Previous Article | Next Article 
Applied and Environmental Microbiology, November 1998, p. 4433-4438, Vol. 64, No. 11
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Implications of rRNA Operon Copy Number and Ribosome Content in
the Marine Oligotrophic Ultramicrobacterium Sphingomonas
sp. Strain RB2256
Fitri
Fegatella,
Julianne
Lim,
Staffan
Kjelleberg, and
Ricardo
Cavicchioli*
School of Microbiology and Immunology, The
University of New South Wales, Sydney, 2052 New South Wales,
Australia
Received 2 July 1998/Accepted 31 August 1998
 |
ABSTRACT |
Sphingomonas sp. strain RB2256 is a representative of
the dominant class of ultramicrobacteria that are present in marine oligotrophic waters. In this study we examined the rRNA copy number and
ribosome content of RB2256 to identify factors that may be associated
with the relatively low rate of growth exhibited by the organism. It
was found that RB2256 contains a single copy of the rRNA operon, in
contrast to Vibrio spp., which contain more than eight
copies. The maximum number of ribosomes per cell was observed during
mid-log phase; however, this maximum content was low compared to those
of faster-growing, heterotrophic bacteria (approximately 8% of the
maximum ribosome content of Escherichia coli with a growth
rate of 1.5 h
1). The low number of ribosomes per cell
appears to correlate with the low rate of growth (0.16 to 0.18 h1) and the presence of a single copy of the rRNA operon.
However, on the basis of cell volume, RB2256 appears to have a higher
concentration of ribosomes than E. coli (approximately
double that of E. coli with a growth rate of 1.5 h1). Ribosome numbers reached maximum levels
during mid-log-phase growth but decreased rapidly to 10% of maximum
during late log phase through 7 days of starvation. The cells in late
log phase and at the onset of starvation displayed an immediate
response to a sudden addition of excess glucose (3 mM). This result
demonstrates that a ribosome content 10% of
maximum is sufficient to allow cells to immediately respond to nutrient
upshift and achieve maximum rates of growth. These data indicate
that the bulk of the ribosome pool is not required for protein
synthesis and that ribosomes are not the limiting factor contributing
to a low rate of growth. Our findings show that the regulation of
ribosome content, the number of ribosomes per cell, and growth rate
responses in RB2256 are fundamentally different from those
characteristics in fast-growing heterotrophs like E. coli
and that they may be characteristics typical of oligotrophic ultramicrobacteria.
| |
INTRODUCTION |
Sphingomonas sp. strain
RB2256 was isolated from Resurrection Bay, Alaska (5, 31).
When it was originally isolated, it was able to grow only in seawater
medium that contained less than 1 mg of dissolved organic carbon (DOC)
per liter (31). The growing cells were ultramicro (<0.1
µm3) in size and grew relatively slowly (µ = <0.2
h1). In contrast, significantly lower numbers (<1%)
of larger, faster-growing cells were able to be immediately cultured in
rich media and on plates. In this regard, RB2256 behaved like an
obligate oligotroph by growing like a K strategist (grows slowly by
using low concentrations of nutrients), while the faster-growing cells
behaved like eutrophs by growing like r strategists (which grow in
bursts and produce resting-stage cells) (reviewed in reference
35). Upon storage at 5°C, RB2256 cells developed
the ability to form colonies on plates and grew in rich media, a
procedure that was reproducible for related species from the North Sea
(31, 32). The term "facultatively oligotrophic" has been
used to describe the ability of an obligate oligotroph to grow on rich
media (34). By the definitions of Hirsch et al.
(16), RB2256 also fulfills the criteria for being a "model
oligotroph" by possessing high-affinity uptake systems, the ability
to simultaneously take up mixed substrates (33), and a
mechanism for avoiding predation, i.e., its ultramicro size (9,
13, 35).
Although the defining characteristics of an oligotroph are the subject
of debate (23, 34), we operationally define RB2256 as
an oligotrophic ultramicrobacterium due to the growth
properties it exhibited when it was isolated (e.g., it was
unable to grow in rich media) and the physiological (e.g., the ability
to grow in media containing <1 mg of DOC/liter) and morphological
(e.g., the retention of a constant ultramicro size of <1
µm3 irrespective of whether it is growing or starving)
characteristics that it possesses (9). These characteristics
differ in many ways from those of eutrophic marine bacteria, typified
by Vibrio spp. For example, Vibrio angustum S14
undergoes reductive cell division when it is grown in progressively
nutrient-limited media or starved (27) and is markedly less
stress resistant than RB2256 (18, 25, 28).
RB2256 cells have the ability to immediately reach maximum
rates of growth without a lag after the addition of excess glucose to
glucose-limited chemostat cultures or in acetate or alanine batch
cultures (9). The immediate response of RB2256 cells to
nutrient upshift suggests that the ribosome content is not limiting,
that the ribosome content is not down-regulated during slow growth,
and/or that the remaining ribosomal pool is sufficient for
immediately achieving maximum rates of growth.
A distinguishing feature of RB2256 is its constant rate of growth (0.13 to 0.16 h1), regardless of the glucose concentration (800 to 0.8 mg of DOC/liter) in the medium (9). Bacteria such as
V. angustum S14 with high rates of growth (2.2 doublings/h)
(27) are known to contain 8 to 11 copies of the rRNA
operon (39) and >35,000 ribosomes/cell (10). In contrast, the bioluminescent symbiont from the
Caribbean flashlight fish, Kryptophanaron alfredi, has a low
rate of growth (one doubling every 8 to 23 h) and a single copy of
the rRNA operon (39). The relatively low rate of
growth of RB2256 may also be correlated with its rRNA operon
copy number and ribosome content.
In order to discern the relationship between growth rate
characteristics of RB2256 and ribosome levels, in this study we
examined the rRNA operon copy numbers and ribosome contents of
cells growing throughout the growth phase and of cells during periods
of starvation of up to 7 days. The results of these experiments provide
important insights into the unique physiology of this oligotrophic ultramicrobacterium.
| |
MATERIALS AND METHODS |
Source of the isolate.
Sphingomonas sp. strain RB2256
was isolated from Resurrection Bay, Alaska, by an extinction dilution
method at a dilution of 106 (5, 31). Following
growth in filtered autoclaved seawater (ASW) and synthetic seawater
medium (MPM[31]) at 10°C, static cultures were stored in the dark
for 6 months at 5°C. After this procedure, colonies formed when the
strain was plated onto ZoBell and MPM solid medium. At the collection
site the bacterioplankton populations were 0.2 × 106
to 1.07 × 106 cells/ml, making RB2256 a numerically
important member of the population at the time of sampling.
Morphologically (31) and phylogenetically (14)
related species were also isolated as representatives of the dominant
population from the North Sea.
Microorganisms, media, and growth conditions.
Batch cultures
of RB2256 were grown at 30°C with rotary shaking (130 rpm) in two
types of artificial media: ASW and VNSS (9). With ASW, 3 mM
D-glucose was added as the carbon source. Growth was
monitored at 610 and 433 nm, and cell density was determined by the
drop plate method (10) with VNSS solid medium. Starvation experiments were performed by growing cells in ASW-glucose until glucose deprivation caused cessation of growth (this was defined as the
onset of starvation). The starved cultures were then incubated for up
to 7 days.
Other bacterial strains used in this study were Escherichia
coli JM101, Vibrio fischeri MJ1, and Vibrio
harveyi 179, which were obtained from the University of New South
Wales culture collection. Mycoplasma pneumoniae M12-B16 was
a gift from V. Vasinger, University of Sydney. E. coli batch
cultures were grown in Luria broth at 37°C, V. fischeri
and V. harveyi were grown in Luria broth with 2% NaCl at
room temperature, and M. pneumoniae was grown in
Leivbovitz-15 medium at 37°C.
Determination of rRNA operon copy number.
Genomic
DNAs from RB2256, E. coli, V. fischeri, V. harveyi, and M. pneumoniae were prepared by a
phenol-chloroform-isoamyl alcohol (25:24:1) extraction procedure
(38). The control strains were chosen due to the broad range
of numbers of rRNA operons known to be present in them. Prior
to PCR, genomic DNA was purified with a Prep-A-Gene DNA purification
kit (Bio-Rad). An approximately 500-ng sample of genomic DNA from
RB2256, E. coli, V. fischeri, V. harveyi, or M. pneumoniae was digested with a range of
restriction enzymes: NcoI, BclI,
AatII, EcoRV, and NaeI for RB2256;
NcoI and PvuII for E. coli;
NcoI and EcoRI for V. fischeri; NcoI
and PvuII for V. harveyi; and EcoRI
for M. pneumoniae. DNA fragments were separated in 0.7%
agarose gels in TAE buffer (0.4 M Tris-acetate, 1 mM EDTA [pH 8.0])
and transferred to a nylon membrane by capillary blotting. A PCR
digoxigenin (DIG)-labelled probe was constructed from RB2256 genomic
DNA with two universal 16S rRNA primers: R12 (ACGGCTACCTTGTTACGACT) and F1 (GAGTTTGATCCTGGCTCAG).
R12 and F1 correspond to positions 1492 to 1512 and 11 to 29 in
the E. coli 16S rRNA sequence, respectively. Southern
hybridization and detection of DIG probes were performed with a DIG
luminescence detection kit (Boehringer Mannheim) by following the
supplier's protocols.
Preparation of the ribosomal fraction.
Ribosomal fractions
were prepared as described in the work of Flardh et al.
(10). Cells were harvested, lysed, and fractionated by
differential centrifugation, and rRNA was quantified chemically by the
orcinol reaction procedure (see below). Chemicals and glassware used in
this experiment were treated with 0.1% diethyl pyrocarbonate. Cultures
(200 ml) of RB2256 were harvested at exponential phase, at the onset of
starvation, and after carbon starvation for a range of times up to 7 days. The cells were pelleted at 25°C by centrifugation at
10,000 × g (Sorvall GSA rotor) for 10 min and stored
at 
70°C. The pellets were thawed and resuspended in 1 ml of buffer
A (10 mM Tris-HCl [pH 7.5], 1 mM EDTA, 6 mM 2-
-mercaptoethanol, 1.25 mM dithiothreitol). Lysozyme (300 µg/ml) and 1 ml of buffer B
(10 mM Tris-HCl [pH 7.5], 20 mM magnesium acetate, 60 mM KCl, 6 mM
2--mercaptoethanol, 1.25 mM dithiothreitol) were added thereafter. The lysate was incubated on ice for 15 min, and 80 µl of 10% Triton X-100 was added. The lysate was kept on ice for another 15 min, followed by the addition of 6 ml of buffer C (10 mM Tris-HCl [pH 7.5], 10.5 mM magnesium acetate, 0.5 mM EDTA, 30 mM KCl, 6 mM 2--mercaptoethanol, 1.25 mM dithiothreitol) with 20 µl of DNase I
(10 U per ml; Boehringer Mannheim) and incubation at 37°C for 20 min.
After the cells were cooled on ice, cell debris was pelleted by
centrifugation at 7,000 × g (Sorvall SM24 rotor) at
4°C for 10 min. The supernatants were centrifuged twice at
30,000 × g (Sorvall SA600 rotor) at 4°C for 30 min.
The ribosomal particles in the resulting supernatant were pelleted by
centrifugation at 150,000 × g at 4°C for 1 h in
a Beckman ultracentrifuge (SW41 Ti rotor). The resulting crude
ribosomal pellets were resuspended in 600 µl of buffer C and stored
at 70°C.
Chemical determination of ribosome content.
Determination of
rRNA content was performed by the orcinol reaction procedure
(8), with Saccharomyces cerevisiae RNA
(Boehringer Mannheim; 0.1 mg/ml in 50 mM NaOH) as an RNA standard, as
described by Flardh et al. (10). Trichloroacetic acid (final
concentration, 10%) was added to thawed samples to precipitate
ribosomal particles. The resulting precipitates were pelleted in a
microcentrifuge at 12,000 rpm at 4°C for 20 min, and the pellets were
subsequently resuspended in 1 ml of 50 mM NaOH. All the samples were
kept on ice until they were used in the colorimetry assay. For the
colorimetry assay, reagent B was prepared by adding 5 ml of reagent A
[2.7% (wt/vol)
Fe(NH4)2(SO4)2 and 4%
(wt/vol) orcinol] to 85 ml of concentrated HCl and 10 ml of diethyl
pyrocarbonate-treated Milli-Q water. Three milliliters of reagent B was
added to 1 ml of sample in a test tube, and suspensions were vortexed
briefly. Each tube was covered with a marble and immediately placed in
boiling water for 20 min. Samples were allowed to cool to room
temperature, and the optical density at 670 nm (OD670) of
each sample was determined with a Beckman DU 640 spectrophotometer. The
amount of rRNA in each sample was calculated from a standard curve with
yeast RNA. The efficiency of lysis was determined as the percentage of
RNA that remained in the lysate after unlysed cells had been removed and was found to be essentially the same for all cells regardless of
growth or starvation phase. The amount of rRNA per cell (femtograms per
cell) was then calculated from the viable-cell count for each sample.
The number of ribosomes per cell was calculated by multiplying the
cellular amount (grams per cell) by Avogadro's number (6.02 × 1023 mol1) and dividing by the molecular
weight of a ribosome (1.539 × 106) (24).
Ribosome concentration per cell volume (ribosomes per cubic micrometer)
was calculated as the number of ribosomes per cell divided by the cell
volume (RB2256, 0.05 µm3; E. coli, 1.1 µm3).
Nutrient upshift experiments.
ASW-glucose is a defined
medium containing 3 mM glucose and enables cultures to reach
>109 cells/ml. VNSS medium is a complex medium also
containing 3 mM glucose. The half-saturation constant for glucose
uptake in RB2256 is 40 to 75 µM (33), and 3 mM glucose was
the concentration chosen for glucose excess (9). For upshift
experiments, RB2256 cultures were grown in ASW-glucose (3 mM) at
30°C, sampled at late log phase; at onset of starvation; and after 1, 2, 4, and 7 days of starvation and diluted 1:5 into fresh ASW-glucose
or VNSS medium. Nutrient-upshifted cultures were incubated at 30°C, and growth was monitored at 433 nm for the next 6 h. OD was
monitored every 10 min for the first 2 h to determine the initial
response, and every hour thereafter.
| |
RESULTS |
rRNA operon copy number.
In complex artificial
seawater basal medium (VNSS), RB2256 exhibits a growth rate of
0.13 to 0.16 h1 at 25°C over a 104-fold
range of medium richness (800 to 0.8 mg of DOC/liter) (9). This result indicates that while RB2256 is capable of growing as fast
under oligotrophic conditions (<1 mg of DOC/liter) as it does under
eutrophic conditions (800 mg of DOC/liter), its growth rate is
comparatively low compared to those of heterotrophic marine bacteria,
such as the well-studied V. angustum S14, which has a
growth rate of 2.2 h1 on VNSS (27). We
rationalized that the low maximum rate of growth of RB2256 may
correlate with a low number of copies of the rRNA operon.
rRNA operon copy number was determined by Southern
hybridization with a 16S ribosomal DNA probe hybridized to restriction
enzyme digests of genomic DNAs from RB2256 and control strains:
E. coli,
V. fischeri,
V. harveyi, and
M. pneumoniae (Fig.
1).
For all control strains, the number of bands present was
consistent
with the number of rRNA operons known to be
present in those organisms
(Table
1). For
example,
E. coli possesses seven rRNA operons
(
19) and six or seven bands were detected, and
M. pneumoniae possesses one to two rRNA operons
(
1) and two bands were detected.
The digests for
RB2256 showed one or two bands depending on the
restriction enzyme
used, suggesting that RB2256 has one or two
copies of the rRNA
operon.
View larger version (66K):
[in this window]
[in a new window]
|
FIG. 1.
rRNA operon copy numbers as determined by
Southern hybridization. Lambda phage DNA size markers (lanes A and N)
and genomic DNAs from E. coli (lanes B and C), V. fischeri (lanes D and E), V. harveyi (lanes F and G),
M. pneumoniae (lane H), and RB2256 (lanes I to M) were cut
with the restriction enzymes NcoI (lanes B, D, F, and M),
PvuII (lanes C and G), EcoRI (lane H),
BclI (lane J), AatII (lane K), EcoRV
(lane L), and NaeI (lane I). Molecular weight markers (in
thousands) are noted at the left.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Numbers of hybridizing bands and rRNA operon
contents for E. coli, V. fischeri, V. harveyi, M. pneumoniae, and RB2256
|
|
To determine the exact number of rRNA operons in RB2256,
we determined if each restriction enzyme used for the genomic DNA
digests also had a restriction site in the 16S rRNA gene sequence
(GenBank accession no.
Z73631 [
31,
35]). This analysis
confirmed that the restriction enzymes that gave two bands in
the blot
shown in Fig.
1 (
BclI,
AatII, and
NcoI) had recognition
sequences within the region PCR
amplified for probe synthesis
but that those that gave a single band in
the blot shown in Fig.
1 (
NaeI and
EcoRV) were
absent in the 16S rRNA sequence. From
these observations it is proposed
that the rRNA copy number of
RB2256 is
1.
Number of ribosomes per cell.
The presence of a single copy of
the rRNA operon correlates with the low maximum rate of growth
observed for RB2256; however, it was necessary to assess what effect
the low copy number had on the number of ribosomes per cell before a
clear relationship between growth rate and ribosome content could be
established. To examine the regulation of ribosome synthesis, we
determined the numbers of ribosomes per cell in cells growing from log
phase to 7 days of carbon starvation.
The number of ribosomes per cell increased during log growth, reaching
a maximum of 2,000 ribosomes per cell in mid-log phase
(Fig.
2). Between mid-log and late log to
stationary phase, the
ribosome content decreased rapidly until it
reached a minimal
level of about 200 ribosomes per cell. This level of
200 ribosomes
per cell remained constant from late log phase through 7 days
of starvation. These data showed that the number of ribosomes
per
cell was regulated throughout the growth phase and that once
ribosome
levels fell to 10% of maximum around late log phase and
the onset of
starvation, the level remained constant for at least
7 days of
starvation.
View larger version (23K):
[in this window]
[in a new window]
|
FIG. 2.
Ribosome contents for RB2256 cells throughout the growth
phase until 7 days of starvation. Viability ( ) was determined on
VNSS solid medium, and the numbers of ribosomes per cell ( ) were
calculated from the RNA contents by the orcinol method. The data are
the averages of results from five experiments. Maximum standard
deviations were 40%.
|
|
Response to excess glucose.
To examine what effect
the growth phase-dependent ribosome content and low constant
number of ribosomes during stationary phase had on the ability of cells
to respond to sudden nutrient excess, we challenged the cells with
excess glucose. The pattern of response of cells to glucose
upshift varied depending on whether ASW-glucose (Fig.
3A) or VNSS (Fig. 3B) was used. In
ASW-glucose the response curves for cells from late log phase, at onset
of starvation, and after 1 day of starvation were similar, whereas cells starved for 2 to 7 days exhibited reduced rates of growth during
the 6 h following the upshift. In contrast, in VNSS medium the
response curves for cells from late log phase to 7 days of starvation
were similar.
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 3.
Growth response of RB2256 following glucose upshift.
Cell growth (OD433) was measured for cells grown after
dilution to 1:5 in ASW-glucose (A) or VNSS (B) during late log phase
(); at the onset of starvation ( ); and after 1 day (), 2 days
( ), 4 days ( ), and 7 days ( ) of starvation. The experiment was
performed four times, and the values shown are representative of a
typical experiment.
|
|
To quantitatively assess immediate growth responses, growth
rates were calculated for the periods 0 to 2 h and 2 to
6 h following
the upshift in each of the media and relative rates
were calculated
from the maximum rates of growth for log-phase cultures
(Table
2). When cultures in late log
phase or at the onset of starvation
were subjected to excess glucose in
ASW-glucose, growth immediately
resumed at a rate comparable to
maximum rates (relative rate =
1 for the period 0 to 2 h)
(Table
2). Furthermore, both late-log-phase
cells and cells from the
onset of starvation maintained high rates
of growth over the first
6 h (relative rate = 0.9 to 1 for the
period 2 to 6 h).
After 24 h of starvation, the response of the
cells was almost as
rapid with initial (0 to 2 h) and prolonged
(2 to 6 h) rates
of growth near maximal (relative rate = 0.8 to
0.9). After
prolonged starvation (2 to 7 days), the ability of
cells to respond to
glucose upshift was diminished, with relative
rates of growth
decreasing from 0.4 to 0.5 at 2 days to 0.2 to
0.3 at 7 days of
starvation. Even though growth responses decreased
with increasing
periods of starvation, a lag before growth resumed
was not observed.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Relative rates of growth of RB2256 cells at late log
phase to 7 days of starvation following nutrient upshift into
ASW-glucose or VNSS
|
|
For the experiments with upshift into VNSS medium, relative rates of
growth for all periods examined showed an initial period
of slower
growth during the first 2 h (0.4 to 0.8), with maximum
rates of
growth being achieved thereafter (2 to 6 h). As for experiments
with ASW-glucose, lag phases were not observed for any of the
cultures
examined.
Final cell densities reached >1 × 10
9 cells/ml for
all cultures after 24 to 48 h, and when cells were inoculated
(1/100) into
fresh 3 mM glucose-ASW, typical growth curves and maximum
rates
of growth were observed (data not
shown).
| |
DISCUSSION |
rRNA operon copy number.
Bacteria known to possess low
numbers of rRNA copies are bacteria that are involved in symbiosis
or parasitism such as the marine bioluminescent symbiont from K. alfredi (39), mycoplasmas, and mycobacteria (1,
37). The low rates of growth of mycoplasmas (37) and
the K. alfredi symbiont (39) correlate with
their low rRNA operon copy numbers, and data presented here
support this relationship. Furthermore, the finding that RB2256, a
free-living bacterium, contains one rRNA operon is an important
step in understanding its physiology as it contrasts with eutrophic
marine bacteria, which generally contain 8 to 11 copies
(39).
Insight into whether all of the rRNA operons in an organism are
necessary for maintaining growth rates can be gained from
the
experiments of Condon et al. (
7) where they used strains
with one or two of the seven rRNA operons deleted. These
strains
could grow at near optimal rates of growth in rich media;
however,
when they were subjected to a nutrient upshift or temperature
increase, the time taken to adjust to the new environment
increased
with the number of rRNA operons removed
(
7). In contrast, increasing
the rRNA operon content
above levels normally found in
E. coli (with multicopy
plasmids) leads to an excess of ribosomes and
a metabolic drain on
cells, resulting in a decreased rate of growth
(
36). The
effect of increased rRNA operons was particularly
detrimental
at lower rates of growth. These data on rRNA operon
copy
numbers imply that multiple rRNA operons may provide advantages
for rapidly growing cells responding to environmental changes,
while
potentially being a burden to cells growing at low rates
of growth in
stable, oligotrophic
environments.
Ribosome numbers.
With E. coli, glucose-limited
chemostat-grown cells and batch-grown cells exhibit a lag phase when
responding to nutrient upshift, during which time the number of
ribosomes per cell increases to accommodate the growth rate demand
(15, 17). Even if the lag phase is minimal, several hours
pass before the growth rate reaches maximum levels (20). In
glucose-limited chemostat cultures or acetate or alanine batch cultures
RB2256 displays an immediate response to nutrient addition without
exhibiting a lag phase (9). This finding suggests that
RB2256 does not need to increase its capacity for growth by increasing
ribosome synthesis; otherwise, a lag phase would be expected. These
earlier studies suggested that RB2256 may maintain a constant level of
ribosome synthesis and may not be capable of altering cellular
ribosome levels by regulating synthesis. Our present study,
however, indicated that this is not the case, as the number of
ribosomes per cell is highly regulated throughout the growth phase
(Fig. 2). There is a sharp increase in ribosome content that reaches a
maximum in mid-log phase, followed by an equally sharp decrease
to basal levels around late-log phase and the onset of starvation.
To identify the number of ribosomes per cell that are required for the
immediate resumption of maximum rates of growth following
nutrient
upshift, we examined the growth rate responses of cells
in late log
phase to 7 days of starvation following the addition
of excess
glucose (Fig.
3; Table
2). When transferred into ASW-glucose,
cells
from late log phase and the onset of starvation exhibited
immediate
increases in rates of growth. This result indicates
that 10% of the
maximum ribosome content (200 ribosomes per cell)
is sufficient to
allow maximum rates of growth and that the number
of ribosomes per cell
is not directly linked to the ability to
respond to the sudden
availability of nutrients; in effect, the
protein synthesis capacity
appears to exceed the cellular requirement
for
growth.
When cells were transferred to ASW-glucose after 2 to 7 days of
starvation, growth rates did not immediately return to maximum
rates
even after 6 h. ASW-glucose medium is a defined minimal
medium that provides glucose as a carbon source, vitamins, and
minerals; however, for cell growth, all remaining components (e.g.,
amino acids and fatty acids) need to be synthesized by the
cell.
It is likely that during starvation, any stored reserves of
carbohydrates
and proteins are consumed. After carbon addition to
starved cells,
time is required to synthesize amino acids
necessary for protein
synthesis (
11). The stringent control
regulates protein synthesis
during amino acid deprivation by repressing
protein synthesis
until sufficient concentrations of amino acids
are available to
support growth (
6). It is possible
that the inability of starved
RB2256 cells to achieve maximum rates of
growth when they are
shifted into ASW-glucose is caused by a stringent
response. In
support of this possibility, when cells starved for up to
7 days
were transferred to complex medium (Table
2), maximum rates of
growth were achieved after a short period of slower growth (less
than 2 h). This result indicates that if available nutrients can
be imported rather than biosynthesized, the cells are poised to
immediately use the components and commence growth at maximum
rates.
In
V. angustum S14, the pattern of response to glucose
upshift in minimal versus rich medium (
11) is similar to
that of
RB2256, with the exception that a growth lag occurs when RB2256
cells are transferred into glucose minimal medium. In RB2256,
even
though growth rates were reduced after 1 day of starvation
(Table
2),
no lag phase was observed before the resumption of
growth, in
comparison to a 4- or 8-h lag for S14 cells starved
for 1 or 2 days,
respectively, which indicates that the stringent
control mechanisms in
RB2256 and S14 are
different.
In RB2256, the regulation of ribosome content during growth
and stationary phases is not the same as in other gram-negative
heterotrophs such as
E. coli,
Vibrio sp., and
Pseudomonas putida.
In
E. coli growing
at a rate of one doubling per h, the number
of ribosomes per cell is
13,500 during log phase (
4) and decreases
to 4,100 during
late log phase, 3,500 at the onset of starvation,
and 25 after 24 h of starvation (
26). In minimal marine medium,
V. angustum S14 grows at a generation time of 75 min (
10).
Following
glucose starvation, the number of ribosomes per cell
decreases
from 20,000 to 35,000 at the onset of starvation to 16,000 at
24 h and 8,000 at 4 days. A similar, if not more rapid, decrease
in ribosome content following starvation was observed for
Vibrio alginolyticus and
Vibrio furnissii (
21). In
P. putida the ribosome
content decreased to
approximately 50% within 2 h of starvation
but declined slowly
thereafter, reaching 22% after 30 days of
starvation
(
12). Clearly, RB2256 has adopted a different
strategy.
The ribosome content decreases from mid-log to late log
phase,
and by the time that starvation has occurred, the ribosome
content
has reached a steady-state level that is maintained until at
least
7 days of
starvation.
This different pattern in regulation may be reflected in the type of
environment (oligotrophic) in which RB2256 grows and
the physiology it
has therefore evolved. As RB2256 is capable
of growth under
oligotrophic conditions, in the marine environment
it rarely encounters
starvation conditions. In contrast, eutrophic
marine bacteria can
encounter long periods of starvation (
23).
During
starvation,
Vibrio spp. (S14 and ANT-300) undergo cell
miniaturization, with a concomitant decrease in the number of
ribosomes
(
10); however, the concentration of ribosomes in the
miniature cells may approximate those of newly starved cells.
RB2256 on
the other hand, retains a relatively constant cell volume
independently
of whether it is under growth or starvation conditions
(
30,
32). This is consistent with RB2256 maintaining constant
levels
of ribosomes throughout the 7 days of
starvation.
Ribosome concentration and growth-limiting factors.
The low
ribosome content in RB2256 correlates well with the presence of a
single copy of the rRNA operon and a low maximum rate of growth
(0.16 to 0.18 h1); however, on the basis of cell volume,
RB2256 has a concentration similar to that of a fast-growing E. coli strain (Table 3). During mid-log phase, at a growth rate of 0.18 h1, the cellular
concentration is 40,000 ribosomes per µm3, which is
similar to the concentration in E. coli at a growth rate (2.0 h1) more than 10 times the growth rate of
RB2256. Furthermore, when E. coli is growing at 0.6 h1 (greater than three times that of RB2256), it contains
6,200 ribosomes per µm3, a concentration of ribosomes
over fivefold less than that in RB2256.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Comparisons of growth rates, ribosome contents per cell,
and ribosome concentrations per cubic micrometer for RB2256,
E. coli, and R. prowazekii
|
|
A number of possibilities to explain these observations exist. The
ribosomes in RB2256 may possess a slower processivity than
those in
laboratory strains of
E. coli, similar to that found
in
natural isolates of
E. coli (
22). This slower
processivity
may be a characteristic not only of the ribosomes
themselves but
also of auxiliary proteins such as translation
initiation and
elongation factors, which in effect would reduce the
translational
capacity of the cell. RB2256 possesses high-efficiency
transport
systems (
33), which suggests that transport
systems do not have
a role in growth limitation, and clearly, even in
rich medium
RB2256 grows no faster than in a mineral salts solution
(
9).
An apparent excess of ribosomes in ultramicrobacteria (cell
volume = 0.09 µm
3) has also been observed in
the parasite
Rickettsia prowazekii (
29). The
rickettsiae have a generation time of about 10 h (µ
= 0.07 cell h
1) when growing in the cytoplasms of their
eucaryotic hosts. Their
low rate of growth correlates well with a
low number of ribosomes
(1,500 per cell); however, the
cellular concentration is 17,000
per µm
3 (Table
3) (
30). Similarities and differences between
R. prowazekii and RB2256 include the fact that they both grow
slowly, have small
genome sizes, and are ultramicrobacteria; however,
while RB2256
is naturally found under oligotrophic
conditions,
R. prowazekii is found in a
nutrient-rich cytoplasm. It is possible that slowly
growing
heterotrophs have evolved ribosomes with reduced efficiencies
in
comparison to those of heterotrophs adapted to a faster pace
of
existence. In general, parasites such as
Rickettsia,
Chlamydia spp.,
Borrelia spp., and mycoplasmas
all have small genomes and
are ultramicrobacteria, which leads to the
suggestion that the
smaller biomass of the individual bacterium
provides for a greater
number of progeny from a defined substrate pool
(
2,
3).
In the marine environment, RB2256 also has the
advantage of being
oligotrophic, thus enabling it to proliferate in
environments
that preclude competition from
eutrophs.
| |
ACKNOWLEDGMENTS |
We thank Mitsuru Eguchi and Jan Gottschal for valuable
discussions. Thanks also go to Matthias Dorsch for providing primers for PCR.
This work was supported by an Australian Research Council grant.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: School of
Microbiology and Immunology, The University of New South Wales, Sydney,
2052 NSW, Australia. Phone: (61) 2-9385 3516. Fax: (61) 2-9385 1591. E-mail: r.cavicchioli{at}unsw.edu.au.
| |
REFERENCES |
| 1.
|
Amikam, D.,
G. Glaser, and S. Razin.
1984.
Mycoplasmas (Mollicutes) have a low number of rRNA genes.
J. Bacteriol.
158:376-378[Abstract/Free Full Text].
|
| 2.
|
Andersson, S. G. E., and C. G. Kurland.
1995.
Genomic evolution drives the evolution of the translation system.
Biochem. Cell Biol.
73:775-787[Medline].
|
| 3.
|
Andersson, S. G. E.,
A. Zommorodipur,
H. H. Winkler, and C. G. Kurland.
1995.
Unusual organization of the rRNA genes in Rickettsia prowazekii.
J. Bacteriol.
177:4171-4175[Abstract/Free Full Text].
|
| 4.
|
Bremer, H., and P. P. Dennis.
1996.
Modulation of chemical composition and other parameters of the cell by growth rate, p. 1553-1569.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 2. ASM Press, Washington, D.C.
|
| 5.
|
Button, D. K.,
F. Schut,
P. Quang,
R. Martin, and B. R. Robertson.
1993.
Viability and isolation of marine bacteria by dilution culture: theory, procedures, and initial results.
Appl. Environ. Microbiol.
59:881-891[Abstract/Free Full Text].
|
| 6.
|
Cashel, M.,
D. R. Gentry,
V. J. Hernandez, and D. Vinella.
1996.
The stringent response, p. 1456-1496.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. ASM Press, Washington, D.C.
|
| 7.
|
Condon, C.,
D. Liveris,
C. Squires,
I. Schwartz, and C. L. Squires.
1995.
rRNA operon multiplicity in Escherichia coli and the physiological implications of rrn inactivation.
J. Bacteriol.
177:4152-4156[Abstract/Free Full Text].
|
| 8.
|
Cooper, T. G.
1977.
The tools of biochemistry.
John Wiley & Sons, New York, N.Y.
|
| 9.
|
Eguchi, M.,
T. Nishikawa,
K. MacDonald,
R. Cavicchioli,
J. C. Gottschal, and S. Kjelleberg.
1996.
Responses to stress and nutrient availability by the marine ultramicrobacterium Sphingomonas sp. strain RB2256.
Appl. Environ. Microbiol.
62:1287-1294[Abstract].
|
| 10.
|
Flardh, K.,
P. S. Cohen, and S. Kjelleberg.
1992.
Ribosomes exist in large excess over the apparent demand for protein synthesis during carbon starvation in marine Vibrio sp. strain CCUG 15956.
J. Bacteriol.
174:6780-6788[Abstract/Free Full Text].
|
| 11.
|
Flardh, K., and S. Kjelleberg.
1994.
Glucose upshift of carbon-starved marine Vibrio sp. strain S14 causes amino acid starvation and induction of the stringent response.
J. Bacteriol.
176:5897-5903[Abstract/Free Full Text].
|
| 12.
|
Givskov, M.,
L. Eberl,
S. Moller,
L. K. Poulsen, and S. Molin.
1994.
Responses to nutrient starvation in Pseudomonas putida KT 2442: analysis of general cross-protection, cell shape, and macromolecular content.
J. Bacteriol.
176:7-14[Abstract/Free Full Text].
|
| 13.
|
Gonzales, J. M.,
E. B. Sherr, and B. F. Sherr.
1993.
Differential feeding by marine flagellates on growing versus starving, and on motile versus nonmotile, bacterial prey.
Mar. Ecol. Prog. Ser.
102:257-267.
|
| 14.
| Gottschal, J. C. Unpublished data.
|
| 15.
|
Harvey, R. J.
1970.
Metabolic regulation in glucose-limited chemostat cultures of Escherichia coli.
J. Bacteriol.
104:698-706[Abstract/Free Full Text].
|
| 16.
|
Hirsch, P.,
M. Bernhard,
S. S. Cohen,
J. C. Ensign,
H. W. Jannasch,
A. L. Koch,
K. C. Marshall,
J. S. Poindexter,
S. C. Rittenberg,
D. C. Smith, and H. Veldkamp.
1979.
Life under conditions of low nutrient concentrations, p. 357-372.
In
M. Shilo (ed.), Strategies of microbial life in extreme environments. Verlag Chemie, Weinheim, Germany.
|
| 17.
|
Jacobson, A., and D. Gillespie.
1968.
Metabolic events occurring during recovery from prolonged glucose starvation in Escherichia coli.
J. Bacteriol.
95:1030-1039[Abstract/Free Full Text].
|
| 18.
|
Jouper-Jaan, A.,
A. E. Goodman, and S. Kjelleberg.
1992.
Bacteria starved for prolonged periods develop increased protection against lethal temperatures.
FEMS Microbiol. Rev.
101:229-236.
|
| 19.
|
Kiss, A.,
B. Sain, and P. Ventianer.
1977.
The number of rRNA genes in Escherichia coli.
FEBS Lett.
79:77-79[Medline].
|
| 20.
|
Koch, A. L.
1979.
Microbial growth in low concentrations of nutrients, p. 261-279.
In
M. Shilo (ed.), Strategies of microbial life in extreme environments. Verlag Chemie, Weinheim, Germany.
|
| 21.
|
Kramer, J. G., and F. L. Singleton.
1992.
Variations in rRNA content of marine Vibrio spp. during starvation-survival and recovery.
Appl. Environ. Microbiol.
58:201-207[Abstract/Free Full Text].
|
| 22.
|
Mikkola, R., and C. G. Kurland.
1991.
Is there a unique ribosome phenotype for naturally occurring Escherichia coli?
Biochimie
73:1061-1066[Medline].
|
| 23.
|
Morita, R. Y.
1997.
Bacteria in oligotrophic environments: starvation-survival lifestyle.
Chapman & Hall, New York, N.Y.
|
| 24.
|
Neidhardt, F. C.,
J. L. Ingraham, and M. Schaechter.
1990.
Physiology of the bacterial cell: a molecular approach.
Sinauer Associates, Inc., Sunderland, Mass.
|
| 25.
|
Nelson, D. R.,
Y. Sadlowski,
M. Eguchi, and S. Kjelleberg.
1997.
The starvation-stress response of Vibrio (Listonella) anguillarum.
Microbiology
143:2305-2312.
|
| 26.
|
Nillson, M.,
L. Bulow, and K. Wahlund.
1997.
Use of flow field-flow fractination for the rapid quantitation of ribosome and ribosomal subunits in Escherichia coli at different protein production conditions.
Biotechnol. Bioeng.
54:461-467.
|
| 27.
|
Nystrom, T., and S. Kjelleberg.
1989.
Role of protein synthesis in the cell division and starvation induced resistance to autolysis of a marine Vibrio during the initial phase of starvation.
J. Gen. Microbiol.
135:1599-1606.
|
| 28.
|
Nystrom, T.,
R. M. Olsson, and S. Kjelleberg.
1992.
Survival, stress resistance, and alterations in protein expression in the marine Vibrio sp. strain S14 during starvation for different individual nutrients.
Appl. Environ. Microbiol.
58:55-65[Abstract/Free Full Text].
|
| 29.
|
Pang, H., and W. W. Winkler.
1994.
The concentrations of stable RNA and ribosomes in Rickettsia prowazekii.
Mol. Microbiol.
12:115-120[Medline].
|
| 30.
|
Schut, F.
1993.
Ph.D. thesis.
University of Groningen, Groningen, The Netherlands.
|
| 31.
|
Schut, F.,
E. J. de Vries,
J. C. Gottschal,
B. R. Robertson,
W. Harder,
R. A. Prins, and D. K. Button.
1993.
Isolation of typical marine bacteria by dilution culture: growth, maintenance, and characteristics of isolates under laboratory conditions.
Appl. Environ. Microbiol.
59:2150-2160[Abstract/Free Full Text].
|
| 32.
|
Schut, F.,
J. C. Gottschal, and R. A. Prins.
1997.
Isolation and characterisation of the marine ultramicrobacterium Sphingomonas sp. strain RB2256.
FEMS Microbiol. Rev.
20:363-369.
|
| 33.
|
Schut, F.,
M. Jansen,
T. M. Pedro Gomes,
J. C. Gottschal,
W. Harder, and R. A. Prins.
1995.
Substrate uptake and utilization by a marine ultramicrobacterium.
Microbiology
141:351-361[Abstract/Free Full Text].
|
| 34.
|
Schut, F.,
R. A. Prins, and J. C. Gottschal.
1997.
Oligotrophy and pelagic marine bacteria: facts and fiction.
Aquat. Microb. Ecol.
12:177-202.
|
| 35.
|
Simek, K., and H. Chrzanowski.
1992.
Direct and indirect evidence of size-selective grazing on pelagic bacteria by freshwater nanoflagellates.
Appl. Environ. Microbiol.
58:3715-3720[Abstract/Free Full Text].
|
| 36.
|
Stevenson, B. S., and T. M. Schmidt.
1998.
Growth rate-dependent accumulation of RNA from plasmid-borne rRNA operons in Escherichia coli.
J. Bacteriol.
180:1970-1972[Abstract/Free Full Text].
|
| 37.
|
Suzuki, Y.,
T. Mori,
Y. Miyata, and T. Yamada.
1987.
The number of ribosomal RNA genes in Mycobacterium lepraemurium.
FEMS Microbiol. Lett.
44:73-76.
|
| 38.
|
Wilson, K.
1994.
Preparation of genomic DNA from bacteria, p. 2.4.1-2.4.5.
In
F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology, vol. 1. John Wiley and Sons, Inc., New York, N.Y.
|
| 39.
|
Wolfe, C. J., and M. G. Haygood.
1993.
Bioluminescent symbionts of the Caribbean flashlight fish (Kryptophanaron alfredi) have a single rRNA operon.
Mol. Mar. Biol. Biotechnol.
2:189-197[Medline].
|
Applied and Environmental Microbiology, November 1998, p. 4433-4438, Vol. 64, No. 11
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ting, L., Cowley, M. J., Hoon, S. L., Guilhaus, M., Raftery, M. J., Cavicchioli, R.
(2009). Normalization and Statistical Analysis of Quantitative Proteomics Data Generated by Metabolic Labeling. Mol. Cell. Proteomics
8: 2227-2242
[Abstract]
[Full Text]
-
Lauro, F. M., McDougald, D., Thomas, T., Williams, T. J., Egan, S., Rice, S., DeMaere, M. Z., Ting, L., Ertan, H., Johnson, J., Ferriera, S., Lapidus, A., Anderson, I., Kyrpides, N., Munk, A. C., Detter, C., Han, C. S., Brown, M. V., Robb, F. T., Kjelleberg, S., Cavicchioli, R.
(2009). From the Cover: Feature Article: The genomic basis of trophic strategy in marine bacteria. Proc. Natl. Acad. Sci. USA
106: 15527-15533
[Abstract]
[Full Text]
-
Miyatake, T., MacGregor, B. J., Boschker, H. T. S.
(2009). Linking Microbial Community Function to Phylogeny of Sulfate-Reducing Deltaproteobacteria in Marine Sediments by Combining Stable Isotope Probing with Magnetic-Bead Capture Hybridization of 16S rRNA. Appl. Environ. Microbiol.
75: 4927-4935
[Abstract]
[Full Text]
-
Hamasaki, K., Taniguchi, A., Tada, Y., Long, R. A., Azam, F.
(2007). Actively Growing Bacteria in the Inland Sea of Japan, Identified by Combined Bromodeoxyuridine Immunocapture and Denaturing Gradient Gel Electrophoresis. Appl. Environ. Microbiol.
73: 2787-2798
[Abstract]
[Full Text]
-
Dethlefsen, L., Schmidt, T. M.
(2007). Performance of the Translational Apparatus Varies with the Ecological Strategies of Bacteria. J. Bacteriol.
189: 3237-3245
[Abstract]
[Full Text]
-
MacGregor, B. J., Boschker, H. T. S., Amann, R.
(2006). Comparison of rRNA and Polar-Lipid-Derived Fatty Acid Biomarkers for Assessment of 13C-Substrate Incorporation by Microorganisms in Marine Sediments. Appl. Environ. Microbiol.
72: 5246-5253
[Abstract]
[Full Text]
-
Eichler, S., Christen, R., Holtje, C., Westphal, P., Botel, J., Brettar, I., Mehling, A., Hofle, M. G.
(2006). Composition and Dynamics of Bacterial Communities of a Drinking Water Supply System as Assessed by RNA- and DNA-Based 16S rRNA Gene Fingerprinting.. Appl. Environ. Microbiol.
72: 1858-1872
[Abstract]
[Full Text]
-
Pernthaler, J., Amann, R.
(2005). Fate of Heterotrophic Microbes in Pelagic Habitats: Focus on Populations. Microbiol. Mol. Biol. Rev.
69: 440-461
[Abstract]
[Full Text]
-
Karlyshev, A. V., Wren, B. W.
(2005). Development and Application of an Insertional System for Gene Delivery and Expression in Campylobacter jejuni. Appl. Environ. Microbiol.
71: 4004-4013
[Abstract]
[Full Text]
-
Stevenson, B. S., Schmidt, T. M.
(2004). Life History Implications of rRNA Gene Copy Number in Escherichia coli. Appl. Environ. Microbiol.
70: 6670-6677
[Abstract]
[Full Text]
-
Labrenz, M., Brettar, I., Christen, R., Flavier, S., Botel, J., Hofle, M. G.
(2004). Development and Application of a Real-Time PCR Approach for Quantification of Uncultured Bacteria in the Central Baltic Sea. Appl. Environ. Microbiol.
70: 4971-4979
[Abstract]
[Full Text]
-
Leys, N. M. E. J., Ryngaert, A., Bastiaens, L., Verstraete, W., Top, E. M., Springael, D.
(2004). Occurrence and Phylogenetic Diversity of Sphingomonas Strains in Soils Contaminated with Polycyclic Aromatic Hydrocarbons. Appl. Environ. Microbiol.
70: 1944-1955
[Abstract]
[Full Text]
-
Cho, J.-C., Giovannoni, S. J.
(2004). Cultivation and Growth Characteristics of a Diverse Group of Oligotrophic Marine Gammaproteobacteria. Appl. Environ. Microbiol.
70: 432-440
[Abstract]
[Full Text]
-
Stach, J. E. M., Maldonado, L. A., Masson, D. G., Ward, A. C., Goodfellow, M., Bull, A. T.
(2003). Statistical Approaches for Estimating Actinobacterial Diversity in Marine Sediments. Appl. Environ. Microbiol.
69: 6189-6200
[Abstract]
[Full Text]
-
Martinez, J. S., Carter-Franklin, J. N., Mann, E. L., Martin, J. D., Haygood, M. G., Butler, A.
(2003). Bioinorganic Chemistry Special Feature: Structure and membrane affinity of a suite of amphiphilic siderophores produced by a marine bacterium. Proc. Natl. Acad. Sci. USA
100: 3754-3759
[Abstract]
[Full Text]
-
Pinhassi, J., Berman, T.
(2003). Differential Growth Response of Colony-Forming {alpha}- and {gamma}-Proteobacteria in Dilution Culture and Nutrient Addition Experiments from Lake Kinneret (Israel), the Eastern Mediterranean Sea, and the Gulf of Eilat. Appl. Environ. Microbiol.
69: 199-211
[Abstract]
[Full Text]
-
Moreno, C., Romero, J., Espejo, R. T.
(2002). Polymorphism in repeated 16S rRNA genes is a common property of type strains and environmental isolates of the genus Vibrio. Microbiology
148: 1233-1239
[Abstract]
[Full Text]
-
Tiirola, M. A., Mannisto, M. K., Puhakka, J. A., Kulomaa, M. S.
(2002). Isolation and Characterization of Novosphingobium sp. Strain MT1, a Dominant Polychlorophenol-Degrading Strain in a Groundwater Bioremediation System. Appl. Environ. Microbiol.
68: 173-180
[Abstract]
[Full Text]
-
Eguchi, M., Ostrowski, M., Fegatella, F., Bowman, J., Nichols, D., Nishino, T., Cavicchioli, R.
(2001). Sphingomonas alaskensis Strain AFO1, an Abundant Oligotrophic Ultramicrobacterium from the North Pacific. Appl. Environ. Microbiol.
67: 4945-4954
[Abstract]
[Full Text]
-
MacGregor, B. J., Moser, D. P., Baker, B. J., Alm, E. W., Maurer, M., Nealson, K. H., Stahl, D. A.
(2001). Seasonal and Spatial Variability in Lake Michigan Sediment Small-Subunit rRNA Concentrations. Appl. Environ. Microbiol.
67: 3908-3922
[Abstract]
[Full Text]
-
Pernthaler, A., Pernthaler, J., Eilers, H., Amann, R.
(2001). Growth Patterns of Two Marine Isolates: Adaptations to Substrate Patchiness?. Appl. Environ. Microbiol.
67: 4077-4083
[Abstract]
[Full Text]
-
Ostrowski, M., Cavicchioli, R., Blaauw, M., Gottschal, J. C.
(2001). Specific Growth Rate Plays a Critical Role in Hydrogen Peroxide Resistance of the Marine Oligotrophic Ultramicrobacterium Sphingomonas alaskensis Strain RB2256. Appl. Environ. Microbiol.
67: 1292-1299
[Abstract]
[Full Text]
-
Fuchs, B. M., Glöckner, F. O., Wulf, J., Amann, R.
(2000). Unlabeled Helper Oligonucleotides Increase the In Situ Accessibility to 16S rRNA of Fluorescently Labeled Oligonucleotide Probes. Appl. Environ. Microbiol.
66: 3603-3607
[Abstract]
[Full Text]
-
Fegatella, F., Cavicchioli, R.
(2000). Physiological Responses to Starvation in the Marine Oligotrophic Ultramicrobacterium Sphingomonas sp. Strain RB2256. Appl. Environ. Microbiol.
66: 2037-2044
[Abstract]
[Full Text]
-
Klappenbach, J. A., Dunbar, J. M., Schmidt, T. M.
(2000). rRNA Operon Copy Number Reflects Ecological Strategies of Bacteria. Appl. Environ. Microbiol.
66: 1328-1333
[Abstract]
[Full Text]
Top
Abstract
Introduction
