Previous Article | Next Article 
Applied and Environmental Microbiology, October 1998, p. 4068-4072, Vol. 64, No. 10
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Development of Bacterium-Based Heavy Metal Biosorbents: Enhanced
Uptake of Cadmium and Mercury by Escherichia coli
Expressing a Metal Binding Motif
Mehran
Pazirandeh,*
Bridget M.
Wells, and
Rebecca
L.
Ryan
Center for Bio/Molecular Science and
Engineering, Naval Research Laboratory, Washington, D.C. 20375
Received 24 April 1998/Accepted 10 July 1998
 |
ABSTRACT |
A gene coding for a de novo peptide sequence containing a metal
binding motif was chemically synthesized and expressed in Escherichia coli as a fusion with the maltose binding
protein. Bacterial cells expressing the metal binding peptide fusion
demonstrated enhanced binding of Cd2+ and Hg2+
compared to bacterial cells lacking the metal binding peptide. The
potential use of genetically engineered bacteria as biosorbents for the
removal of heavy metals from wastewaters is discussed.
| |
TEXT |
The discharge of heavy metals into
the environment due to agricultural, industrial, and military
operations and the effect of this pollution on the ecosystem and human
health are growing concerns. Recent research in the area of heavy metal
removal from wastewaters and sediments has focused on the development
of materials with increased affinity, capacity, and selectivity for
target metals (7, 8, 30). The use of microorganisms to
sequester, precipitate, or alter the oxidation state of various heavy
metals has been extensively studied (7, 8, 15, 24, 27).
Expression of metallothioneins (1, 17, 20, 24, 25) or
metallopeptides (4, 28) to increase the affinity and
biosorptive capabilities of bacterial cells for heavy metals is a
promising technology for the development of bacterium-based
biosorbents. We are studying the expression of metal binding peptides
with high affinity and selectivity for target metals in
Escherichia coli and the potential use of such peptides as
heavy metal biosorbents. We previously reported expression of the
Neurospora crassa metallothionein gene in E. coli
by fusion to the maltose binding protein of expression vector pMAL (New
England Biolabs) (21). This recombinant E. coli
organism was shown to remove heavy metals such as Cd2+ from
simulated and actual wastewater samples (3, 20). The de novo
design of metal binding motifs has been described and offers the
potential for the design and expression of peptides with high affinity
and selectivity for various metals (5, 9, 12, 14, 23). In
addition to the metallothioneins, peptides which contain an abundance
of cysteine residues or Cys-Gly motifs have been shown to have a high
affinity for Cd2+ and Hg2+ (5, 22).
In this study, heavy metal removal by bacterial cells expressing a
repetitive metal binding motif, (Cys-Gly-Cys-Cys-Gly)3, expressed as a fusion with the maltose binding protein is reported.
Synthesis of the metal binding gene.
The metal binding gene
encodes 21 amino acids with the motif Cys-Gly-Cys-Cys-Gly repeated
three times and linked through a three-amino-acid sequence (Fig.
1A). Four overlapping oligonucleotides were synthesized (0.2 µM scale) on an Applied Biosystems
371 DNA synthesizer. Oligonucleotides were purified and
subsequently phosphorylated, hybridized, and ligated by using standard
molecular biology protocols as described previously (16).
The sequences for the four overlapping oligonucleotides used are as
follows: SYNTOP1, 5' GATCCTGTGGTTGCTGTGGCAAAGGTCATTGTGGCTGT 3'; SYNTOP2, 5' TGCGGCAAAGGTCACTGCGGTTGCTGTGGTA 3';
SYNBOT1,
5' TTTGCCGCAACAGCCACAATGACCTTTGCCACAGCA ACCACAG
3'; and SYNBOT2, 5' AGCTTACCACAGCAACCGCAGTGACC 3'.
View larger version (31K):
[in this window]
[in a new window]
|
FIG. 1.
Cloning of the metal binding gene into the pMAL-p
vector. (A) Nucleotide and amino acid sequence of the metal binding
gene. (B) Map of vector pMAL-p. (C) DNA sequence of metal binding gene
cloned in pMAL-p. Ori, origin of replication.
|
|
The constructed gene contains
BamHI and
HindIII overhangs at the 5' and 3' ends, respectively,
for directional cloning into
expression vector pMAL-p digested with
these restriction enzymes.
Following ligation, bacterial cells were
transformed and screened
for colonies containing the gene insert by
hybridization and restriction
analysis. DNA sequencing of
positive clones (performed by the
University of Georgia DNA Sequencing
Facility) confirmed the correct
in-frame cloning of the gene into
pMAL-p, yielding expression
vector pMAL-p-syn. Figure
1C presents
the DNA sequence of pMAL-p-syn
showing the metal binding gene insert
flanked by the
BamHI and
HindIII sites of
vector pMAL-p.
Expression and localization within the periplasm.
The
expression of small proteins in E. coli has often been
problematic due to instability and degradation (18, 21).
This is especially true in cases where the protein is repetitive in nature. These problems have been minimized by expressing these proteins
as fusion proteins (18, 21, 25, 26). We previously expressed
the N. crassa metallothionein gene within the cytoplasm and periplasm of E. coli by using the fusion protein of
vector pMAL-c and pMAL-p (encoding the maltose binding protein),
respectively (21).
These and other studies have shown that bacterial cells expressing
metallothionein within the cytosol are less efficient in
accumulating
heavy metals from solutions than cells expressing
the metallothionein
within the periplasm or outer membrane (
4,
21,
26). In
the present study only the pMAL-p vector was used
to express the metal
binding gene as a fusion with the maltose
binding protein within the
periplasm. To determine the level of
expression and cellular
localization of the metal binding peptide
fusion,
E. coli
TB1 cells were transformed with either the pMAL-p-syn
plasmid
(containing the metal binding gene) or the parent pMAL-p
plasmid as a
control. Cells were grown to an optical density of
0.6 in Luria broth
(LB) containing ampicillin and induced with
2 mM IPTG
(isopropyl-
-
D-thiogalactopyranoside) for 1 h as
reported
previously (
21). Induced cells were harvested by
centrifugation
at 6,000 ×
g and separated into
cytoplasmic and periplasmic fractions
utilizing the cold osmotic
shock method of Neu and Heppel (
19)
as described previously
(
21). The maltose binding protein containing
the metal
binding peptide fusion and the maltose binding protein
lacking the
metal binding peptide fusion (from control cells)
were purified
from the cytoplasmic and periplasmic fractions by
using an amylose
resin affinity column under conditions recommended
by the manufacturer
(New England Biolabs) (
21). Protein content
within
each fraction was determined by using the Bradford method
(
2) with the Bio-Rad (Richmond, Calif.) protein assay kit.
Samples were subjected to sodium dodecyl sulfate-polyacrylamide
gel
electrophoresis (SDS-PAGE) by the method of Laemmli
(
13)
as described previously (
21). More
than 85% of the expressed
protein was found to be within the
periplasm. This is consistent
with results obtained from the
expression of metallothionein and
other proteins by using the pMAL-p
vector (
21).
-Galactosidase
activity was used as a marker
to ensure that no cytoplasmic proteins
had leaked into the
periplasm during fractionation (
21).
Figure
2 shows an SDS-PAGE gel of the
purified metal binding peptide fusion protein isolated from the
periplasmic fraction
of induced cells. The purified protein appears
as a 44-kDa band
which is similar in size to the purified protein
isolated from
cells lacking the metal binding peptide (expressing only
the maltose
binding protein). To confirm the presence of the metal
binding
peptide, the purified proteins were subjected to amino acid
composition
analysis (performed by Baylor College of Medicine Core
Protein
Sequencing Facility) (
21). Since the maltose binding
protein
does not contain any cysteine residues (
6), the
expression
of cysteine-containing peptides by using this fusion
provides
a convenient and direct method for determining the
authenticity
of the desired product. Amino acid analysis of the
purified maltose
binding protein containing the putative metal binding
peptide
revealed that the protein contained 1.8 mol% cysteine,
reflecting
the addition of nine cysteines, whereas the purified
maltose binding
protein lacking the metal binding peptide contained 0 mol% cysteine,
as expected. This is comparable to the 1.5-mol%
cysteine content
for the expressed metallothionein previously reported,
which contains
seven cysteine residues (
21).
View larger version (50K):
[in this window]
[in a new window]
|
FIG. 2.
SDS-PAGE of purified metal-binding peptide fusion. The
gel was stained with 0.1% Coomassie blue. Lane MW contains molecular
weight markers, in thousands; lanes 1 to 3 contain 0.5, 1, and 2 µg
of purified metal binding peptide, respectively.
|
|
Heavy metal removal.
The ability of cells expressing
the metal binding peptide fusion to remove heavy metals from
solutions was tested and compared to that of control bacteria lacking
the metal binding peptide (expressing only the maltose binding
protein). Induced bacterial cells (1 liter) were harvested by
centrifugation and resuspended in 10 ml of LB. Several aliquots of the
resuspended cells were placed in 1.5-ml centrifuge tubes and
centrifuged at high speed to pellet the cells for wet weight
estimation. Cells (100 mg [wet weight]) were resuspended in 30 ml of
LB and then 30 µl of 5 mM stock solution of Cd2+
(CdCl2), Hg2+ (HgCl2),
Pb2+ [Pb(NO3)2], or
Cu2+ (Cu2SO4) was added, yielding a
final concentration of 5 µM. Samples were incubated for 1 h at
37°C. Following incubation, samples were centrifuged to pellet
bacterial cells and the supernatant was analyzed for heavy metal
content by Accura Analytical (Norcross, Ga.). As shown in Table
1, cells expressing the metal binding peptide fusion efficiently remove Cd2+ and Hg2+
(1.1 and 1.3 nmol removed/mg of cells [wet weight]), whereas control
cells lacking the metal binding peptide remove less than 0.1 nmol/mg of
cells (wet weight). Removal of Pb2+ and Cu2+
was greater than in control cells, but the difference was not as great
as for Cd2+ and Hg2+ (Table 1).
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Heavy metal removal by cells expressing the metal binding
peptide and by control cells expressing only the maltose
binding protein
|
|
Although the level of heavy metal contamination is variable at
different sites, the most promising use for a bacterium-based
biosorbent may be the removal of very low levels of target metals
in
the presence of other metals. In this case, the bulk of the
heavy metal
is removed through a primary treatment, and a secondary,
or polishing,
application is added to further reduce the levels
of target metals in
the effluent (
3,
17). The ability of
cells expressing the
metal binding peptide to remove low levels
of heavy metal was tested by
using part-per-billion levels of
109Cd. A stock solution
was prepared by addition of 0.5 µCi of radioisotopic
109Cd (specific activity, 180 Ci/mol) to a 5-ml aliquot of
unlabeled
CdCl
2, yielding a final specific activity of 5 µCi/mol. Bacterial
cells (20 mg [wet weight]) were resuspended in 5 ml of LB and
incubated with 50 µl of the
109Cd stock
solution, yielding a final concentration of 0.2 µM (approximately
22 ppb). Samples were incubated for 1 h at 37°C and then
centrifuged
to pellet the bacterial cells. Radioactivity was measured
in both
the supernatant and pellets by using a Packard liquid
scintillation
counter as described previously (
21). Figure
3 shows the total
amount (in nanomoles)
of
109Cd which is cell bound or remains in the supernatant
after incubation.
Of the 1.0 nmol of
109Cd added, cells
expressing the metal binding peptide bound 0.92
nmol, whereas cells
lacking the metal binding peptide bound only
0.13 nmol. The effect of
coincubation with increasing concentrations
of unlabeled heavy metals
on the removal of
109Cd by cells was tested. In these
experiments 20 mg of cells was
coincubated in 5 ml of LB with 0.2 µM
109Cd and unlabeled Cd
2+, Hg
2+,
Pb
2+, or Cu
2+ at a concentration of 0.2, 1, or
5 µM. Figure
4 shows the effect
of
increasing concentrations of the unlabeled metals on the ability
of
cells to remove
109Cd from solutions. Cd
2+ and
Hg
2+ have the most inhibitory effect on
109Cd
removal, indicating that these metals have a high affinity
for the
peptide. Pb
2+ is also inhibitory at higher concentrations,
but Cu
2+ does not have any inhibitory effect, even at the
highest concentration
tested. The ability of cells expressing the metal
binding peptide
fusion to effectively and selectively remove
Cd
2+ and Hg
2+ from solutions with a low initial
(part-per-billion) concentration
(Fig.
3 and
4) along with the data
presented in Table
1 demonstrates
the potential for these cells to be
used at various metal-contaminated
sites.
View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
109Cd binding by cells expressing or lacking
the metal binding peptide. S, supernatant; P, pellet; + metal binding
peptide, cells expressing the metal binding peptide;  metal binding
peptide, control cells lacking the metal binding peptide.
|
|
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 4.
Effect of coincubation with cold metal on the binding of
109Cd by cells expressing the metal binding peptide. A
total of 100% cell bound is equal to 1.0 nmol of 109Cd,
which is the total amount added.
|
|
Our approach of using genetically engineered organisms for heavy metal
removal has focused on the expression of peptides with
high cysteine
content within the periplasmic space of bacterial
cells and the use
of such bacteria as an immobilized biomass.
The metal binding peptide
described in this study is similar in
size and cysteine content to the
previously expressed
N. crassa metallothionein
(
21), and it was designed for high affinity
to
Cd
2+ and Hg
2+ through the incorporation of
Cys-Gly and Cys-Cys-Gly motifs.
The potential benefits of a de
novo-constructed metal binding
peptide versus naturally occurring metal
binding proteins include
the ability to incorporate metal binding sites
for several metals
within one protein as well as the potential for
addition of amino
acid sequences for increased protein stability
(
11). To further
increase the biosorption of heavy metals by
E. coli, the expression
of tandem repeat copies of the
metallothionein and this peptide
is currently being studied. The
construction of genetically engineered
organisms for heavy metal
bioaccumulation has recently been reported
by other investigators. Chen
and Wilson (
4) reported the simultaneous
expression of a
metallothionein gene and a mercury transport system
in
E. coli. This study showed that expression of the metallothionein
in
the cytosol without coexpression of the transport system resulted
in
diminished bioaccumulation of Hg
2+ by the cells. These
results are consistent with our previous
work and other studies
indicating that maximal bioaccumulation
of metal occurs with expression
of metal binding proteins outside
the cytosol (
4,
21,
25,
29). In addition, expression
outside the cytosol may allow for
the use of nonviable cells for
metal accumulation and for efficient
desorption of the bound metal
(
3,
7,
20). Sousa et al.
reported the expression of yeast
and mammalian metallothioneins within
the outer membrane of
E. coli when LamB was used as an
anchoring domain (
29). The binding
of Hg
2+ and
Cd
2+ by cells expressing the metal binding peptide fusion
described
in the present study is comparable to those described by Chen
and Wilson (
4) and Sousa et al. (
28,
29). The
metal binding
studies described by these investigators, however, were
performed
under different conditions and at heavy metal concentrations
of
5 µM (
4) and 20 to 30 µM (
28,
29), whereas
our studies
were performed at concentrations of 0.2 to 5 µM.
The development of an immobilized biomass from bacterial cells has been
discussed as an approach for the development of heavy
metal removal
systems (
17) and involves the immobilization of
nonviable
cells or cell remnants containing the metal binding
peptide
within a suitable matrix. The ultimate utility of such
a system
will depend on binding capacity, affinity, selectivity,
stability, and
ease of production, among other factors. The current
expression system
in
E. coli provides several benefits for the
study of
metal binding peptides, including periplasmic localization,
enhanced stability of the expressed peptide, and lack of cysteine
in
the fusion, thus providing a convenient method for analysis
of
cysteine-containing peptides. However, alternate cost-effective
promoters (e.g., heat induced), increased levels of metallothionein
expression (
10), and potential for expression of metal
binding
peptides in other organisms need to be studied for further
development.
The expression and incorporation of amino acid sequences
which
are known to stabilize proteins against heat, pH, and salinity
may further increase the utility of such a system (
11).
| |
ACKNOWLEDGMENTS |
This work was supported by a grant from the Office of Naval
Research.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Center for
Bio/Molecular Science and Engineering, Naval Research Laboratory,
Washington, DC 20375. Phone: (202) 404-6073. Fax: (202) 767-9594. E-mail: mpp{at}cbmse.nrl.navy.mil.
| |
REFERENCES |
| 1.
|
Berka, T.,
A. Shatzman,
J. Zimmerman,
J. Strickler, and M. Rosenberg.
1988.
Efficient expression of the yeast metallothionein gene in Escherichia coli.
J. Bacteriol.
170:21-26[Abstract/Free Full Text].
|
| 2.
|
Bradford, M. M.
1976.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem.
72:248-254[Medline].
|
| 3.
|
Brower, J. B.,
R. L. Ryan, and M. Pazirandeh.
1997.
Comparison of ion-exchange resins and biosorbents for the removal of heavy metals from plating factory wastewater.
Environ. Sci. Technol.
31:2910-2914.
|
| 4.
|
Chen, S., and D. B. Wilson.
1997.
Construction and characterization of Escherichia coli genetically engineered for bioremediation of Hg2+-contaminated environments.
Appl. Environ. Microbiol.
63:2442-2445[Abstract].
|
| 5.
|
Dieckmann, G. R.,
D. K. McRorie,
D. L. Tierney,
L. M. Utschig,
C. P. Singer,
T. V. O'Halloran,
J. E. Penner-Hahn,
W. F. DeGrado, and V. L. Pecoraro.
1997.
De novo design of mercury-binding two- and three-helical bundles.
J. Am. Chem. Soc.
119:6195-6196.
|
| 6.
|
Duplay, P.,
H. Bedouelle,
A. Fowler,
I. Zabin,
W. Saurin, and M. Hofnung.
1984.
Sequences of the malE gene and of its product, the maltose-binding protein of Escherichia coli K12.
J. Biol. Chem.
259:10606-10613[Abstract/Free Full Text].
|
| 7.
|
Gadd, G. M.
1990.
Metal tolerance, p. 178-210.
In
C. Edwards (ed.), Microbiology of extreme environments. McGraw-Hill, New York, N.Y.
|
| 8.
|
Gadd, G. M., and C. White.
1993.
Microbial treatment of metal pollution a working biotechnology?
Trends Biochem. Technol.
11:353-359.
|
| 9.
|
Gregory, D. S.,
A. C. R. Martin,
J. C. Cheetham, and A. R. Rees.
1993.
The prediction and characterization of metal binding sites in proteins.
Protein Eng.
6:29-35[Abstract/Free Full Text].
|
| 10.
|
Hoffman, B. J.,
J. A. Broadwater,
P. Johnson,
B. G. Fox, and W. R. Kenealy.
1995.
Lactose fed-batch overexpression of recombinant metalloproteins in Escherichia coli BL21 (DE3): process control yielding high levels of metal-incorporated, soluble protein.
Protein Expr. Purif.
5:646-654.
|
| 11.
|
Jaenicke, R.
1991.
Protein stability and molecular adaptation to extreme conditions.
Eur. J. Biochem.
202:715-728[Medline].
|
| 12.
|
Klemba, M.,
K. H. Gardner,
S. Marino,
N. D. Clarke, and L. Regan.
1995.
Novel metal-binding proteins by design.
Nat. Struct. Biol.
2:368-373[Medline].
|
| 13.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
|
| 14.
|
Lu, Y., and J. S. Valentine.
1997.
Engineering metal-binding sites in proteins.
Curr. Opin. Struct. Biol.
7:495-500[Medline].
|
| 15.
|
Macaskie, L. E.
1990.
An immobilized cell bioprocess for the removal of heavy metals from aqueous flows.
J. Chem. Technol. Biotechnol.
49:357-379[Medline].
|
| 16.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1982.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 17.
|
Mattison, P. L.
1992.
Bioremediation of metalsputting it to work.
Cognis, Inc., Santa Rosa, Calif.
|
| 18.
|
Murooka, Y., and T. Nagaoka.
1987.
Expression of cloned monkey metallothionein in Escherichia coli.
Appl. Environ. Microbiol.
53:204-207[Abstract/Free Full Text].
|
| 19.
|
Neu, H. C., and L. A. Heppel.
1965.
The release of enzymes from Escherichia coli by osmotic shock and during the formation of spheroplasts.
J. Biol. Chem.
240:3685-3692[Free Full Text].
|
| 20.
|
Pazirandeh, M.
1996.
Development of a metallothionein based heavy metal biosorbent.
Biochem. Mol. Biol. Int.
39:789-795[Medline].
|
| 21.
|
Pazirandeh, M.,
L. A. Chrisey,
J. M. Mauro,
J. R. Campbell, and B. P. Gaber.
1995.
Expression of the Neurospora crassa metallothionein gene in Escherichia coli and its effect on heavy-metal uptake.
Appl. Microbiol. Biotechnol.
43:1112-1117[Medline].
|
| 22.
|
Pettit, L. D.,
J. E. Gregor, and H. Kozlowski.
1991.
Complex formation between metal ions and peptides.
Perspect. Bioinorg. Chem.
1:1-41.
|
| 23.
|
Regan, L.
1995.
Protein design: novel metal-binding sites.
Trends Biochem. Sci.
20:280-285[Medline].
|
| 24.
|
Rittle, K. A.,
J. L. Drever, and P. J. S. Colberg.
1995.
Precipitation of arsenic during bacterial sulfate reduction.
Geomicrobiol. J.
13:1-11.
|
| 25.
|
Romeyer, F. M.,
F. A. Jacobs,
L. Masson,
Z. Hanna, and R. Brousseau.
1988.
Bioaccumulation of heavy metals in Escherichia coli expressing an inducible synthetic human metallothionein gene.
J. Biotechnol.
8:207-220.
|
| 26.
|
Romeyer, F. M.,
F. A. Jacobs, and R. Brousseau.
1990.
Expression of a Neurospora crassa metallothionein and its variants in Escherichia coli.
Appl. Environ. Microbiol.
56:2748-2754[Abstract/Free Full Text].
|
| 27.
|
Shen, H., and Y.-T. Wang.
1993.
Characterization of enzymatic reduction of hexavalent chromium by Escherichia coli ATCC 33456.
Appl. Environ. Microbiol.
59:3771-3777[Abstract/Free Full Text].
|
| 28.
|
Sousa, C.,
A. Cebolla, and V. de Lorenzo.
1996.
Enhanced metalloadsorption of bacterial cells displaying poly-His peptides.
Nat. Biotechnol.
14:1017-1020[Medline].
|
| 29.
|
Sousa, C.,
P. Kotrba,
T. Ruml,
A. Cebolla, and V. De Lorenzo.
1998.
Metalloadsorption by Escherichia coli cells displaying yeast and mammalian metallothioneins anchored to the outer membrane protein LamB.
J. Bacteriol.
180:2280-2284[Abstract/Free Full Text].
|
| 30.
|
Totura, G.
1996.
Innovative uses of specialty ion exchange resins provide new cost-effective options for metals removal.
Environ. Prog.
15:208-212.
|
Applied and Environmental Microbiology, October 1998, p. 4068-4072, Vol. 64, No. 10
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Naz, N., Young, H. K., Ahmed, N., Gadd, G. M.
(2005). Cadmium Accumulation and DNA Homology with Metal Resistance Genes in Sulfate-Reducing Bacteria. Appl. Environ. Microbiol.
71: 4610-4618
[Abstract]
[Full Text]
-
Ueki, T., Sakamoto, Y., Yamaguchi, N., Michibata, H.
(2003). Bioaccumulation of Copper Ions by Escherichia coli Expressing Vanabin Genes from the Vanadium-Rich Ascidian Ascidia sydneiensis samea. Appl. Environ. Microbiol.
69: 6442-6446
[Abstract]
[Full Text]
-
Kjargaard, K., Schembri, M. A., Klemm, P.
(2001). Novel Zn2+-Chelating Peptides Selected from a Fimbria-Displayed Random Peptide Library. Appl. Environ. Microbiol.
67: 5467-5473
[Abstract]
[Full Text]
-
Samuelson, P., Wernérus, H., Svedberg, M., Ståhl, S.
(2000). Staphylococcal Surface Display of Metal-Binding Polyhistidyl Peptides. Appl. Environ. Microbiol.
66: 1243-1248
[Abstract]
[Full Text]
-
Kjærgaard, K., Sørensen, J. K., Schembri, M. A., Klemm, P.
(2000). Sequestration of Zinc Oxide by Fimbrial Designer Chelators. Appl. Environ. Microbiol.
66: 10-14
[Abstract]
[Full Text]
Top
Abstract
Text
