 8 rrn operons (10) and a slightly larger genome (4,550 kb) (24) (no rrn operon data are available for V. anguillarum). However, a strong effect of gene copy number or genome copy number in amplification was not supported by our experiments. Regression analysis of the products amplified with the different template ratios gave no indication of deviation from a linear relationship (Fig. 2). Similarly, different amounts of the V. anguillarum genome in a complex community resulted in no major or consistent amplification bias (Table 4). Whether equally high levels of reproducibility occur with templates present at much lower levels, such as V. anguillarum added at a concentration equivalent to 0.1% of the total community DNA concentration, could not be tested by the quantitative hybridization approach used here.

Two lines of evidence point to the existence of additional factors that cause PCR selection in addition to primer degeneracies. First, when 25 cycles were used, the average B. subtilis/V. fischeri ratio was 2.3 (Table 2), whereas the average Eco(GC)/Eco(AT)m ratio was only 1.7 (Table 3), suggesting that primer degeneracies accounted for only about one-half of the overamplification. Second, there was also bias with the closely related Vibrio species (Table 2). Both of these species have the same sequence in the priming sites (Fig. 3), and their 16S rDNAs are 93.9% identical, yet the V. fischeri template was consistently amplified better (Tables 2 and 5). Although it is impossible to determine a definitive cause, a number of additional factors may have contributed to the bias observed. Sequence regions immediately adjacent to the priming sites may have influenced the hybridization efficiency of the primers, as suggested by Td studies of universal oligonucleotide probes with different templates (30). Single strands of 16S rDNA are potentially prone to secondary-structure formation during product extension, which may cause the polymerase to fall off. Furthermore, differences in the GC contents of the 16S rDNA templates or the whole genomes may lead to differential denaturation of templates. However, in the case of the vibrios, the GC contents are only slightly different; V. fischeri genomes contain 39 to 41% GC, whereas V. anguillarum genomes contain 43 to 44% GC. If overall differences in GC content, as well as the specific priming sites, are a cause of product bias, this problem may be exaggerated in natural samples, in which the differences between genomes typically far exceed the 5% maximum difference between the two Vibrio species examined.

Reduction of PCR bias. The effects of PCR bias were decreased by (i) mixing several replicate PCR amplifications and (ii) reducing the numbers of cycles. The five replicate amplifications which were assayed individually showed good agreement with the PCR mixture, which was a composite of 10 replicate amplifications (Table 2). Thus, as suggested by Chandler et al. (4), pooling replicates may be an effective way to decrease variation in the amplification process; this is especially true for those templates which are present at low initial concentration in the sample. Reduction of the number of cycles had the most dramatic effect (Table 5). Overamplification of the Bacillus template was reduced to ratios of 1.7 and 2.2 with 10 cycles and decreased to ratios of 1.3 and 1.5 with 5 cycles (Table 5). The bias between the two Vibrio species was also reduced, and the ratio was close to the original template ratio (Table 5).

Recommendations and conclusions. The following recommendations for limiting bias in PCR amplifications emerged from the data presented above. First, whenever possible, degeneracies should be avoided when universal primers are designed. Second, to increase reproducibility between replicates, amplifications should be carried out by using high template concentrations. Third, to minimize PCR drift, several replicate PCR amplifications should be combined. Fourth, to diminish PCR selection, the smallest number of cycles should be used. Since cloning utilizes only a very small amount of DNA, 10 cycles or even 5 cycles may be enough if a high template concentration (>500 ng of genomic DNA per tube) is used. In a PCR which started with 500 ng of template, after 10 cycles a discrete band on a standard agarose gel was easily detectable with a subsample as small as 5 µl (unpublished observations). Alternatively, combining several replicates should yield enough product to be analyzed by electrophoretic methods, such as DGGE.

Overall, the results indicate that PCR analysis is a method with relatively high precision but potentially low accuracy; that is, product distributions are reproducible, but template-inherent factors may lead to significant deviations from template distributions. These results support the validity of quantitative PCR approaches, in which internal standards are added, but show the limitations of multitemplate amplifications. Even in the simple three-species community tested, relatively large PCR selection was observed. How PCR selection will skew amplifications from natural communities with potentially thousands of species (28) and with templates that may be even more prone to overamplification cannot be predicted at this time. In addition, estimates of cell numbers based on amounts of products are skewed by the highly variable operon numbers in different species (6, 10). This emphasizes the fact that quantitative interpretation of PCR-based results should still be viewed with caution. In the future, it will be important to explore PCR bias further to arrive at measures which result in confidence in product distributions in molecular diversity studies of natural communities. Currently, quantitative oligonucleotide probing (18, 19, 25) and in situ hybridization (2) still provide ecologically more meaningful measures of the relative importance of specific microorganisms.

    ACKNOWLEDGMENTS

This work was supported by grants from the National Science Foundation and the Office of Naval Research to C.M.C.

We thank Christopher Harbison for help with sequencing, Charles Harvey and Dennis McLaughlin for help with statistics, Stephen Giovannoni, Daniel Distel, and Christian Luschnig for critical discussions, and Edward Ruby and Len Duncan for providing the strains used in this study.

    FOOTNOTES

* Corresponding author. Mailing address: The Biological Laboratories, Harvard University, 16 Divinity Avenue, Cambridge, MA 02138. Phone: (617) 495-2177. Fax: (617) 496-5854. E-mail: ccavanaugh{at}oeb.harvard.edu.

dagger Present address: Department of Civil and Environmental Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139-4307.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Alm, W. E., D. Oerther, N. Larsen, D. A. Stahl, and L. Raskin. 1996. The oligonucleotide database project. Appl. Environ. Microbiol. 62:3557-3559[Medline].
2. Amann, R. I., W. Ludwig, and K.-H. Schleifer. 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59:143-169[Abstract/Free Full Text].
3. Arnheim, N., and H. Erlich. 1992. Polymerase chain reaction strategy. Annu. Rev. Biochem. 61:131-156[Medline].
4. Chandler, D. P., J. K. Fredrickson, and F. J. Brockman. 1997. Effect of PCR template concentration on the composition and distribution of total community 16S rDNA clone libraries. Mol. Ecol. 6:475-483[Medline].
5. Erlich, H. A., D. Gelfand, and J. J. Sninsky. 1991. Recent advances in the polymerase chain reaction. Science 252:1643-1651[Abstract/Free Full Text].
6. Farrelly, V., F. A. Rainey, and E. Stackebrandt. 1995. Effect of genome size and rrn gene copy number on PCR amplification of 16S rRNA genes from a mixture of bacterial species. Appl. Environ. Microbiol. 61:2798-2801[Abstract].
7. Head, I. M., J. R. Saunders, and R. W. Pickup. 1998. Microbial evolution, diversity, and ecology: a decade of ribosomal RNA analysis of uncultivated microorganisms. Microb. Ecol. 35:1-21[Medline].
7a. Hektor, H. Personal communication.
8. Jarrell, K. F., D. Faguy, A. M. Herbert, and M. L. Kalmkoff. 1991. A general method of isolating high molecular weight DNA from methanogenic archaea (archaebacteria). Can J. Microbiol. 38:65-68.
9. Karrer, E. E., J. E. Lincoln, S. Hogenhout, A. B. Bennet, R. M. Bostock, B. Martineau, W. J. Lucas, D. G. Gilchrist, and D. Alexander. 1995. In situ isolation of mRNA from individual plant cells: creation of cell-specific cDNA libraries. Proc. Natl. Acad. Sci. USA 92:3814-3818[Abstract/Free Full Text].
10. Kerkhof, L., and M. Speck. 1997. Ribosomal RNA gene dosage in marine bacteria. Mol. Mar. Biol. Biotechnol. 6:260-267[Medline].
11. Lane, D. J. 1991. 16S/23S rRNA sequencing, p. 115-175. In E. Stackebrandt, and M. Goodfellow (ed.), Nucleic acid techniques in bacterial systematics. Wiley & Sons, Chichester, United Kingdom.
12. Lee, S.-Y., J. Bollinger, D. Bezdicek, and A. Ogram. 1996. Estimation of the abundance of an uncultured soil bacterial strain by a competitive quantitative PCR method. Appl. Environ. Microbiol. 62:3787-3793[Abstract].
13. Maidak, B. L., G. J. Olsen, N. Larsen, R. Overbeek, M. J. McCaughey, and C. R. Woese. 1996. The Ribosomal Database Project (RDP). Nucleic Acids Res. 24:82-85[Abstract/Free Full Text].
14. Mutter, G., and K. A. Boynton. 1995. PCR bias in amplification of androgen receptor alleles, a trinucleotide repeat marker used in clonality studies. Nucleic Acids Res. 23:1411-1418[Abstract/Free Full Text].
15. Muyzer, G., E. C. de Waal, and A. G. Uitterlinden. 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59:695-700[Abstract/Free Full Text].
16. Norrman, B., U. L. Zweifel, C. S. Hopkinson, and B. Fry. 1995. Production and utilization of dissolved organic carbon during an experimental diatom bloom. Limnol. Oceanogr. 40:898-907.
17. Polz, M. F., E. V. Odintsova, and C. M. Cavanaugh. 1996. Phylogenetic relationships of the filamentous sulfur bacterium Thiothrix ramosa based on 16S rRNA sequence analysis. Int. J. Syst. Bacteriol. 46:94-97[Abstract/Free Full Text].
18. Polz, M. F., and C. M. Cavanaugh. 1997. A simple method for the quantification of uncultured microorganisms in the environment based on in vitro transcription of 16S rRNA. Appl. Environ. Microbiol. 63:1028-1033[Abstract].
19. Raskin, L., L. K. Poulsen, D. R. Noguera, B. E. Rittmann, and D. A. Stahl. 1994. Quantification of methanogenic groups in anaerobic biological reactors by oligonucleotide probe hybridization. Appl. Environ. Microbiol. 60:1241-1248[Abstract/Free Full Text].
20. Raskin, L., J. M. Stromley, B. E. Rittmann, and D. A. Stahl. 1994. Group-specific 16S rRNA hybridization probes to describe natural communities of methanogens. Appl. Environ. Microbiol. 60:1232-1240[Abstract/Free Full Text].
21. Reysenbach, A.-L., L. J. Giver, G. S. Wickham, and N. R. Pace. 1992. Differential amplification of rRNA genes by polymerase chain reaction. Appl. Environ. Microbiol. 58:3417-3418[Abstract/Free Full Text].
22. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
23. Sardelli, A. D. 1993. Plateu effect---understanding PCR limitations. Amplifications 9:1-5.
24. Splinter, P. L., and M. A. Rott. 1997. Physical and genetic map of Vibrio fischeri MJ1, abstr. H-212, p. 636. In Abstracts of the 97th General Meeting of the American Society for Microbiology 1997. American Society for Microbiology, Washington, D.C.
25. Stahl, D. A., B. Flesher, H. R. Mansfield, and L. Montgomery. 1988. Use of phylogenetically based hybridization probes for studies of ruminal microbial ecology. Appl. Environ. Microbiol. 54:1079-1084[Abstract/Free Full Text].
26. Steffan, R. J., and R. M. Atlas. 1991. Polymerase chain reaction: applications in environmental microbiology. Annu. Rev. Microbiol. 45:137-161[Medline].
27. Suzuki, M., and S. J. Giovannoni. 1996. Bias caused by template annealing in the amplification mixtures of 16S rRNA genes by PCR. Appl. Environ. Microbiol. 62:625-630[Abstract].
28. Torsvik, V., J. Goksøyr, and F. L. Daae. 1990. High diversity in DNA of soil bacteria. Appl. Environ. Microbiol. 56:782-787[Abstract/Free Full Text].
29. Wagner, A., N. Blackstone, P. Cartwright, M. Dick, B. Misof, P. Snow, G. P. Wagner, J. Bartels, M. Murtha, and J. Pendleton. 1994. Surveys of gene families using polymerase chain reaction: PCR selection and PCR drift. Syst. Biol. 43:250-261.
30. Zheng, D., E. W. Alm, D. A. Stahl, and L. Raskin. 1996. Characterization of universal small-subunit rRNA hybridization probes for quantitative molecular microbial ecology studies. Appl. Environ. Microbiol. 62:4504-4513[Abstract].


Applied and Environmental Microbiology, October 1998, p. 3724-3730, Vol. 64, No. 10
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Ettwig, K. F., van Alen, T., van de Pas-Schoonen, K. T., Jetten, M. S. M., Strous, M. (2009). Enrichment and Molecular Detection of Denitrifying Methanotrophic Bacteria of the NC10 Phylum. Appl. Environ. Microbiol. 75: 3656-3662 [Abstract] [Full Text]  
  • Paliy, O., Kenche, H., Abernathy, F., Michail, S. (2009). High-Throughput Quantitative Analysis of the Human Intestinal Microbiota with a Phylogenetic Microarray. Appl. Environ. Microbiol. 75: 3572-3579 [Abstract] [Full Text]  
  • Morales, S. E., Holben, W. E. (2009). Empirical Testing of 16S rRNA Gene PCR Primer Pairs Reveals Variance in Target Specificity and Efficacy Not Suggested by In Silico Analysis. Appl. Environ. Microbiol. 75: 2677-2683 [Abstract] [Full Text]  
  • Harrison, B. K., Zhang, H., Berelson, W., Orphan, V. J. (2009). Variations in Archaeal and Bacterial Diversity Associated with the Sulfate-Methane Transition Zone in Continental Margin Sediments (Santa Barbara Basin, California). Appl. Environ. Microbiol. 75: 1487-1499 [Abstract] [Full Text]  
  • Sagaram, U. S., DeAngelis, K. M., Trivedi, P., Andersen, G. L., Lu, S.-E., Wang, N. (2009). Bacterial Diversity Analysis of Huanglongbing Pathogen-Infected Citrus, Using PhyloChip Arrays and 16S rRNA Gene Clone Library Sequencing. Appl. Environ. Microbiol. 75: 1566-1574 [Abstract] [Full Text]  
  • Eriksson, K. M., Clarke, A. K., Franzen, L.-G., Kuylenstierna, M., Martinez, K., Blanck, H. (2009). Community-Level Analysis of psbA Gene Sequences and Irgarol Tolerance in Marine Periphyton. Appl. Environ. Microbiol. 75: 897-906 [Abstract] [Full Text]  
  • Morales, S. E., Cosart, T. F., Johnson, J. V., Holben, W. E. (2009). Extensive Phylogenetic Analysis of a Soil Bacterial Community Illustrates Extreme Taxon Evenness and the Effects of Amplicon Length, Degree of Coverage, and DNA Fractionation on Classification and Ecological Parameters. Appl. Environ. Microbiol. 75: 668-675 [Abstract] [Full Text]  
  • Gao, Z., Li, B., Zheng, C., Wang, G. (2008). Molecular Detection of Fungal Communities in the Hawaiian Marine Sponges Suberites zeteki and Mycale armata. Appl. Environ. Microbiol. 74: 6091-6101 [Abstract] [Full Text]  
  • Hall, J. R., Mitchell, K. R., Jackson-Weaver, O., Kooser, A. S., Cron, B. R., Crossey, L. J., Takacs-Vesbach, C. D. (2008). Molecular Characterization of the Diversity and Distribution of a Thermal Spring Microbial Community by Using rRNA and Metabolic Genes. Appl. Environ. Microbiol. 74: 4910-4922 [Abstract] [Full Text]  
  • Blow, M. J., Zhang, T., Woyke, T., Speller, C. F., Krivoshapkin, A., Yang, D. Y., Derevianko, A., Rubin, E. M. (2008). Identification of ancient remains through genomic sequencing. Genome Res 18: 1347-1353 [Abstract] [Full Text]  
  • Chen, C-Y, Chi, K H, Alexander, S, Ison, C A, Ballard, R C (2008). A real-time quadriplex PCR assay for the diagnosis of rectal lymphogranuloma venereum and non-lymphogranuloma venereum Chlamydia trachomatis infections. Sex. Transm. Infect. 84: 273-276 [Abstract] [Full Text]  
  • Troedsson, C., Lee, R. F., Stokes, V., Walters, T. L., Simonelli, P., Frischer, M. E. (2008). Development of a Denaturing High-Performance Liquid Chromatography Method for Detection of Protist Parasites of Metazoans. Appl. Environ. Microbiol. 74: 4336-4345 [Abstract] [Full Text]  
  • Troedsson, C., Lee, R. F., Walters, T., Stokes, V., Brinkley, K., Naegele, V., Frischer, M. E. (2008). Detection and Discovery of Crustacean Parasites in Blue Crabs (Callinectes sapidus) by Using 18S rRNA Gene-Targeted Denaturing High-Performance Liquid Chromatography. Appl. Environ. Microbiol. 74: 4346-4353 [Abstract] [Full Text]  
  • Thompson, R. F., Reimers, M., Khulan, B., Gissot, M., Richmond, T. A., Chen, Q., Zheng, X., Kim, K., Greally, J. M. (2008). An analytical pipeline for genomic representations used for cytosine methylation studies. Bioinformatics 24: 1161-1167 [Abstract] [Full Text]  
  • Pearson, A., Kraunz, K. S., Sessions, A. L., Dekas, A. E., Leavitt, W. D., Edwards, K. J. (2008). Quantifying Microbial Utilization of Petroleum Hydrocarbons in Salt Marsh Sediments by Using the 13C Content of Bacterial rRNA. Appl. Environ. Microbiol. 74: 1157-1166 [Abstract] [Full Text]  
  • Isenbarger, T. A., Finney, M., Rios-Velazquez, C., Handelsman, J., Ruvkun, G. (2008). Miniprimer PCR, a New Lens for Viewing the Microbial World. Appl. Environ. Microbiol. 74: 840-849 [Abstract] [Full Text]  
  • Feazel, L. M., Spear, J. R., Berger, A. B., Harris, J. K., Frank, D. N., Ley, R. E., Pace, N. R. (2008). Eucaryotic Diversity in a Hypersaline Microbial Mat. Appl. Environ. Microbiol. 74: 329-332 [Abstract] [Full Text]  
  • Meyer, B., Kuever, J. (2007). Molecular Analysis of the Diversity of Sulfate-Reducing and Sulfur-Oxidizing Prokaryotes in the Environment, Using aprA as Functional Marker Gene. Appl. Environ. Microbiol. 73: 7664-7679 [Abstract] [Full Text]  
  • Santos-Gonzalez, J. C., Finlay, R. D., Tehler, A. (2007). Seasonal Dynamics of Arbuscular Mycorrhizal Fungal Communities in Roots in a Seminatural Grassland. Appl. Environ. Microbiol. 73: 5613-5623 [Abstract] [Full Text]  
  • Trosvik, P., Skanseng, B., Jakobsen, K. S., Stenseth, N. C., Naes, T., Rudi, K. (2007). Multivariate Analysis of Complex DNA Sequence Electropherograms for High-Throughput Quantitative Analysis of Mixed Microbial Populations. Appl. Environ. Microbiol. 73: 4975-4983 [Abstract] [Full Text]  
  • Ashby, M. N., Rine, J., Mongodin, E. F., Nelson, K. E., Dimster-Denk, D. (2007). Serial Analysis of rRNA Genes and the Unexpected Dominance of Rare Members of Microbial Communities. Appl. Environ. Microbiol. 73: 4532-4542 [Abstract] [Full Text]  
  • Ma, C., Lu, X., Shi, C., Li, J., Gu, Y., Ma, Y., Chu, Y., Han, F., Gong, Q., Yu, W. (2007). Molecular Cloning and Characterization of a Novel beta-Agarase, AgaB, from Marine Pseudoalteromonas sp. CY24. J. Biol. Chem. 282: 3747-3754 [Abstract] [Full Text]  
  • Brodie, E. L., DeSantis, T. Z., Parker, J. P. M., Zubietta, I. X., Piceno, Y. M., Andersen, G. L. (2007). Urban aerosols harbor diverse and dynamic bacterial populations. Proc. Natl. Acad. Sci. USA 104: 299-304 [Abstract] [Full Text]  
  • Case, R. J., Boucher, Y., Dahllof, I., Holmstrom, C., Doolittle, W. F., Kjelleberg, S. (2007). Use of 16S rRNA and rpoB Genes as Molecular Markers for Microbial Ecology Studies. Appl. Environ. Microbiol. 73: 278-288 [Abstract] [Full Text]  
  • Winter, C., Hein, T., Kavka, G., Mach, R. L., Farnleitner, A. H. (2007). Longitudinal Changes in the Bacterial Community Composition of the Danube River: a Whole-River Approach. Appl. Environ. Microbiol. 73: 421-431 [Abstract] [Full Text]  
  • McGarvey, J. A., Miller, W. G., Zhang, R., Ma, Y., Mitloehner, F. (2007). Bacterial Population Dynamics in Dairy Waste during Aerobic and Anaerobic Treatment and Subsequent Storage. Appl. Environ. Microbiol. 73: 193-202 [Abstract] [Full Text]  
  • Dar, S. A., Yao, L., van Dongen, U., Kuenen, J. G., Muyzer, G. (2007). Analysis of Diversity and Activity of Sulfate-Reducing Bacterial Communities in Sulfidogenic Bioreactors Using 16S rRNA and dsrB Genes as Molecular Markers. Appl. Environ. Microbiol. 73: 594-604 [Abstract] [Full Text]  
  • Ben-Dov, E., Shapiro, O. H., Siboni, N., Kushmaro, A. (2006). Advantage of Using Inosine at the 3' Termini of 16S rRNA Gene Universal Primers for the Study of Microbial Diversity. Appl. Environ. Microbiol. 72: 6902-6906 [Abstract] [Full Text]  
  • Penton, C. R., Devol, A. H., Tiedje, J. M. (2006). Molecular evidence for the broad distribution of anaerobic ammonium-oxidizing bacteria in freshwater and marine sediments.. Appl. Environ. Microbiol. 72: 6829-6832 [Abstract] [Full Text]  
  • Danovaro, R., Luna, G. M., Dell'Anno, A., Pietrangeli, B. (2006). Comparison of Two Fingerprinting Techniques, Terminal Restriction Fragment Length Polymorphism and Automated Ribosomal Intergenic Spacer Analysis, for Determination of Bacterial Diversity in Aquatic Environments. Appl. Environ. Microbiol. 72: 5982-5989 [Abstract] [Full Text]  
  • Brodie, E. L., DeSantis, T. Z., Joyner, D. C., Baek, S. M., Larsen, J. T., Andersen, G. L., Hazen, T. C., Richardson, P. M., Herman, D. J., Tokunaga, T. K., Wan, J. M., Firestone, M. K. (2006). Application of a High-Density Oligonucleotide Microarray Approach To Study Bacterial Population Dynamics during Uranium Reduction and Reoxidation. Appl. Environ. Microbiol. 72: 6288-6298 [Abstract] [Full Text]  
  • Diaz, M. R., Boekhout, T., Theelen, B., Bovers, M., Cabanes, F. J., Fell, J. W. (2006). Microcoding and flow cytometry as a high-throughput fungal identification system for Malassezia species.. J Med Microbiol 55: 1197-1209 [Abstract] [Full Text]  
  • Torzilli, A. P., Sikaroodi, M., Chalkley, D., Gillevet, P. M. (2006). A comparison of fungal communities from four salt marsh plants using automated ribosomal intergenic spacer analysis (ARISA).. Mycologia 98: 690-698 [Abstract] [Full Text]  
  • Junker, L. M., Peters, J. E., Hay, A. G. (2006). Global analysis of candidate genes important for fitness in a competitive biofilm using DNA-array-based transposon mapping.. Microbiology 152: 2233-2245 [Abstract] [Full Text]  
  • Sorensen, K. B., Teske, A. (2006). Stratified communities of active archaea in deep marine subsurface sediments.. Appl. Environ. Microbiol. 72: 4596-4603 [Abstract] [Full Text]  
  • Dedysh, S. N., Pankratov, T. A., Belova, S. E., Kulichevskaya, I. S., Liesack, W. (2006). Phylogenetic analysis and in situ identification of bacteria community composition in an acidic sphagnum peat bog.. Appl. Environ. Microbiol. 72: 2110-2117 [Abstract] [Full Text]  
  • Liao, J. C., Mastali, M., Gau, V., Suchard, M. A., Moller, A. K., Bruckner, D. A., Babbitt, J. T., Li, Y., Gornbein, J., Landaw, E. M., McCabe, E. R. B., Churchill, B. M., Haake, D. A. (2006). Use of Electrochemical DNA Biosensors for Rapid Molecular Identification of Uropathogens in Clinical Urine Specimens. J. Clin. Microbiol. 44: 561-570 [Abstract] [Full Text]  
  • Saito, D., de Toledo Leonardo, R., Rodrigues, J. L. M., Tsai, S. M., Hofling, J. F., Goncalves, R. B. (2006). Identification of bacteria in endodontic infections by sequence analysis of 16S rDNA clone libraries. J Med Microbiol 55: 101-107 [Abstract] [Full Text]  
  • Bae, J.-W., Rhee, S.-K., Park, J. R., Chung, W.-H., Nam, Y.-D., Lee, I., Kim, H., Park, Y.-H. (2005). Development and Evaluation of Genome-Probing Microarrays for Monitoring Lactic Acid Bacteria. Appl. Environ. Microbiol. 71: 8825-8835 [Abstract] [Full Text]  
  • Acinas, S. G., Sarma-Rupavtarm, R., Klepac-Ceraj, V., Polz, M. F. (2005). PCR-Induced Sequence Artifacts and Bias: Insights from Comparison of Two 16S rRNA Clone Libraries Constructed from the Same Sample. Appl. Environ. Microbiol. 71: 8966-8969 [Abstract] [Full Text]  
  • Hongoh, Y., Deevong, P., Inoue, T., Moriya, S., Trakulnaleamsai, S., Ohkuma, M., Vongkaluang, C., Noparatnaraporn, N., Kudo, T. (2005). Intra- and Interspecific Comparisons of Bacterial Diversity and Community Structure Support Coevolution of Gut Microbiota and Termite Host. Appl. Environ. Microbiol. 71: 6590-6599 [Abstract] [Full Text]  
  • Castaldini, M., Turrini, A., Sbrana, C., Benedetti, A., Marchionni, M., Mocali, S., Fabiani, A., Landi, S., Santomassimo, F., Pietrangeli, B., Nuti, M. P., Miclaus, N., Giovannetti, M. (2005). Impact of Bt Corn on Rhizospheric and Soil Eubacterial Communities and on Beneficial Mycorrhizal Symbiosis in Experimental Microcosms. Appl. Environ. Microbiol. 71: 6719-6729 [Abstract] [Full Text]  
  • Skidmore, M., Anderson, S. P., Sharp, M., Foght, J., Lanoil, B. D. (2005). Comparison of Microbial Community Compositions of Two Subglacial Environments Reveals a Possible Role for Microbes in Chemical Weathering Processes. Appl. Environ. Microbiol. 71: 6986-6997 [Abstract] [Full Text]  
  • Ridley, C. P., John Faulkner, D., Haygood, M. G. (2005). Investigation of Oscillatoria spongeliae-Dominated Bacterial Communities in Four Dictyoceratid Sponges. Appl. Environ. Microbiol. 71: 7366-7375 [Abstract] [Full Text]  
  • Gafan, G. P., Lucas, V. S., Roberts, G. J., Petrie, A., Wilson, M., Spratt, D. A. (2005). Statistical Analyses of Complex Denaturing Gradient Gel Electrophoresis Profiles. J. Clin. Microbiol. 43: 3971-3978 [Abstract] [Full Text]  
  • Schmid, M. C., Maas, B., Dapena, A., van de Pas-Schoonen, K., van de Vossenberg, J., Kartal, B., van Niftrik, L., Schmidt, I., Cirpus, I., Kuenen, J. G., Wagner, M., Sinninghe Damste, J. S., Kuypers, M., Revsbech, N. P., Mendez, R., Jetten, M. S. M., Strous, M. (2005). Biomarkers for In Situ Detection of Anaerobic Ammonium-Oxidizing (Anammox) Bacteria. Appl. Environ. Microbiol. 71: 1677-1684 [Full Text]  
  • Yannarell, A. C., Triplett, E. W. (2005). Geographic and Environmental Sources of Variation in Lake Bacterial Community Composition. Appl. Environ. Microbiol. 71: 227-239 [Abstract] [Full Text]  
  • Meguro, N., Kodama, Y., Gallegos, M.-T., Watanabe, K. (2005). Molecular Characterization of Resistance-Nodulation-Division Transporters from Solvent- and Drug-Resistant Bacteria in Petroleum-Contaminated Soil. Appl. Environ. Microbiol. 71: 580-586 [Abstract] [Full Text]  
  • Kurata, S., Kanagawa, T., Magariyama, Y., Takatsu, K., Yamada, K., Yokomaku, T., Kamagata, Y. (2004). Reevaluation and Reduction of a PCR Bias Caused by Reannealing of Templates. Appl. Environ. Microbiol. 70: 7545-7549 [Abstract] [Full Text]  
  • Takatsu, K., Yokomaku, T., Kurata, S., Kanagawa, T. (2004). A FRET-based analysis of SNPs without fluorescent probes. Nucleic Acids Res 32: e156-e156 [Abstract] [Full Text]  
  • Davies, C. E., Hill, K. E., Wilson, M. J., Stephens, P., Hill, C. M., Harding, K. G., Thomas, D. W. (2004). Use of 16S Ribosomal DNA PCR and Denaturing Gradient Gel Electrophoresis for Analysis of the Microfloras of Healing and Nonhealing Chronic Venous Leg Ulcers. J. Clin. Microbiol. 42: 3549-3557 [Abstract] [Full Text]  
  • McGarvey, J. A., Miller, W. G., Sanchez, S., Stanker, L. (2004). Identification of Bacterial Populations in Dairy Wastewaters by Use of 16S rRNA Gene Sequences and Other Genetic Markers. Appl. Environ. Microbiol. 70: 4267-4275 [Abstract] [Full Text]  
  • Munson, M. A., Banerjee, A., Watson, T. F., Wade, W. G. (2004). Molecular Analysis of the Microflora Associated with Dental Caries. J. Clin. Microbiol. 42: 3023-3029 [Abstract] [Full Text]  
  • Lipson, D. A., Schmidt, S. K. (2004). Seasonal Changes in an Alpine Soil Bacterial Community in the Colorado Rocky Mountains. Appl. Environ. Microbiol. 70: 2867-2879 [Abstract] [Full Text]  
  • Gast, R. J., Dennett, M. R., Caron, D. A. (2004). Characterization of Protistan Assemblages in the Ross Sea, Antarctica, by Denaturing Gradient Gel Electrophoresis. Appl. Environ. Microbiol. 70: 2028-2037 [Abstract] [Full Text]  
  • Holben, W. E., Feris, K. P., Kettunen, A., Apajalahti, J. H. A. (2004). GC Fractionation Enhances Microbial Community Diversity Assessment and Detection of Minority Populations of Bacteria by Denaturing Gradient Gel Electrophoresis. Appl. Environ. Microbiol. 70: 2263-2270 [Abstract] [Full Text]  
  • Steward, G. F., Jenkins, B. D., Ward, B. B., Zehr, J. P. (2004). Development and Testing of a DNA Macroarray To Assess Nitrogenase (nifH) Gene Diversity. Appl. Environ. Microbiol. 70: 1455-1465 [Abstract] [Full Text]  
  • Sliwinski, M. K., Goodman, R. M. (2004). Spatial Heterogeneity of Crenarchaeal Assemblages within Mesophilic Soil Ecosystems as Revealed by PCR-Single-Stranded Conformation Polymorphism Profiling. Appl. Environ. Microbiol. 70: 1811-1820 [Abstract] [Full Text]  
  • Bano, N., Ruffin, S., Ransom, B., Hollibaugh, J. T. (2004). Phylogenetic Composition of Arctic Ocean Archaeal Assemblages and Comparison with Antarctic Assemblages. Appl. Environ. Microbiol. 70: 781-789 [Abstract] [Full Text]  
  • Winter, C., Smit, A., Herndl, G. J., Weinbauer, M. G. (2004). Impact of Virioplankton on Archaeal and Bacterial Community Richness as Assessed in Seawater Batch Cultures. Appl. Environ. Microbiol. 70: 804-813 [Abstract] [Full Text]  
  • Zoetendal, E. G., Collier, C. T., Koike, S., Mackie, R. I., Gaskins, H. R. (2004). Molecular Ecological Analysis of the Gastrointestinal Microbiota: A Review. J. Nutr. 134: 465-472 [Abstract] [Full Text]  
  • Yannarell, A. C., Triplett, E. W. (2004). Within- and between-Lake Variability in the Composition of Bacterioplankton Communities: Investigations Using Multiple Spatial Scales. Appl. Environ. Microbiol. 70: 214-223 [Abstract] [Full Text]  
  • Adamczyk, J., Hesselsoe, M., Iversen, N., Horn, M., Lehner, A., Nielsen, P. H., Schloter, M., Roslev, P., Wagner, M. (2003). The Isotope Array, a New Tool That Employs Substrate-Mediated Labeling of rRNA for Determination of Microbial Community Structure and Function. Appl. Environ. Microbiol. 69: 6875-6887 [Abstract] [Full Text]  
  • Zwart, G., van Hannen, E. J., Kamst-van Agterveld, M. P., Van der Gucht, K., Lindstrom, E. S., Van Wichelen, J., Lauridsen, T., Crump, B. C., Han, S.-K., Declerck, S. (2003). Rapid Screening for Freshwater Bacterial Groups by Using Reverse Line Blot Hybridization. Appl. Environ. Microbiol. 69: 5875-5883 [Abstract] [Full Text]  
  • Purdy, K. J., Nedwell, D. B., Embley, T. M. (2003). Analysis of the Sulfate-Reducing Bacterial and Methanogenic Archaeal Populations in Contrasting Antarctic Sediments. Appl. Environ. Microbiol. 69: 3181-3191 [Abstract] [Full Text]  
  • Singh, R., Stine, O. C., Smith, D. L., Spitznagel, J. K. Jr., Labib, M. E., Williams, H. N. (2003). Microbial Diversity of Biofilms in Dental Unit Water Systems. Appl. Environ. Microbiol. 69: 3412-3420 [Abstract] [Full Text]  
  • Egert, M., Friedrich, M. W. (2003). Formation of Pseudo-Terminal Restriction Fragments, a PCR-Related Bias Affecting Terminal Restriction Fragment Length Polymorphism Analysis of Microbial Community Structure. Appl. Environ. Microbiol. 69: 2555-2562 [Abstract] [Full Text]  
  • Stamper, D. M., Walch, M., Jacobs, R. N. (2003). Bacterial Population Changes in a Membrane Bioreactor for Graywater Treatment Monitored by Denaturing Gradient Gel Electrophoretic Analysis of 16S rRNA Gene Fragments. Appl. Environ. Microbiol. 69: 852-860 [Abstract] [Full Text]  
  • Lueders, T., Friedrich, M. W. (2003). Evaluation of PCR Amplification Bias by Terminal Restriction Fragment Length Polymorphism Analysis of Small-Subunit rRNA and mcrA Genes by Using Defined Template Mixtures of Methanogenic Pure Cultures and Soil DNA Extracts. Appl. Environ. Microbiol. 69: 320-326 [Abstract] [Full Text]  
  • Ronn, R., McCaig, A. E., Griffiths, B. S., Prosser, J. I. (2002). Impact of Protozoan Grazing on Bacterial Community Structure in Soil Microcosms. Appl. Environ. Microbiol. 68: 6094-6105 [Abstract] [Full Text]  
  • Luton, P. E., Wayne, J. M., Sharp, R. J., Riley, P. W. (2002). The mcrA gene as an alternative to 16S rRNA in the phylogenetic analysis of methanogen populations in landfill. Microbiology 148: 3521-3530 [Abstract] [Full Text]  
  • Ogino, S., Wilson, R. B. (2002). Quantification of PCR Bias Caused by a Single Nucleotide Polymorphism in SMN Gene Dosage Analysis. J. Mol. Diagn. 4: 185-190 [Abstract] [Full Text]  
  • Munson, M.A., Pitt-Ford, T., Chong, B., Weightman, A., Wade, W.G. (2002). Molecular and Cultural Analysis of the Microflora Associated with Endodontic Infections. JDR 81: 761-766 [Abstract] [Full Text]  
  • Martin, A. P. (2002). Phylogenetic Approaches for Describing and Comparing the Diversity of Microbial Communities. Appl. Environ. Microbiol. 68: 3673-3682 [Full Text]  
  • Holmes, D. E., Finneran, K. T., O'Neil, R. A., Lovley, D. R. (2002). Enrichment of Members of the Family Geobacteraceae Associated with Stimulation of Dissimilatory Metal Reduction in Uranium-Contaminated Aquifer Sediments. Appl. Environ. Microbiol. 68: 2300-2306 [Abstract] [Full Text]  
  • Zhong, Y., Chen, F., Wilhelm, S. W., Poorvin, L., Hodson, R. E. (2002). Phylogenetic Diversity of Marine Cyanophage Isolates and Natural Virus Communities as Revealed by Sequences of Viral Capsid Assembly Protein Gene g20. Appl. Environ. Microbiol. 68: 1576-1584 [Abstract] [Full Text]  
  • Huber, J. A., Butterfield, D. A., Baross, J. A. (2002). Temporal Changes in Archaeal Diversity and Chemistry in a Mid-Ocean Ridge Subseafloor Habitat. Appl. Environ. Microbiol. 68: 1585-1594 [Abstract] [Full Text]  
  • Teske, A., Hinrichs, K.-U., Edgcomb, V., de Vera Gomez, A., Kysela, D., Sylva, S. P., Sogin, M. L., Jannasch, H. W. (2002). Microbial Diversity of Hydrothermal Sediments in the Guaymas Basin: Evidence for Anaerobic Methanotrophic Communities. Appl. Environ. Microbiol. 68: 1994-2007 [Abstract] [Full Text]  
  • Lopez-Garcia, P., Rodriguez-Valera, F., Moreira, D. (2002). Toward the Monophyly of Haeckel's Radiolaria: 18S rRNA Environmental Data Support the Sisterhood of Polycystinea and Acantharea. Mol Biol Evol 19: 118-121 [Full Text]  
  • Sigler, W. V., Nakatsu, C. H., Reicher, Z. J., Turco, R. F. (2001). Fate of the Biological Control Agent Pseudomonas aureofaciens TX-1 after Application to Turfgrass. Appl. Environ. Microbiol. 67: 3542-3548 [Abstract] [Full Text]  
  • Ishii, K., Fukui, M. (2001). Optimization of Annealing Temperature To Reduce Bias Caused by a Primer Mismatch in Multitemplate PCR. Appl. Environ. Microbiol. 67: 3753-3755 [Abstract] [Full Text]  
  • Schabereiter-Gurtner, C., Maca, S., Rölleke, S., Nigl, K., Lukas, J., Hirschl, A., Lubitz, W., Barisani-Asenbauer, T. (2001). 16S rDNA-Based Identification of Bacteria from Conjunctival Swabs by PCR and DGGE Fingerprinting. IOVS 42: 1164-1171 [Abstract] [Full Text]  
  • Campbell, B. J., Cary, S. C. (2001). Characterization of a Novel Spirochete Associated with the Hydrothermal Vent Polychaete Annelid, Alvinella pompejana. Appl. Environ. Microbiol. 67: 110-117 [Abstract] [Full Text]  
  • Duineveld, B. M., Kowalchuk, G. A., Keijzer, A., van Elsas, J. D., van Veen, J. A. (2001). Analysis of Bacterial Communities in the Rhizosphere of Chrysanthemum via Denaturing Gradient Gel Electrophoresis of PCR-Amplified 16S rRNA as Well as DNA Fragments Coding for 16S rRNA. Appl. Environ. Microbiol. 67: 172-178 [Abstract] [Full Text]  
  • Webster, N. S., Wilson, K. J., Blackall, L. L., Hill, R. T. (2001). Phylogenetic Diversity of Bacteria Associated with the Marine Sponge Rhopaloeides odorabile. Appl. Environ. Microbiol. 67: 434-444 [Abstract] [Full Text]  
  • Purkhold, U., Pommerening-Röser, A., Juretschko, S., Schmid, M. C., Koops, H.-P., Wagner, M. (2000). Phylogeny of All Recognized Species of Ammonia Oxidizers Based on Comparative 16S rRNA and amoA Sequence Analysis: Implications for Molecular Diversity Surveys. Appl. Environ. Microbiol. 66: 5368-5382 [Abstract] [Full Text]  
  • Elnifro, E. M., Ashshi, A. M., Cooper, R. J., Klapper, P. E. (2000). Multiplex PCR: Optimization and Application in Diagnostic Virology. Clin. Microbiol. Rev. 13: 559-570 [Abstract] [Full Text]  
  • Normander, B., Prosser, J. I. (2000). Bacterial Origin and Community Composition in the Barley Phytosphere as a Function of Habitat and Presowing Conditions. Appl. Environ. Microbiol. 66: 4372-4377 [Abstract] [Full Text]  
  • Dahllöf, I., Baillie, H., Kjelleberg, S. (2000). rpoB-Based Microbial Community Analysis Avoids Limitations Inherent in 16S rRNA Gene Intraspecies Heterogeneity. Appl. Environ. Microbiol. 66: 3376-3380 [Abstract] [Full Text]  
  • Massana, R., DeLong, E. F., Pedrós-Alió, C. (2000). A Few Cosmopolitan Phylotypes Dominate Planktonic Archaeal Assemblages in Widely Different Oceanic Provinces. Appl. Environ. Microbiol. 66: 1777-1787 [Abstract] [Full Text]  
  • Ritchie, N. J., Schutter, M. E., Dick, R. P., Myrold, D. D. (2000). Use of Length Heterogeneity PCR and Fatty Acid Methyl Ester Profiles To Characterize Microbial Communities in Soil. Appl. Environ. Microbiol. 66: 1668-1675 [Abstract] [Full Text]  
  • Worden, A. Z., Chisholm, S. W., Binder, B. J. (2000). In Situ Hybridization of Prochlorococcus and Synechococcus (Marine Cyanobacteria) spp. with rRNA-Targeted Peptide Nucleic Acid Probes. Appl. Environ. Microbiol. 66: 284-289 [Abstract] [Full Text]  
  • Netherwood, T., Gilbert, H. J., Parker, D. S., O'Donnell, A. G. (1999). Probiotics Shown To Change Bacterial Community Structure in the Avian Gastrointestinal Tract. Appl. Environ. Microbiol. 65: 5134-5138 [Abstract] [Full Text]  
  • Fisher, M. M., Triplett, E. W. (1999). Automated Approach for Ribosomal Intergenic Spacer Analysis of Microbial Diversity and Its Application to Freshwater Bacterial Communities. Appl. Environ. Microbiol. 65: 4630-4636 [Abstract] [Full Text]  
  • Polz, M. F., Harbison, C., Cavanaugh, C. M. (1999). Diversity and Heterogeneity of Epibiotic Bacterial Communities on the Marine Nematode Eubostrichus dianae. Appl. Environ. Microbiol. 65: 4271-4275 [Abstract] [Full Text]  
  • Edwards, K. J., Gihring, T. M., Banfield, J. F. (1999). Seasonal Variations in Microbial Populations and Environmental Conditions in an Extreme Acid Mine Drainage Environment. Appl. Environ. Microbiol. 65: 3627-3632 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Polz, M. F.
Right arrow Articles by Cavanaugh, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Polz, M. F.
Right arrow Articles by Cavanaugh, C. M.
Agricola
Right arrow Articles by Polz, M. F.
Right arrow Articles by Cavanaugh, C. M.