Previous Article | Next Article 
Applied and Environmental Microbiology, October 1998, p. 3831-3837, Vol. 64, No. 10
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Improvement of Nitrogen Assimilation and Fermentation Kinetics
under Enological Conditions by Derepression of Alternative
Nitrogen-Assimilatory Pathways in an Industrial Saccharomyces
cerevisiae Strain
Jean-Michel
Salmon* and
Pierre
Barre
Laboratoire de Microbiologie et de
Technologie des Fermentations, Institut des Produits de la Vigne,
Institut National de la Recherche Agronomique, 34060 Montpellier Cedex
1, France
Received 1 December 1997/Accepted 17 July 1998
 |
ABSTRACT |
Metabolism of nitrogen compounds by yeasts affects the efficiency
of wine fermentation. Ammonium ions, normally present in grape
musts, reduce catabolic enzyme levels and transport activities for
nonpreferred nitrogen sources. This nitrogen catabolite repression severely impairs the utilization of proline and arginine, both common
nitrogen sources in grape juice that require the proline utilization
pathway for their assimilation. We attempted to improve fermentation
performance by genetic alteration of the regulation of
nitrogen-assimilatory pathways in Saccharomyces
cerevisiae. One mutant carrying a recessive allele of
ure2 was isolated from an industrial S. cerevisiae strain. This mutation strongly deregulated the proline
utilization pathway. Fermentation kinetics of this mutant were studied
under enological conditions on simulated standard grape juices with
various nitrogen levels. Mutant strains produced more biomass and
exhibited a higher maximum CO2 production rate than the wild type. These differences were primarily due to the derepression of amino acid utilization pathways. When low amounts of
dissolved oxygen were added, the mutants could assimilate proline. Biomass yield and fermentation rate were consequently increased, and
the duration of the fermentation was substantially shortened. S. cerevisiae strains lacking URE2 function could improve alcoholic fermentation of natural media where proline and other poorly
assimilated amino acids are the major potential nitrogen source, as is
the case for most fruit juices and grape musts.
 |
INTRODUCTION |
A wide variety of
nitrogen-containing compounds are present in grape juice, depending
upon the grape variety and time of harvest. During fermentation, these
compounds are taken up during the first part of the Saccharomyces
cerevisiae growth phase. Biosynthetic pools of amino acids are
filled and the remaining nitrogenous compounds are utilized
as nitrogen sources (17). Once pools are filled and
growth begins, nitrogenous compounds are taken up and degraded
in a specific order depending on environmental, physiological, and
strain-specific factors (30, 32). Ammonium ions, which may
constitute up to 10% of the total assimilable nitrogen in the must
(26), reduce catabolic enzyme levels and transport activity
for nonpreferred nitrogen sources through a phenomenon known as
nitrogen catabolite repression (18). Nitrogen catabolite
repression is attributed to the action of three proteins, GLN3,
URE2, and GAP1 (36). The GLN3 and
URE2 gene products are required for the transcription
of many genes involved in alternative nitrogen-assimilatory pathways
(22). GLN3 activates their transcription when preferred
nitrogen sources are not available (38, 39), and URE2
represses their transcription when alternative nitrogen sources are not
needed (20). GAP1, the general amino acid permease that
transports all biological amino acids across the plasma membrane (28), is regulated at the transcriptional level by GLN3 and URE2 and is inactivated by dephosphorylation in the presence of glutamate and glutamine (48).
Alternative nitrogen-assimilatory pathways are not expressed
when ammonium is present. In grape juice, ammonium is the
preferred nitrogen source. As ammonium is consumed, amino acids are
taken up in a pattern determined by their concentration relative to cell needs for biosynthesis and to total nitrogen availability (40-42). Two exceptions are known: (i) proline is not taken
up from grape juice under anaerobic fermentative conditions
(27) and proline metabolism requires oxygen and a
functioning electron transport chain to cleave the proline ring
(51) and (ii) arginine and
-aminobutyrate are usually
taken up during the latter stages of fermentation under enological
conditions and are always detectable in the final wine (9).
Proline and arginine are the most common nitrogenous compounds in grape
juice and represent 30 to 65% of the total amino acid content of
grape juices (26). Both amino acids require the proline
utilization pathway for conversion to glutamate and ammonia
(12). Proline is transported into S. cerevisiae by the general amino acid permease and a proline-specific permease (product of PUT4 [36]). Proline is
converted to glutamate in the mitochondria by proline oxidase
(product of the PUT1 gene [51]) and
1-pyrroline-5-carboxylate dehydrogenase (product of
PUT2 [33]). The expression of the
PUT genes is regulated by the PUT3 activator protein. This
protein responds to the presence of proline in the medium and increases
transcription of PUT1 and PUT2 genes (10, 13). URE2 represses transcription of the PUT genes and
proline transporters under nitrogen-repressing conditions; the GLN3
protein has no effect on these genes (13, 53).
The objective of our work was to isolate mutants of an industrial
strain of S. cerevisiae that were no longer subject to
nitrogen catabolite repression, while studying the fermentation
kinetics of these mutants on simulated standard grape juice under
enological conditions. The ultimate goal of this research is to enhance
the degradation of proline and other poorly assimilated amino acids during the growth phase and evaluate the potential impact of these physiological changes on yeast metabolism and fermentation kinetics.
 |
MATERIALS AND METHODS |
Strains, vectors, and culture conditions.
Yeast strains.
S. cerevisiae strains used in this study were V5
(MATa ura3) and A45 (MAT
). These
two strains were derived from the same diploid industrial wine strain.
Both strains exhibited identical fermentation kinetics under enological
conditions. The ura3 genotype was introduced in the V5
strain at the haploid stage. This strain is preserved in the Collection
Nationale de Cultures de Microorganisms (CNCM, Institut Pasteur, Paris,
France) under reference no. I-1222. The A45 strain is preserved in our laboratory collection (Institut National de la Recherche Agronomique, Montpellier, France). Isogenic laboratory S. cerevisiae
strains MYC1 (MAT
ade2-1) and MYC2 (MATa
ade2-1) were used as mating-type tester strains (J. Conde, Sevilla, Spain).
Culture media. All media were heat sterilized (110°C, 30 min). The
standard nutrient medium used for the general cultivation of yeast
strains contained 1% yeast extract (Difco), 2% Bacto Peptone (Difco),
and 2% glucose (YPD). Glucose-glutamine, glucose-proline, and
glucose-ammonia liquid media contained 0.17% yeast nitrogen base (YNB)
without amino acids and ammonium sulfate (Difco), 2% glucose, 0.002%
uracil, and 0.1% glutamine, 0.1% proline, or 0.2% NH4H2PO4, respectively. The
synthetic fermentation media used in this study (symbolized as
MSx in the text, where x represents the
concentration of assimilable nitrogen [milligrams of N
liter
1]) were simulated standard grape juices strongly
buffered to pH 3.3 (5). These media contained the following
ingredients (per liter): glucose, 200 g; citric acid, 6 g;
DL-malic acid, 6 g; uracil, 20 mg; mineral salts
(KH2PO4, 750 mg; K2SO4,
500 mg; MgSO4 · 7H2O, 250 mg;
CaCl2 · 2H2O, 155 mg; NaCl, 200 mg;
MnSO4 · H2O, 4 mg; ZnSO4, 4 mg; CuSO4 · 5H2O, 1 mg; KI, 1 mg;
CoCl2 · 6H2O, 0.4 mg;
H3BO3, 1 mg; NaMoO4 · 2H2O, 1 mg); vitamins (myoinositol, 20 mg; nicotinic acid,
2 mg; calcium panthothenate, 1.5 mg; thiamin-HCl, 0.25 mg;
pyridoxine-HCl, 0.25 mg; biotin, 0.003 mg); anaerobic growth factors
(ergosterol, 15 mg; sodium oleate, 5 mg; Tween 80, 0.5 ml); nitrogen
source, 80 to 300 mg of N as ammoniacal nitrogen (18.6%
NH4Cl); and amino acids (L-proline, 20.5%;
L-glutamine, 16.9%; L-arginine, 12.5%;
L-tryptophan, 6%; L-alanine, 4.9%;
L-glutamic acid, 4%; L-serine, 2.6%;
L-threonine, 2.6%; L-leucine, 1.6%; L-aspartic acid, 1.5%; L-valine, 1.5%;
L-phenylalanine, 1.3%; L-isoleucine, 1.1%;
L-histidine, 1.1%; L-methionine, 1.1%;
L-tyrosine, 0.6%; L-glycine, 0.6%;
L-lysine, 0.6%; and L-cysteine, 0.4%). The
ammonium salts and
-amino acids (all amino acids except proline) in
the medium were considered assimilable nitrogen. For the proline degradation assay, the following medium was used: 0.17% YNB without amino acids and ammonium sulfate, 20% glucose, 0.002% uracil, 0.25%
proline (0.3 g of N liter
1), and 0.009%
(NH4)2SO4 (20 mg of N
liter
1). Ammonium was provided at a low initial level to
initiate cell growth.
Growth conditions. For YPD medium and glucose-ammonia and
glucose-proline liquid media, yeasts were inoculated at 10
6
cells ml
1 in 25-ml Erlenmeyer flasks containing 5 ml of
liquid medium and
incubated at 28°C on a rotary shaker. For
MS
x fermentation media,
yeasts were precultured at 28°C in
small fermentors (250 ml) with
fermentation locks under discontinuous
magnetic stirring (30 s
every 5 min). Inoculation was standardized at
10
6 cells ml
1. Cells were harvested by
centrifugation (500 ×
g, 5 min), rinsed
twice with
sterile 0.9% (wt/vol) NaCl, and inoculated in culture
medium. Yeast
cultures were grown in fermentors (1.2 liters) with
fermentation locks
(CO
2 bubbling outlets filled with water). Fermentation
media were normally deaerated by bubbling argon prior to inoculation
(initial oxygen concentration, <1 mg liter
1). Filling
conditions were controlled, and fermentations were
carried out during
anaerobiosis with continuous stirring under
isothermal conditions
(28°C). When oxygenation of the medium was
required at the beginning
of fermentation, the medium was oxygenated
by adding different amounts
of the same medium saturated with
pure O
2 at 4°C. During
fermentation, the fermentation medium was
oxygenated by adding a
synthetic solution saturated with pure
O
2 at 4°C. This
solution contained malic acid (6 g liter
1), citric acid
(6 g liter
1), sugar, and ethanol at the same
concentrations as in the fermenting
medium. The addition of 6 mg of
dissolved O
2 liter
1 by this method caused
10% dilution of the fermentation medium.
Control fermentations
involved 10% medium dilution with deaerated
synthetic solution. For
proline degradation assays, yeasts were
inoculated at 10
6
cells ml
1 in 30-ml Erlenmeyer flasks containing 29 ml of
argon-deaerated
liquid medium containing 0.17% YNB without amino acids
and ammonium
sulfate), 20% glucose, 0.002% uracil, 0.25% proline
(0.3 g of
N liter
1) and 0.009%
(NH
4)
2SO
4 (20 mg of N
liter
1). Ammonium was provided at a low initial level to
initiate cell
growth. Cultures were incubated for at least 48 h at
28°C without
agitation. Oxygen diffusion in the medium was prevented
by using
bubbling CO
2 outlets.
Genetic methods. (i) Mutagenesis and mutant selection.
V5
cells were spread on plates containing 0.17% YNB without amino acids
and ammonium sulfate, 20% glucose, 2% agar, 0.002% uracil, 0.25%
proline (0.3 g of N liter
1), and 0.48% methylamine (1 g
of N liter
1) at a cell density of 105 cells
per plate. UV mutants were obtained by irradiating plates with UV
(Philips UV-C 15 W; G15T8) for 40 s with a UV dose of 1,000 ergs mm
2. This dose killed 90 to 98% of the cells. V5
cells are impaired at methylamine concentrations above 0.24% (0.5 g of
N liter
1). All media were adjusted to pH 6.5 with
concentrated KOH prior to sterilization.
(ii) Mating type.
Mating type was determined by observing
zygote formation after mixed inoculation of cells with tester strains
MYC1 (MAT
) and MYC2 (MATa) on 2%
agar-YPD plates.
(iii) Sporulation.
Approximately 107 cells were
grown for 24 h on a plate of presporulation medium (1% yeast
extract, 0.5% Bacto Peptone, 2% agar, and 10% glucose) and then
spread on a plate of sporulation medium (1% yeast extract, 2% Bacto
Peptone, 2% agar, and 1% potassium acetate) and incubated at 28°C.
Sporulation efficiency was expressed as the ratio of asci to vegetative
cells in a total population of at least 103 cells.
(iv) Tetrad dissection.
The ascus sac was digested with
Helix pomatia gut juice (SHP; IBF-Sepracor) at 28°C for 20 min according to the method described by Johnston and Mortimer
(31), and spores were separated with a micromanipulator.
(v) Plasmid.
Centromeric plasmid p1C-CS contained the
URE2 gene inserted into the ClaI/SalI
site of the Ycp50 plasmid (20). For this plasmid, V5 strain
transformation was carried out on yeast spheroplasts (14).
(vi) URE gene disruption.
URE2 disruption
was obtained by internal deletion of the open reading frame (ORF) by
the method described by Wach et al. (50). A 1.4-kb PCR
fragment containing a dominant resistance module, kanMX, was amplified
by using plasmid pFA6-kanMX4 as template and two
oligonucleotides, TTGTTTTAAGCTGCAAATTAAGTTGTACACCAAATGATGACGTACG CTGCAGGTCGAC
and AAGCAGCCTTCATTCACCACGCAATGCCTTGATGACCGCGGATGAATTCGAGCTCG, containing 18 and 16 nucleotides, respectively, homologous to the
pFA6-kanMX4 multicloning site. In addition, these primers have
40-nucleotide extensions homologous to regions surrounding the start
codon (nucleotides
33 to 6) or the stop codon (nucleotides 1034 to
1073) of the URE2 ORF. The PCR product was used directly to
transform strain V5 by the lithium acetate method (47).
Cells were incubated at 28°C in YPD medium for 14 h and plated
on YPD medium containing 150 mg of G418 (Geneticin)
liter
1. Correct replacement of the URE2 ORF by
the kanMX4 module was checked by PCR with total genomic DNA and two
oligonucleotides homologous to a region upstream of the start codon
(nucleotides
88 to
72) or to that downstream of the stop codon
(nucleotides 1114 to 1132) of the URE2 ORF and having the
following sequences, respectively: ATCCCCCGTACGAACTT and
GCCTATATACATACCCTTA. PCR with transformants carrying a
correctly integrated kanMX4 module gave a 1.5-kb fragment instead of
the 1.2-kb fragment corresponding to the wild-type fragment.
Analytical methods. (i) Cell counting.
Cells were counted
after sonication (30 s, 10 W) with an electronic Coulter Counter
(model ZBI; Coulter Coultronics, Margency, France) fitted with a
100-µm probe.
(ii) Cellular dry weight.
Cellular dry weight was obtained
by filtering 10 ml of culture medium through membrane filters (pore
size, 1.2 µm). Filters were rinsed with the same amount of distilled
water, and cells were dessicated at 108°C until a constant weight was
obtained (24 h).
(iii) Total cell protein.
Total cell proteins were extracted
as described by Jayamaran et al. (29).
(iv) Protein determination.
The protein concentration was
determined with the bicinchoninic acid protein assay reagent (Pierce
Chemicals, Rockford, Ill.), with crystalline bovine serum albumin as
standard.
(v) Determination of assimilable nitrogen in fermentation
media.
Ammonium and
-amino acid concentrations were measured by
enzymatic assay (8) and the TNBS
(2,4,6-trinitrobenzenesulfonic acid) method (23),
respectively. Proline concentrations in fermentation media were
determined by the method of Yemm and Cocking (54).
(vi) Determination of amino acid profiles in fermentation
media.
An aliquot of each fermentation medium (10 ml) was mixed
with 50 ml of 96% (vol/vol) ethanol and allowed to stand for 48 h at
20°C to precipitate proteins and polysaccharides. After
centrifugation (20,000 × g, 20 min), the supernatant
was dried under vacuum and resuspended in 0.2 N lithium citrate buffer
(pH 2.2). Amino acids were separated by ion-exchange chromatography on
an anionic Ultropac-8 lithium form resin (Pharmacia) with a Chromakon
400 analyzer (Kontron) and detected after reaction with ninhydrin
(6, 7).
(vii) Proline uptake experiments.
We estimated high-affinity
proline uptake by using the proline-specific permease (PUT4
gene product) and low-affinity proline uptake by using both the general
amino acid and the proline-specific permeases (GAP1 and
PUT4 gene products, respectively). The methodology described
by Brandriss and Magasanik (11) was used. Since the affinities of these permeases for proline are very different (2.5 mM
and 31 µM, respectively), uptake was studied with
L-[U-14C]proline (ICN Biomedicals,
Oxfordshire, United Kingdom) at a final proline concentration of 10 mM
(10 µCi mmol
1) or 100 µM (500 µCi
mmol
1) for studying low-affinity or high-affinity proline
uptake activity, respectively.
(viii) NAD-linked glutamate dehydrogenase assay.
Yeast cell
crude extracts were prepared by vortexing exponentially growing cells
with glass beads as previously described (15). NAD-dependent
glutamate dehydrogenase assays were performed as described by Miller
and Magasanik (37).
(ix) Fermentation kinetics.
The amount of CO2
released was determined by automatic measurement of fermentor weight
loss every 20 min (45). Loss of ethanol and water by
CO2 stripping represented less than 2% of the total fermentor weight loss. The CO2 production rate was
calculated by polynomial smoothing of the last 10 measurements of
fermentor weight loss. The numerous acquisitions (one datum point every 20 min) and the precision of the fermentor weighing (0.01 g) allowed calculation of the CO2 production rate with good precision
(5).
(x) Dissolved oxygen measurements.
Dissolved oxygen
measurement were routinely performed with a dissolved oxygen probe
(OXI90 model; Wissenschaftlich Technische Werkstätten, Weilheim,
Germany).
 |
RESULTS |
Isolation and characterization of an S. cerevisiae
mutant strain V5 derepressed for proline utilization.
Derepressed
mutants were obtained after UV mutagenesis by selecting for
resistance to the ammonium analog methylamine. Mutant strains were
screened for their ability to grow on plates containing proline as the
sole nitrogen source and methylamine at a repressive concentration.
Except for one, all 40 isolated mutants exhibited clear derepression of
amino acid utilization under nitrogen repression (data not shown). Most
of these strains could not grow on plates with proline as the sole
nitrogen source under oxygen-limiting conditions (Table
1). Only one mutant (UV9) could degrade
proline under such conditions and increase biomass. UV9 cells had
better nitrogen assimilation efficiency and therefore higher
nitrogen contents than the other tested strains. This result suggests
that UV9 was altered in its ability to regulate proline utilization. Proline uptake requires either the general amino acid permease or a
specific proline permease. Since both systems are subject to nitrogen
repression, we estimated the capacities of wild-type and UV9
mutant strains for proline uptake by both permeases under different culture conditions (Table 2).
The UV9 strain had a higher capacity for high-affinity proline
uptake (PUT4 function) than the wild type under nitrogen-repressing
conditions (MS300 medium). Control experiments performed under
derepressing conditions (glucose-proline medium) revealed a significant
increase in proline-specific permease activity in the UV9 mutant.
We also studied amino acid utilization by UV9 cells on simulated
standard grape juice. Mutant and wild-type strains were inoculated
at
the same cell density on MS80 and MS300 synthetic media and
harvested
at the end of the growth phase. The amino acid composition
was
determined in both fermentation media (Fig.
1 and
2).
In both
cases, UV9 utilized more amino acids than the V5 strain, except
for histidine, leucine, lysine, methionine, and threonine. Glutamate,
which is one of the two end products of nitrogen catabolic pathways
of
yeasts (
34), is excreted at low concentration into the
fermentation
medium by wild-type cells during the growth phase
(
52) but is
not excreted by UV9. This result may indicate
the presence of
a strongly derepressed catabolic NAD-linked glutamate
dehydrogenase
(NAD-GDH) favoring the interconversion of glutamate into
ammonia
within UV9 cells (
21,
37). We tested this
hypothesis by measuring
the level of NAD-GDH in both strains
under strongly repressing
conditions (glucose-glutamine
medium). We observed that the mutant
strain exhibited higher NAD-GDH
specific activity than the wild
type under such conditions (490 ± 8 nmol min
1 mg of protein
1 versus 59 ± 6 nmol min
1 mg of protein
1, three
determinations). In the absence of oxygen on these two
fermentation
media, the UV9 mutant always reached a higher final
biomass than V5
cells (2.5 versus 2.3 g [dry weight] liter
1 and
5.2 versus 3.4 g [dry weight] liter
1 on MS80 and
MS300 media, respectively).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
Amino acid composition of MS80 synthetic medium before
(A) and after 28-h fermentation by wild-type V5 (B) and mutant UV9 (C)
strains. At this harvest time, fermentation progress was 0.155 for both
strains. Mean values and standard errors of three different experiments
are shown. Abbreviations: Gaba, -aminobutyrate; Ala, alanine; Asp,
aspartate; Cys, cysteine; Etn, ethanolamine; Glu, glutamate; Gln,
glutamine; Gly, glycine; His, histidine; Ile, isoleucine; Leu, leucine;
Lys, lysine; Met, methionine; Orn, ornithine; Phe, phenylalanine; Ser,
serine; Thr, threonine; Tyr, tyrosine; Val, valine; NH4, ammonium ions;
Pro, proline; and Arg, arginine.
|
|

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 2.
Amino acid composition of MS300 synthetic medium before
(A) and after 28-h fermentation by wild-type V5 (B) and mutant UV9 (C)
strains. At this harvest time, fermentation progress was 0.194 and
0.250 for V5 and UV9 strains, respectively. Mean values and standard
errors of three different experiments are shown. Abbreviations are the
same as those in the legend for Fig. 1.
|
|
Characterization of the mutated URE2 allele.
We
crossed UV9 with the wild-type A45 strain. The diploids could
not grow on plates containing proline as the sole nitrogen source
and methylamine at a repressive concentration. We characterized these
cells for their ability to use proline as the nitrogen source for
growth under oxygen-limiting conditions (Table
3). Heterozygous diploids (initial cross
A45 × UV9: Z6 and Z14) reached the same biomass as the wild-type
strain, indicating that the mutation is recessive. All 25 tetrads from
this cross segregated 2+/2
for this
character, indicating that a single mutation is responsible for this
phenotype. Feedback crosses with the parental UV9 strain or direct
crossing of haploids allowed us to construct homozygous diploids for
the corresponding mutation (Table 3).
Since
ure2 mutant alleles (also known as
usu and
gdhCR) have been isolated in a number of screens designed to
isolate mutants
with increased amino acid permease activity
(
22) or genetic
derepression of NAD-linked glutamate
dehydrogenase (
24), we
also checked the identity of the
isolated mutation as a recessive
mutation in the
URE2 gene.
Strains with recessive
URE2 gene mutations
were previously
characterized as possessing nitrogen catabolic
enzymes insensitive to
nitrogen catabolite repression (
16),
mainly in the pathways
involved in glutamate, glutamine, arginine,
allantoin, urea,

-aminobutyrate, and proline assimilation (
13).
As
previously described for
ure2 mutants (
53),
the UV9 strain
grew aerobically more slowly than the wild-type
strain V5 on a
glucose-ammonia medium (doubling time of 3.5 versus
2.6 h) or
on a glucose-proline medium (doubling time of 8.9 versus
5.5 h).
Similarly, exposure of the mutant strain to heat shock
(45°C,
3 h) resulted in reduced recovery at 30°C compared with
the V5
wild-type strain on YPD plates: survival rates were 13 and 49%,
respectively.
All diploids homozygous for the mutation failed to sporulate (Table
3).
Very low sporulation efficiency is a characteristic
of homozygous
ure2/ure2 diploids (
53). To confirm that the
isolated
mutation had occurred in
ure2, the UV9 mutant was
transformed
with the centromeric plasmid p1C-CS containing
URE2 (
20). The
resulting strain UV9/p1C-CS
exhibited a phenotype analogous to
that of the wild-type strain V5.
Finally, in the wild-type strain
V5, we disrupted
URE2,
leading to a
URE2 null allele (mutant strain
V5/
ure2::kan). This mutant behaved like UV9 for
most of its growth
phenotypes (Table
3).
Potential technological application of ure2 mutant
strains in wine fermentations.
Typical concentrations of total
available nitrogen in real grape juices ranged from 50 to 800 mg of N
liter
1, although assimilable nitrogen represents only 30 to 500 mg of N liter
1 (4, 5). An assimilable
nitrogen concentration of 80 mg of N liter
1 is considered
limiting for both growth and fermentation of industrial S. cerevisiae strains under enological conditions (5). In
the absence of oxygen, both ure2 strains had a higher
maximum CO2 production rate and final biomass than V5 on
two simulated standard grape juices, leading to quicker fermentation
(about 100 instead of 115 h) (Fig.
3A and B and 4A and B). Under such
conditions, regardless of initial must nitrogen content, assimilation
of all nitrogen substrates was better in ure2 strains than
in the wild type (Table 4). The
increased level of amino acid permeases and derepression of amino
acid utilization under ammoniacal nitrogen repression in
ure2 strains may be solely responsible for these effects.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 3.
Variations in the CO2 production rate by
wild-type V5 ( ) and mutant UV9 ( ) and
V5/ure2::kan ( ) strains in MS300 culture medium
at 28°C in the absence (A and B) or in the presence (C and D) of 6 mg
of dissolved oxygen liter 1. The arrows indicate the time
of dissolved oxygen addition for each strain. The CO2
production rate patterns are represented as a function of fermentation
progress (panels A and C) or of fermentation time (panels B and D).
Final cell populations were 236 × 106, 286 × 106, and 293 × 106 cells
ml 1 in the absence of oxygen and 235 × 106, 340 × 106, and 367 × 106 cells ml 1 in the presence of oxygen for
V5, UV9, and V5/ure2::kan strains, respectively.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 4.
Effect of initial oxygen addition on fermentation
characteristics of wild-type V5 and UV9 and
UV9/ure2::kan mutant strains in MS80
synthetic medium
|
|
We also tested the ability of
ure2 mutants to degrade
proline in simulated standard grape juices in the presence of oxygen.
Air or oxygen diffusion during wine fermentation is a legal practice
(
23a); some authors have shown that oxygen addition improves
the synthesis of anaerobic growth factors (ergosterol and unsaturated
fatty acids [
2,
3]) at the end of the cell growth
phase
(
43,
44). Nevertheless, in enological conditions, this
oxygen
requirement is low and is estimated at 5 to 10 mg
liter
1 (
43). We tested growth with increased
initial dissolved oxygen
concentrations in a nitrogen-limited
simulated grape juice (MS80)
containing anaerobic growth factors.
Under these conditions, at
oxygen concentrations equal to or above 6 mg
liter
1, both
ure2 strains utilized proline
more efficiently than wild
type, produced more biomass, and
exhibited a higher maximum CO
2 production rate (Table
4).
We also checked the effect of dissolved oxygen addition at the end of
the cell growth phase on MS80 and MS300 media (Fig.
3 and
4). On MS80 medium, oxygen addition had a
slight effect
on the maximum fermentation rate of UV9 and no effect on
V5; this
effect was not sufficient to reduce the fermentation duration
(Fig.
4). This effect was amplified on MS300 medium, where there
were
higher levels of assimilable nitrogen compounds and proline.
V5 was
weakly affected by oxygen addition (Fig.
3C and D), but
ure2
strains produced more biomass and maintained a higher CO
2 production rate than V5 throughout the fermentation. Consequently,
the
fermentation duration decreased from 100 to only about 85
h. This
effect of oxygen addition could be attributed primarily
to
deregulation of the proline utilization pathway in
ure2
mutants.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 4.
Variations in the CO2 production rate by
wild-type V5 ( ) and mutant UV9 ( ) strains in MS80 culture medium
at 28°C in the absence (A and B) or presence (C and D) of 6 mg of
dissolved oxygen liter 1. The arrows indicate the times of
dissolved oxygen addition. The CO2 production rate patterns
are represented as a function of fermentation progress (panels A and C)
or of fermentation time (panels B and D). Final cell populations were
125 × 106 cells ml 1 for both strains in
the absence of oxygen, and 125 × 106 cells
ml 1 and 135 × 106 cells
ml 1 for V5 and UV9 strains in the presence of oxygen,
respectively.
|
|
 |
DISCUSSION |
Metabolism of nitrogen compounds by S. cerevisiae may
govern the efficiency of alcoholic fermentation and affect the final product quality. Proline and arginine are the most abundant amino acids in fruit juices, but S. cerevisiae is not able
to completely utilize these two amino acids during alcoholic
fermentation. Derepression for the assimilation of amino acids in
ure2 mutant strains of S. cerevisiae leads to
better amino acid assimilation during alcoholic fermentation. Moreover,
these strains can assimilate a significant amount of proline,
especially following incorporation of small amounts of oxygen in the
fermentation medium (as low as 6 mg of dissolved oxygen
liter
1) at the end of the yeast growth phase. Cleavage of
the proline ring requires oxygen and a functioning electron transport
chain (51). As high hexose concentrations inhibit
respiration by first closing mitochondrial voltage-dependent
anion-selective channels (1) and then repressing key enzymes
in the respiratory chain (19), this observed proline
degradation in ure2 strains under strong glucose-repressive
conditions indicates that mitochondria retain their full potential for
this degradation. Further research is needed to clarify the specific
role of mitochondria under such conditions.
The more efficient use of amino acids allowed ure2 strains
to reach a higher final biomass and consequently to ferment natural media faster than wild-type cells. Thus, natural and industrial yeasts
might be expected to lose URE2 repressor function during evolution. The
much longer generation time of ure2 mutants on glucose-containing media could explain why selection has not favored spontaneous ure2 mutants. The ure2 mutants also
were more sensitive to thermal stress than the corresponding wild type.
This sensitivity might carry over to other stress situations, such as
ethanol stress, but remains to be examined in detail.
From a technological point of view, S. cerevisiae strains
lacking URE2 function could improve alcoholic fermentation of natural media where proline and other poorly assimilated amino acids
represent the major potential nitrogen source. The metabolism of
nitrogen-containing compounds yields some end products of sensory
importance for wine quality. For example, amino acids are
deaminated catabolically to release their nitrogenous components and
leave their carbon skeletons. This deamination step can result in the
formation of
-keto acids or of higher (fusel) alcohols.
Further research is needed to identify the specific impact of
ure2 strain fermentation on the overall flavor and aroma
profile of wines.
 |
ACKNOWLEDGMENTS |
We thank M. J. Biron for technical assistance, especially
with the genetic methods, E. Baptista for the construction of
ure2 disruptants, and M. Pradal for assistance with the
amino acid analyses. The plasmid p1C-CS was kindly provided by D. Rowen
(Massachusetts Institute of Technology, Cambridge, Mass.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratoire de
Microbiologie et de Technologie des Fermentations, Institut des
Produits de la Vigne, Institut National de la Recherche Agronomique, 2 place Viala, 34060 Montpellier Cedex 1, France. Phone: (33) 499612505. Fax: (33) 499612857. E-mail: jmsalmon{at}ensam.inra.fr.
 |
REFERENCES |
| 1.
|
Ahmadzadeh, M.,
A. Horng, and M. Colombini.
1996.
The control of mitochondrial respiration in yeasts: a possible role of the outer mitochondrial membrane.
Cell Biochem. Funct.
14:201-208[Medline].
|
| 2.
|
Andreasen, A. A., and T. J. B. Stier.
1953.
Anaerobic nutrition of Saccharomyces cerevisiae. I. Ergosterol requirement for growth in a defined medium.
J. Cell. Comp. Physiol.
41:23-36.
[Medline] |
| 3.
|
Andreasen, A. A., and T. J. B. Stier.
1954.
Anaerobic nutrition of Saccharomyces cerevisiae. II. Unsaturated fatty acid requirement for growth in a defined medium.
J. Cell. Comp. Physiol.
43:271-281.
|
| 4.
|
Bely, M.,
J. M. Sablayrolles, and P. Barre.
1990.
Automatic detection of assimilable nitrogen deficiencies during alcoholic fermentations in enological conditions.
J. Ferment. Bioeng.
70:246-252.
|
| 5.
|
Bely, M.,
J. M. Sablayrolles, and P. Barre.
1990.
Description of alcoholic fermentation kinetics: its variability and significance.
Am. J. Enol. Vitic.
40:319-324.
|
| 6.
|
Benson, J. V.
1972.
Multipurpose resins for analysis of amino acids and ninhydrin-positive compounds in hydrolysates and physiological fluids.
Anal. Biochem.
50:477-493[Medline].
|
| 7.
|
Benson, J. V.,
M. J. Gordon, and J. A. Patterson.
1967.
Accelerated chromatographic analysis of amino acids in physiological fluids containing glutamine and asparagine.
Anal. Biochem.
18:228-240.
|
| 8.
|
Bergmeyer, H. U., and H. O. Beutler.
1985.
Ammonia, p. 454-462.
In
H. U. Bergmeyer (ed.), Methods of enzymatic analysis. Metabolites. 3. Lipids, amino acids and related compounds, 3rd ed., vol. 8. VCH, Weinheim, Federal Republic of Germany.
|
| 9.
|
Boulton, R. B.,
V. L. Singleton,
L. F. Bisson, and R. E. Kunkee.
1996.
Nitrogen metabolism during fermentation, p. 153-167.
In
Principles and practices of winemaking. International Thomson Publishing, New York, N.Y.
|
| 10.
|
Brandriss, M. C.
1983.
Proline utilization in Saccharomyces cerevisiae: analysis of the cloned PUT2 gene.
Mol. Cell. Biol.
3:1846-1856[Abstract/Free Full Text].
|
| 11.
|
Brandriss, M. C., and B. Magasanik.
1979.
Genetics and physiology of proline utilization in Saccharomyces cerevisiae: enzyme induction by proline.
J. Bacteriol.
140:498-503[Abstract/Free Full Text].
|
| 12.
|
Brandriss, M. C., and B. Magasanik.
1980.
Proline: an essential intermediate in arginine degradation in Saccharomyces cerevisiae.
J. Bacteriol.
143:1403-1410[Abstract/Free Full Text].
|
| 13.
| Brandriss, M. C., D. A. Falvey, S. A. G. des Etages, and S. Xu. 1995. The roles of PUT3, URE2,
and GLN3 regulatory proteins in the proline utilization pathway of
Saccharomyces cerevisiae. Can. J. Bot. 73(Suppl.
1):S153-S159.
|
| 14.
|
Burgers, P. J. M., and K. J. Percival.
1987.
Transformation of yeast spheroplasts without cell fusion.
Anal. Biochem.
163:391-397[Medline].
|
| 15.
|
Camarasa, C.,
S. Prieto,
R. Ros,
J. M. Salmon, and P. Barre.
1996.
Evidence for a selective and electroneutral K+/H+-exchange in Saccharomyces cerevisiae using plasma membrane vesicles.
Yeast
12:1301-1313[Medline].
|
| 16.
|
Coffman, J. A.,
H. M. el Berry, and T. G. Cooper.
1994.
The URE2 protein regulates nitrogen catabolic gene expression through the GATAA-containing UASNTR element in Saccharomyces cerevisiae.
J. Bacteriol.
176:7476-7483[Abstract/Free Full Text].
|
| 17.
|
Cooper, T. G.
1982.
Nitrogen metabolism in Saccharomyces cerevisiae, p. 39-99.
In
J. N. Strathern, E. W. Jones, and J. B. Broach (ed.), The molecular biology of the yeast Saccharomyces. Metabolism and gene expression. Cold Spring Harbor Laboratory, New York, N.Y.
|
| 18.
|
Cooper, T. G., and R. A. Sumrada.
1983.
What is the function of nitrogen catabolite repression in Saccharomyces cerevisiae?
J. Bacteriol.
155:623-627[Abstract/Free Full Text].
|
| 19.
|
Correa Garcia, S.,
M. Bermudez Moretti,
M. Cardalda,
M. V. Rossetti, and A. M. del C. Batlle.
1993.
The role of ALA-S and ALA-D in regulating porphyrin biosynthesis in a normal and a HEM R+ mutant strain of Saccharomyces cerevisiae.
Yeast
9:165-173[Medline].
|
| 20.
|
Coschigano, P., and B. Magasanik.
1991.
The URE2 gene product of Saccharomyces cerevisiae plays an important role in the cellular response to the nitrogen source and has homology to glutathione S-transferases.
Mol. Cell. Biol.
11:822-832[Abstract/Free Full Text].
|
| 21.
|
Coschigano, P. W.,
S. M. Miller, and B. Magasanik.
1991.
Physiological and genetic analysis of the carbon regulation of the NAD-dependent glutamate dehydrogenase of Saccharomyces cerevisiae.
Mol. Cell. Biol.
11:4455-4465[Abstract/Free Full Text].
|
| 22.
|
Courchesne, W. E., and B. Magasanik.
1988.
Regulation of nitrogen assimilation in Saccharomyces cerevisiae: roles of the URE2 and GLN3 genes.
J. Bacteriol.
170:708-713[Abstract/Free Full Text].
|
| 23.
|
Crowell, E. A.,
C. S. Ough, and A. Bakalinsky.
1985.
Determination of alpha amino nitrogen in musts and wines by TNBS method.
Am. J. Enol. Vitic.
36:175-177.
[Abstract/Free Full Text] |
| 23a.
|
European Economic Community.
1987.
Council regulation 822/87 of 16 March 1987 on the common organization of the market of wine. Official journal no. L084, annexe VI, point 3b, p. 1-58.
Office for Official Publications of European Communities, Luxembourg, Luxembourg.
|
| 24.
|
Grenson, M.,
E. Dubois,
M. Piotrwska,
R. Drillen, and M. Aigle.
1974.
Ammonia assimilation in Saccharomyces cerevisiae as mediated by the two glutamate dehydrogenases.
Mol. Gen. Genet.
128:73-85[Medline].
|
| 25.
|
Grenson, M.,
C. Hou, and M. Crabeel.
1970.
Multiplicity of the amino acid permeases in Saccharomyces cerevisiae. IV. Evidence for a general amino acid permease.
J. Bacteriol.
103:770-777[Abstract/Free Full Text].
|
| 26.
|
Henschke, P. A., and V. Jiranek.
1991.
Hydrogen sulfide formation during fermentation: effects of nitrogen composition in model grape musts, p. 101-158.
In
J. M. Rantz (ed.), International nitrogen symposium on grapes and wine. American Society for Enology and Viticulture, Davis, Calif.
|
| 27.
|
Ingledew, W. M.,
C. A. Magnus, and F. W. Sosulski.
1987.
Influence of oxygen on proline utilization during the wine fermentation.
Am. J. Enol. Vitic.
38:246-248.
[Abstract/Free Full Text] |
| 28.
|
Jauniaux, J. C., and M. Grenson.
1990.
GAP1, the general amino acid permease gene of Saccharomyces cerevisiae.
Eur. J. Biochem.
190:39-44[Medline].
|
| 29.
|
Jayamaran, J.,
J. C. Cotman,
H. M. Mahler, and C. V. Sharp.
1966.
Biochemical correlation of respiration deficiency. VII. Glucose repression.
Arch. Biochem. Biophys.
116:224-252[Medline].
|
| 30.
|
Jiranek, V.,
P. Langridge, and P. A. Henschke.
1990.
Nitrogen requirements of yeast during wine fermentation, p. 166-171.
In
P. J. Williams, D. M. Davidson, and T. H. Lee (ed.), Proceedings of the 7th Australian wine industry technical conference. Australian Industrial Publishers S.A., Adelaide, Australia.
|
| 31.
|
Johnston, J. R., and R. K. Mortimer.
1959.
Use of snail digestive juice in isolation of yeast spore tetrads.
J. Bacteriol.
78:292[Free Full Text].
|
| 32.
|
Jones, M., and J. S. Pierce.
1964.
Adsorption of amino acids from wort by yeasts.
J. Inst. Brew.
70:307-315.
|
| 33.
|
Krzywicki, K. A., and M. C. Brandriss.
1984.
Primary structure of the nuclear PUT2 gene involved in the mitochondrial pathway for proline utilization in Saccharomyces cerevisiae.
Mol. Cell. Biol.
4:2837-2842[Abstract/Free Full Text].
|
| 34.
|
Large, P. J.
1986.
Degradation of organic nitrogen compounds by yeasts.
Yeast
2:1-34.
|
| 35.
|
Lasko, P., and M. C. Brandriss.
1981.
Proline transport in Saccharomyces cerevisiae.
J. Bacteriol.
148:241-247[Abstract/Free Full Text].
|
| 36.
|
Magasanik, B.
1992.
Regulation of nitrogen utilization, p. 283-317.
In
E. W. Jones, J. R. Pringle, and J. B. Broach (ed.), The molecular and cellular biology of the yeast Saccharomyces, vol. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 37.
|
Miller, S. M., and B. Magasanik.
1990.
Role of NAD-linked glutamate dehydrogenase in nitrogen metabolism in Saccharomyces cerevisiae.
J. Bacteriol.
172:4927-4935[Abstract/Free Full Text].
|
| 38.
|
Minehart, P. L., and B. Magasanik.
1991.
Sequence and expression of GLN3, a positive nitrogen regulatory gene of Saccharomyces cerevisiae encoding a protein with a putative zinc finger DNA-binding domain.
Mol. Cell. Biol.
11:6216-6228[Abstract/Free Full Text].
|
| 39.
|
Mitchell, A. P., and B. Magasanik.
1984.
Regulation of glutamine-repressible gene products by the GLN3 function in Saccharomyces cerevisiae.
Mol. Cell. Biol.
4:2758-2766[Abstract/Free Full Text].
|
| 40.
|
Monteiro, F. F., and L. F. Bisson.
1991.
Amino acids utilization and urea formation during vinification.
Am. J. Enol. Vitic.
42:199-208.
[Abstract/Free Full Text] |
| 41.
|
Monteiro, F. F., and L. F. Bisson.
1992.
Nitrogen supplementation of grape juice. I. Effect on amino acid utilization during fermentation.
Am. J. Enol. Vitic.
43:1-10.
[Abstract/Free Full Text] |
| 42.
|
Monteiro, F. F., and L. F. Bisson.
1992.
Nitrogen supplementation of grape juice. II. Effect on amino acid and urea release following fermentation.
Am. J. Enol. Vitic.
43:11-17.
[Abstract/Free Full Text] |
| 43.
|
Sablayrolles, J. M., and P. Barre.
1986.
Evaluation des besoins en oxygène de fermentations alcooliques en conditions oenologiques simulées.
Sci. Alim.
6:373-383.
|
| 44.
|
Sablayrolles, J. M.,
P. Barre, and P. Grenier.
1987.
Design of a laboratory automatic system for studying alcoholic fermentations in anisothermal enological conditions.
Biotechnol. Tech.
1:181-184.
|
| 45.
|
Sablayrolles, J. M.,
J. M. Salmon, and P. Barre.
1996.
Carences nutritionnelles des moûts. Efficacité des ajouts combinés d'oxygène et d'azote ammoniacal.
Rev. Fr. Oenol.
159:25-32.
|
| 46.
|
Salmon, J. M.,
O. Vincent,
J. C. Mauricio,
M. Bely, and P. Barre.
1993.
Sugar transport inhibition and apparent loss of activity in Saccharomyces cerevisiae as a major limiting factor of enological fermentations.
Am. J. Enol. Vitic.
44:56-64.
[Abstract/Free Full Text] |
| 47.
|
Schiestl, R. H., and R. D. Gietz.
1989.
High efficiency transformation of intact cells using single stranded nucleic acid as carrier.
Curr. Genet.
16:339-446[Medline].
|
| 48.
|
Stanbrough, M., and B. Magasanik.
1995.
Transcriptional and posttranslational regulation of the general amino acid permease of Saccharomyces cerevisiae.
J. Bacteriol.
177:94-102[Abstract/Free Full Text].
|
| 49.
|
Stucka, R.,
S. Dequin,
J. M. Salmon, and C. Gancedo.
1991.
DNA sequences in chromosomes II and VII code for pyruvate carboxylase isoenzymes in Saccharomyces cerevisiae: analysis of pyruvate carboxylase-deficient strains.
Mol. Gen. Genet.
229:307-315[Medline].
|
| 50.
|
Wach, A.,
A. Brachat,
R. Pöhlmann, and P. Philippsen.
1994.
New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae.
Yeast
10:1793-1808[Medline].
|
| 51.
|
Wang, S. S., and M. C. Brandriss.
1987.
Proline utilization in Saccharomyces cerevisiae: sequence, regulation, and mitochondrial localization of the PUT1 gene product.
Mol. Cell. Biol.
7:4431-4440[Abstract/Free Full Text].
|
| 52.
|
Watson, T. G.
1976.
Amino-acid pool composition of Saccharomyces cerevisiae as a function of growth rate and amino acid nitrogen source.
J. Gen. Microbiol.
96:263-268[Abstract/Free Full Text].
|
| 53.
|
Xu, S.,
D. A. Falvey, and M. C. Brandriss.
1995.
Roles of URE2 and GLN3 in the proline utilization pathway in Saccharomyces cerevisiae.
Mol. Cell. Biol.
15:2321-2330[Abstract].
|
| 54.
|
Yemm, E. W., and E. C. Cocking.
1955.
The determination of amino acids with ninhydrin.
Analyst
80:209-213.
|
Applied and Environmental Microbiology, October 1998, p. 3831-3837, Vol. 64, No. 10
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Talarek, N., Maillet, L., Cullin, C., Aigle, M.
(2005). The [URE3] Prion Is Not Conserved Among Saccharomyces Species. Genetics
171: 23-34
[Abstract]
[Full Text]
-
Nakayashiki, T., Kurtzman, C. P., Edskes, H. K., Wickner, R. B.
(2005). Yeast prions [URE3] and [PSI+] are diseases. Proc. Natl. Acad. Sci. USA
102: 10575-10580
[Abstract]
[Full Text]
-
Varela, C., Pizarro, F., Agosin, E.
(2004). Biomass Content Governs Fermentation Rate in Nitrogen-Deficient Wine Musts. Appl. Environ. Microbiol.
70: 3392-3400
[Abstract]
[Full Text]