Previous Article | Next Article 
Applied and Environmental Microbiology, November 1998, p. 4477-4481, Vol. 64, No. 11
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Sequence Polymorphism in the 
-Tubulin Gene Reveals
Heterogeneous and Variable Population Structures in
Cryptosporidium parvum
Giovanni
Widmer,1,*
Laurie
Tchack,1
Cynthia L.
Chappell,2 and
Saul
Tzipori1,3
Division of Infectious Diseases, Tufts University School of
Veterinary Medicine, North Grafton, Massachusetts
015361;
Division of Geographic Medicine,
New England Medical Center, Boston, Massachusetts
021113; and
University of Texas School
of Public Health, Houston, Texas 772252
Received 24 June 1998/Accepted 5 August 1998
 |
ABSTRACT |
Restriction fragment length polymorphism (RFLP) analysis of
isolates of Cryptosporidium parvum has revealed two
subgroups, termed H and C. The limited resolution of the RFLP method
precludes an in-depth study of the genetic structure of C. parvum populations. Published C. parvum restriction
polymorphisms lie within protein-coding regions known to be
more homogeneous than noncoding sequences. To better assess the degrees
of heterogeneity between and within C. parvum isolates,
sequence polymorphism in the 
-tubulin intron, the only C. parvum intron described to date, was investigated. In contrast to
the two genotypes distinguished by multilocus RFLP, several alleles
were detected by sequence and RFLP analysis of the -tubulin intron
and adjacent exon 2. Isolates carrying different -tubulin alleles
were found. Significantly, one of the -tubulin alleles
present in two geographically unrelated isolates combined features of
C- and H-type isolates, suggesting that it might have arisen from a
recombination event. A comparison of multiple samples of a
calf-propagated laboratory isolate showed that the ratio of different
-tubulin alleles fluctuated during serial passage.
| |
INTRODUCTION |
Cryptosporidium parvum is
an enteric protozoan parasite of clinical and veterinary importance
(7, 12). Phenotypic and genotypic characterizations of
isolates obtained from human and animal hosts have demonstrated the
occurrence of two subgroups (2, 3, 5, 6, 9, 10, 11, 14, 15).
Restriction fragment length polymorphism (RFLP) analysis has been
applied in several laboratories to characterize different isolates and assess the occurrence of C. parvum genotypes in human and
animal hosts (1, 3, 6, 11, 15). These studies identified a
group of isolates with identical RFLP genotypes which are found in
humans only (termed H) and a second group which infects both humans and
calves (termed C) (15). This finding has led some investigators to propose the existence of two transmission cycles, one
exclusively anthroponotic and the other involving both human and animal
hosts (2, 11).
In order to overcome the limited resolution achieved with RFLP,
sequence polymorphism in the 84-bp intron within the -tubulin gene (4) was investigated. The choice of this sequence was based on previous observations of extensive sequence
polymorphism within another C. parvum intergenic region, the
ribosomal internal transcribed spacer 1 (5, 8). The
advantage of the -tubulin intron over internal transcribed spacer 1 is that the -tubulin gene is presumed to be single copy (4, 7a,
10a), whereas multiple and heterogenous copies of the ribosomal
transcription unit are dispersed in the genome of C. parvum
(8). This unusual feature of the rRNA loci makes them less
suitable for genetic fingerprinting because of the difficulty in
distinguishing between intragenomic heterogeneity and genotypically
mixed samples.
Here we report on the identification of several -tubulin alleles in
C. parvum and on the correlation of this polymorphism with
previously described RFLP and PCR markers. In contrast to previously
published genetic markers in C. parvum, RFLP analysis of the
-tubulin locus identified several alleles within both RFLP subgroups.
| |
MATERIALS AND METHODS |
C. parvum isolates.
The host origin given for
each isolate identifies the host from which the oocysts were recovered.
Human isolates passaged through calves are listed under bovine
isolates. This group includes isolates GCH1, CISD, Peru1, and Peru2.
Isolates recovered directly from humans or primates are listed under
the corresponding subheading.
(i) Human.
Isolates 2066K, 0541L, 0676I, and 0583K
(15) were obtained from human immunodeficiency
virus-positive individuals enrolled in a phase II/III study of
nitazoxanide for cryptosporidiosis conducted by the National Institute
of Allergy and Infectious Diseases AIDS Clinical Trials Group (ACTG
336). Isolate F16 was from the United Kingdom. OH was obtained from an
immunocompetent individual from Ohio.
(ii) Bovine.
Isolate GCH1 originated from an AIDS patient
and was maintained in calves at Tufts University School of Veterinary
Medicine for over 6 years (13). Isolate Peru originated from
a Peruvian patient and was passaged through calves at the University of
Arizona. Peru1 and Peru2 designate two subsequent passages. Isolate UCP is believed to be of bovine origin and has been maintained in calves
for over 8 years at ImmuCell Corp., Portland, Maine. Isolate CISD was
originally isolated from a human immunodeficiency virus-negative patient and passaged through a calf. ICP is a bovine isolate from Idaho. TAMU was originally isolated from a foal, accidentally transmitted to a human, and thereafter maintained in calves.
(iii) Primate.
PC1 originated directly from a captive
macaque at the New England Regional Primate Center, Southboro, Mass.
Oocyst purification and DNA extraction.
Oocysts were
purified from C. parvum-positive stool by using a salt
flotation step followed by centrifugation on a Nycodenz (Sigma) step
gradient. Briefly, stool from which coarse debris had been removed by
filtration through gauze or low-speed centrifugation (500 × g) was mixed with 2 volumes of saturated NaCl solution and
centrifuged at 1,000 × g for 15 min. Oocysts were
recovered from the supernatant diluted with 3 parts of water by
centrifugation at 4,000 × g for 15 min. Oocysts were
resuspended in a small volume of water and further purified by
sedimentation at 100,000 × g on a 15%-30% (wt/vol)
Nycodenz step gradient in phosphate-buffered saline for 1 h. DNA
for genetic analysis was extracted from purified oocysts or,
alternatively, directly from stool following an overnight incubation in
0.2% sodium dodecyl sulfate-200 µg of proteinase K per ml in water
at 45°C as described previously (5).
PCR amplification and RFLP and sequence analyses of the
-tubulin gene.
A 538-bp fragment of the C. parvum
-tubulin gene (GenBank accession no. Y12615) spanning an 81- to 87-bp intron was amplified with sense primer btub5
(5'GATTGGTGCTAAATTCTGGG3'), located at positions 165 to 184, and antisense primer btub2
(5'GTCTGCAAAATACGATCTGG3'), at positions 708 to 689 (numbering according to GenBank accession no. Y12615). In some
experiments btub4 (5'CCTGATCCTGTACCACCTCC3'; positions 648 to 629) was used instead of btub2. The GenBank sequence under accession
no. Y12615 contains a 6-bp (ACTGGT) duplication at the 5'
end of exon 2, which was not seen in any of the samples sequenced here
and was assumed to be an artifact. This resulted in a 6-bp discrepancy
between size estimates derived from the GenBank entry and our
sequences. Amplifications were performed with Taq DNA
polymerase and 35 cycles of 94°C for 50 s, 52°C for 1 min, and
72°C for 50 s, with a 5-min extension at 72°C. For RFLP
analysis, PCR products were digested with restriction enzyme Tsp509I (New England Biolabs, Beverly, Mass.) in PCR buffer
(10 mM Tris-HCl [pH 9], 50 mM KCl, 0.1% Triton X-100, 2 mM
MgCl2) for 30 to 60 min at 65°C.
PCR products were cloned in the pCRII vector (Invitrogen, Carlsbad,
Calif.). Recombinant plasmids were purified from color-selected transformed Escherichia coli colonies and sequenced at the
Tufts University School of Medicine core facility. The following
plasmids were sequenced on both strands: icp-1, tamu-2, tamu-5,
0541L-5, 0541L-6, 0541L-8, 2066K-5, and 0583K-8. The remaining clones
were sequenced on one strand.
| |
RESULTS |
RFLP analysis.
RFLP analysis was performed on a 478-bp PCR
fragment of the -tubulin gene defined by primers btub5 and btub4
(Fig. 1A). This amplicon includes the 3'
portion of exon 1, the intron, and the 5' portion of exon 2. For
RFLP analysis, the enzyme Tsp509I (/AATT) was used
because of the high frequency with which this enzyme was expected to
cut the AT-rich sequences typically found in C. parvum.
Seven Tsp509I sites were present within this region, three of which were polymorphic (Fig. 1A). Two of these restriction polymorphisms, located at positions 399 and 613 within exon 2, segregated, with some exceptions, with the H and C genotypes. The
allele with an intact Tsp509I site at position 399 (defined as Tsp509I+) was present in all subgroup H isolates.
However, the reverse was not consistently found, as seen in isolate
0676I, which was classified as type C according to previous RFLP typing
(15) yet was Tsp509I+. On the other hand, the
-tubulin allele which lacks the Tsp509I site at position
399 (Tsp509I
) was found in a subset of human isolates and
in all bovine isolates. These are isolates which were classified as
genotype C (15). Most samples could unambiguously be
classified as Tsp509I+ or Tsp509I because of
the presence or absence of a diagnostic 99-bp restriction fragment.
However, a number of isolates displayed mixed profiles, suggesting that
both Tsp509I+ and Tsp509I alleles were
present in subgroups C and H (not shown).
View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Restriction maps of four -tubulin alleles of
C. parvum. The fragment sizes are indicated for each
allele. The approximate locations of the Tsp509I sites
(vertical lines), the intron (black box), and the T repeat (hatched
box) were derived from multiple, aligned sequences. The PCR fragment is
478 bp long in GCH1. The codes for the isolates from which these
sequences were amplified are shown at the left. Arrows show the
approximate locations of the PCR primers used in this study. btub2 is
located 60 bp downstream of btub4 and, together with primer btub5,
amplifies a 538-bp fragment. The location of the restriction site
defining the Tsp509I+ and Tsp509I alleles is
marked (*). The dashed line indicates the approximate range of the
sequence included in the alignment shown in Fig. 2. (B)
Tsp509I restriction profiles of isolates shown in panel A. GCH1 lanes  and + designate unrestricted and restricted
btub5-btub4 PCR products, respectively. The arrow indicates the 99-bp
fragment mentioned in the text. Lane M, 100-bp DNA ladder. The sizes
(in base pairs) of three bands are shown at the right.
|
|
The seven
Tsp509I sites found within the
-tubulin
PCR fragment occurred in different combinations in human
isolates, which
gave rise to different restriction profiles (Fig.
1B).
Contributing
to the heterogeneity among profiles was the T repeat of
variable
length located within a 38- to 52-bp restriction
fragment (Fig.
1A). The presence of the
Tsp509I
site at position 399 in exon
2 resulted in a 99-bp restriction
fragment, typical of genotype
H.
Sequence analysis.
Sequence analysis of the intron and
adjacent exon 2 was performed to obtain a more detailed view of
heterogeneity at this locus. PCR products amplified from
C. parvum DNA originating from human and animal
infections were cloned, and multiple, randomly picked recombinant
plasmids were sequenced. The alignment of 42 -tubulin
sequences ranging from 281 to 287 bp in length confirmed the
expected high level of sequence polymorphism within the intron. Sixteen
of 87 intron positions (18%) were polymorphic. In contrast, 11 of 200 positions (6%) within exon 2 were polymorphic (Fig. 2). The existence of an intron within
this amplicon was confirmed by reverse transcription-PCR amplification
of oocyst RNA (not shown).
View larger version (67K):
[in this window]
[in a new window]
|
FIG. 2.
Sequence alignment of -tubulin sequences from 14 C. parvum isolates. The alignment was generated with
the PileUp program (Wisconsin Sequence Analysis Package). Isolate codes
are shown on the left. The number following the hyphen designates the
plasmid number. The multilocus RFLP genotype (15) is
indicated leftmost. Only the polymorphic positions are shown. Changes
from the sequence under GenBank accession no. Y12615 are shaded. A 6-bp
duplication in Y12615 presumed to be artifactual was omitted (see
text). Selected positions are numbered below the sequences according to
accession no. Y12615. The intron-exon boundary is indicated with a
vertical line. The arrowhead at position 399 indicates the 5'-most
nucleotide of a polymorphic Tsp509I site in exon 2. Clones
icp-1, tamu-2, tamu-5, 0541L-5, 0541L-6, 0541L-8, 2066K-5, and 0583K-8
were sequenced on both strands. All others were sequenced on one
strand. A sequence ambiguity in 0541L-9 is indicated in lowercase.
|
|
The
-tubulin sequence alignment defined four groups of
-tubulin
alleles. Two of these matched the genotypes H and C described
previously (
6,
15). A third group was comprised of isolates
0676I, Peru2, and one sequence of Peru1. On the basis of RFLP
analysis,
these isolates were assigned to subgroup C. Lastly,
two clones
from human isolate 0583K constituted a fourth group.
Two
-tubulin
sequences originating from this isolate revealed
numerous differences
from the other
alleles.
The comparison of multiple clones from individual isolates
revealed intraisolate heterogeneity. For example, in
isolate Peru,
three clones grouped with the 0676I sequences and
one was related
to the sequences found in other C isolates. In
contrast, there
was a high degree of homogeneity among C
isolates, regardless
of their human or bovine
source.
The relationship between the C, H, and 0676I-Peru sequences
suggested that the last group arose from multiple recombination
events between the H and C sequences. This assumption was based
on the
observation that the 0676I-Peru sequences alternately share
polymorphic
nucleotides with the H and the C groups. For example,
this is apparent
within the intron, where the 0676I-Peru group
shares a polymorphic T
and C with the H group and then six positions
with the C group (Fig.
2). This recombinant sequence could have
arisen from one crossover
event in the intron and two in the exon,
flanking position
399.
Variable ratio of -tubulin alleles in a calf-propagated
isolate.
RFLP analysis of -tubulin PCR products amplified from
different calf passages of isolate GCH1 revealed a changing ratio of Tsp509I+ and Tsp509I alleles. This resulted
in restriction profiles with variable ratios of uncut (408-bp) to cut
(309- and 99-bp) fragments. This is illustrated by three calf passages
of isolate GCH1 collected between December 1997 and March 1998 (Fig.
3). The December and March samples showed
a predominance of Tsp509I DNA, while the sample from
February showed the opposite pattern. In contrast to the -tubulin
profile, no changes were seen in the calf-propagated samples with other
RFLP markers. All GCH1 samples consistently displayed genotype C at
these loci (not shown). Similar changes in the ratio of -tubulin
alleles were made on GCH1 passaged in mice (not shown).
View larger version (69K):
[in this window]
[in a new window]
|
FIG. 3.
Variable -tubulin restriction profiles in GCH1
oocysts from three calf passages. A 538-bp fragment was PCR amplified
with primers btub5 and btub2 from three samples of GCH1 oocyst DNA
collected from calf passages at the dates shown (lanes 2 to 4). The
difference in restriction profiles was caused by variable ratios of
-tubulin alleles with or without a Tsp509I site at
position 399. The sizes of the uncut PCR product (lane 1) and the
relevant restriction fragments are shown (in base pairs) at the left.
The length of the uncut PCR product (538 bp) and digests (408 bp or 309 and 99 bp) is not additive due to the presence of several unresolved
small fragments totalling 129 to 133 bp (Fig. 1A). The positions of
600- and 100-bp size markers are indicated on the right.
|
|
In view of the unexpected variability of the
-tubulin restriction
profiles, a control experiment was performed to rule out
possible
artifacts. First, we ruled out incomplete digestion with
Tsp509I, since the full-length, 538-bp PCR product
(Fig.
3, lane
1) was not visible in the digests (lanes 2 to 4).
Second, in order
to confirm that the mixed
-tubulin RFLP profiles
originated from
genotypically mixed
C. parvum DNA, the
following control experiment
was performed. PCR products were amplified
from DNA samples showing
an approximately equal ratio of
Tsp509I
+ and Tsp509I
DNA and cloned into a
plasmid vector. Recombinant plasmids were
subjected individually to PCR
amplification with primers btub5
and btub2 and were RFLP typed with
Tsp509I. Among nine plasmids
analyzed in this manner, five
were Tsp509I
and four were Tsp509I
+ (not
shown). As to be expected from cloned sequences, no mixed
patterns were
observed. This observation supports our interpretation
that mixed
Tsp509I restriction profiles originated from mixed
DNA
templates. Mixed
-tubulin RFLP profiles were also found in
some
human isolates of genotype H, indicating that isolates classified
as
genotype C or H may carry different
-tubulin
alleles.
| |
DISCUSSION |
The sequence alignment and the RFLP analysis of the
C. parvum -tubulin intron and 5' portion of exon 2 were consistent with the existence of two main subgroups in this
species. In addition, this analysis demonstrated the presence of
additional polymorphisms within each subgroup and revealed two new
subgroups, one of them showing significant divergence. The occurrence
of additional heterogeneity is consistent with earlier genotypic and
phenotypic observations. Specifically, sequence heterogeneity was
observed among genotype H (genotype 1) isolates at the TRAP-C2 locus
(10) and among different PCR clones amplified from the
poly(T) locus (14). Differences in virulence in tissue
culture, as defined by the release of lactate dehydrogenase and
decrease in transmonolayer resistance, were also consistent with
heterogeneity within genetic subgroups (15).
Both newly identified subgroups are of interest, the 0676I-Peru group
because it shows sequence patterns suggestive of a recombination between alleles found in the H and C subgroups and the 05483K sequences
for showing considerable divergence from other -tubulin alleles.
Sequences suggestive of recombination between the H and C genotypes
were unexpected, since the two subgroups are assumed to be
reproductively isolated. This view is based on the absence of
recombinant isolates as defined by multilocus RFLP analysis. With
respect to the unusual 05483K -tubulin sequence, a unique restriction polymorphism was found in the poly(T) locus of this isolate
(14a), a further indication that isolate 05483K possesses a
distinct genotype.
The high frequency of mixed -tubulin genotypes contrasts with
observations on other RFLP markers, which rarely display mixed profiles
(6). We assume that a certain proportion of natural populations of C. parvum are genotypically mixed and
that the examination of other highly variable loci will reveal
additional mixed profiles.
As exemplified by the GCH1 -tubulin RFLPs, the ratio
between Tsp509I+ and Tsp509I alleles is
unstable. The reason for this phenomenon is unknown. Since changes were
seen during serial passage in calves, it cannot be excluded that new
-tubulin alleles are imported with the calves prior to infection. In
this context, it is interesting that in two calf-propagated isolates
(GCH1 and Peru), a predominantly Tsp509I+ profile coincided
with low infectivity in calves. As pointed out above,
Tsp509I+ alleles are not frequently seen in calves. It is
presently unclear whether different -tubulin alleles have any
phenotypic relevance or are linked to other phenotypically relevant
traits. Given a sufficient number of isolates, it should be possible to
address this question by assaying isolates bearing different
-tubulin alleles for virulence in tissue culture or in mice.
Evidence against any phenotypic significance of the -tubulin
polymorphism is the fact that the majority of polymorphisms within exon
2 were silent. Substitutions changing the amino acid sequence were
present in single clones only, suggesting that they may be polymerase
or sequencing artifacts.
Although new information from previous studies of genotypic
polymorphism in C. parvum was gained through sequence
analysis, this approach is time-consuming and expensive. Based on the
sequence information gained from this study, it is now possible to
design PCR-based methods capable of directly discriminating between
-tubulin alleles. To this end, PCR primers flanking the T
repeat located within the intron are being evaluated in parallel with
the Tsp509I RFLP profiles for routine isolate
characterization. The -tubulin marker alone or together with
microsatellite markers under development should provide faster
and less expensive methods for genotyping C. parvum
isolates. The present study validates the idea that untranslated
regions are suitable targets for such applications. The analysis of
hypervariable loci will facilitate the identification of clinically
relevant markers and find application in epidemiological studies.
| |
ACKNOWLEDGMENTS |
This work was supported by USDA grant 94-371020914 and NIH
Cooperative Agreement U019AI33384.
Our thanks go to Carl Fichtenbaum, Jeff Griffiths, and the NIH ACTG 336 team, patients, and site personnel for providing samples, to Heidi
Scaltreto for technical assistance, and to Sylvie Le Blancq and Mike
Piper for mapping the -tubulin gene. Samples were kindly
provided by Lucy Ward (Ohio State University), Marilyn Marshall
(University of Arizona), Joe Crabb (ImmuCell, Portland, Maine), Furio
Spano (University of Rome, Rome, Italy), Karen Snowden (Texas A&M
University), Hal Stibbs (Waterborne, New Orleans, La.), and Keith
Mansfield (New England Regional Primate Center, Southboro, Mass.).
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Tufts
University, Bldg. 20, 200 Westboro Road, North Grafton, MA 01536. Phone: (508) 839 7944. Fax: (508) 839 7977. E-mail:
gwidmer{at}infonet.tufts.edu.
| |
REFERENCES |
| 1.
|
Awad-El-Kariem, F. M.,
H. A. Robinson,
D. A. Dyson,
D. Evans,
S. Wright,
T. M. Fox, and V. McDonald.
1995.
Differentiation between human and animal strains of Cryptosporidium parvum using isoenzyme typing.
Parasitology
110:129-132.
|
| 2.
|
Awad-El-Kariem, F. M.,
H. A. Robinson,
F. Petry,
V. McDonald,
D. Evans, and D. Casemore.
1998.
Differentiation between human and animal isolates of Cryptosporidium parvum using molecular and biological markers.
Parasitol. Res.
84:297-301[Medline].
|
| 3.
|
Bonnin, A.,
M. N. Fourmaux,
J. F. Dubremetz,
R. G. Nelson,
P. Gobet,
G. Harly,
M. Buisson,
D. Puygauthier-Toubas,
F. Gabriel-Pospisil,
M. Naciri, and P. Camerlynck.
1996.
Genotyping human and bovine isolates of Cryptosporidium parvum by polymerase chain reaction-restriction fragment length polymorphism analysis of a repetitive DNA sequence.
FEMS Microbiol. Lett.
137:207-211[Medline].
|
| 4.
|
Cacciò, S.,
G. La Rosa, and E. Pozio.
1997.
The beta-tubulin gene of Cryptosporidium parvum.
Mol. Biochem. Parasitol.
89:307-311[Medline].
|
| 5.
|
Carraway, M.,
S. Tzipori, and G. Widmer.
1996.
Identification of genetic heterogeneity in the Cryptosporidium parvum ribosomal repeat.
Appl. Environ. Microbiol.
62:712-716[Abstract].
|
| 6.
|
Carraway, M.,
S. Tzipori, and G. Widmer.
1997.
New restriction fragment length polymorphism marker in Cryptosporidium parvum identifies mixed parasite populations and genotypic instability in response to host change.
Infect. Immun.
65:3958-3960[Abstract].
|
| 7.
|
Guerrant, R. L.
1997.
Cryptosporidiosis: an emerging, highly infectious threat.
Emerg. Infect. Dis.
3:51-57[Medline].
|
| 7a.
| Le Blancq, S. (Columbia University). Personal
communication.
|
| 8.
|
Le Blancq, S. M.,
N. Khramtsov,
F. Zamani,
S. J. Upton, and T. W. Wu.
1997.
Ribosomal RNA gene organization in Cryptosporidium parvum.
Mol. Biochem. Parasitol.
90:463-478[Medline].
|
| 9.
|
Morgan, U. M.,
C. C. Constantine,
P. O'Donoghue,
B. P. Meloni,
P. A. O'Brien, and R. C. A. Thompson.
1995.
Molecular characterization of Cryptosporidium isolates from human and other animals using random amplified polymorphic DNA analysis.
Am. J. Trop. Med. Hyg.
52:559-564.
|
| 10.
|
Peng, M. M.,
L. Xiao,
A. R. Freeman,
M. J. Arrowood,
A. A. Escalante,
A. C. Weltman,
C. S. L. Ong,
W. R. MacKenzie,
A. A. Lal, and C. B. Beard.
1997.
Genetic polymorphism among Cryptosporidium parvum isolates: evidence for two distinct human transmission cycles.
Emerg. Infect. Dis.
3:567-573[Medline].
|
| 10a.
| Piper, M. (Medical Research Council, Cambridge, United
Kingdom). Personal communication.
|
| 11.
|
Spano, F.,
L. Putignani,
J. McLaughlin,
D. P. Casemore, and A. Crisanti.
1997.
PCR-RFLP analysis of the Cryptosporidium oocyst wall protein (COWP) gene discriminates between C. wrairi and C. parvum, and between C. parvum isolates of human and animal origin.
FEMS Microbiol. Lett.
152:209-217.
|
| 12.
|
Tzipori, S.
1988.
Cryptosporidiosis in perspective.
Adv. Parasitol.
27:63-130[Medline].
|
| 13.
|
Tzipori, S.,
W. Rand,
J. Griffiths,
G. Widmer, and J. Crabb.
1994.
Evaluation of an animal model system for cryptosporidiosis: therapeutic efficacy of paromomycin and hyperimmune bovine colostrum-immunoglobulin.
Clin. Diagn. Lab. Immunol.
1:450-463[Abstract/Free Full Text].
|
| 14.
|
Widmer, G.
1998.
Genetic heterogeneity and PCR detection of Cryptosporidium parvum.
Adv. Parasitol.
40:224-241.
|
| 14a.
| Widmer, G., L. Tchack, and S. Tzipori. Unpublished
data.
|
| 15.
|
Widmer, G.,
S. Tzipori,
C. J. Fichtenbaum, and J. K. Griffiths.
1998.
Genotypic and phenotypic characterization of Cryptosporidium parvum isolates from people with AIDS.
J. Infect. Dis.
178:834-840[Medline].
|
Applied and Environmental Microbiology, November 1998, p. 4477-4481, Vol. 64, No. 11
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Learmonth, J. J., Ionas, G., Ebbett, K. A., Kwan, E. S.
(2004). Genetic Characterization and Transmission Cycles of Cryptosporidium Species Isolated from Humans in New Zealand. Appl. Environ. Microbiol.
70: 3973-3978
[Abstract]
[Full Text]
-
Xiao, L., Fayer, R., Ryan, U., Upton, S. J.
(2004). Cryptosporidium Taxonomy: Recent Advances and Implications for Public Health. Clin. Microbiol. Rev.
17: 72-97
[Abstract]
[Full Text]
-
Gatei, W., Greensill, J., Ashford, R. W., Cuevas, L. E., Parry, C. M., Cunliffe, N. A., Beeching, N. J., Hart, C. A.
(2003). Molecular Analysis of the 18S rRNA Gene of Cryptosporidium Parasites from Patients with or without Human Immunodeficiency Virus Infections Living in Kenya, Malawi, Brazil, the United Kingdom, and Vietnam. J. Clin. Microbiol.
41: 1458-1462
[Abstract]
[Full Text]
-
Akiyoshi, D. E., Feng, X., Buckholt, M. A., Widmer, G., Tzipori, S.
(2002). Genetic Analysis of a Cryptosporidium parvum Human Genotype 1 Isolate Passaged through Different Host Species. Infect. Immun.
70: 5670-5675
[Abstract]
[Full Text]
-
Tanriverdi, S., Tanyeli, A., Baslamisli, F., Koksal, F., Kilinc, Y., Feng, X., Batzer, G., Tzipori, S., Widmer, G.
(2002). Detection and Genotyping of Oocysts of Cryptosporidium parvum by Real-Time PCR and Melting Curve Analysis. J. Clin. Microbiol.
40: 3237-3244
[Abstract]
[Full Text]
-
Leav, B. A., Mackay, M. R., Anyanwu, A., O' Connor, R. M., Cevallos, A. M., Kindra, G., Rollins, N. C., Bennish, M. L., Nelson, R. G., Ward, H. D.
(2002). Analysis of Sequence Diversity at the Highly Polymorphic Cpgp40/15 Locus among Cryptosporidium Isolates from Human Immunodeficiency Virus-Infected Children in South Africa. Infect. Immun.
70: 3881-3890
[Abstract]
[Full Text]
-
Limor, J. R., Lal, A. A., Xiao, L.
(2002). Detection and Differentiation of Cryptosporidium Parasites That Are Pathogenic for Humans by Real-Time PCR. J. Clin. Microbiol.
40: 2335-2338
[Abstract]
[Full Text]
-
Guyot, K., Follet-Dumoulin, A., Recourt, C., Lelievre, E., Cailliez, J. C., Dei-Cas, E.
(2002). PCR-Restriction Fragment Length Polymorphism Analysis of a Diagnostic 452-Base-Pair DNA Fragment Discriminates between Cryptosporidium parvum and C. meleagridis and between C. parvum Isolates of Human and Animal Origin. Appl. Environ. Microbiol.
68: 2071-2076
[Abstract]
[Full Text]
-
Guyot, K., Follet-Dumoulin, A., Lelievre, E., Sarfati, C., Rabodonirina, M., Nevez, G., Cailliez, J. C., Camus, D., Dei-Cas, E.
(2001). Molecular Characterization of Cryptosporidium Isolates Obtained from Humans in France. J. Clin. Microbiol.
39: 3472-3480
[Abstract]
[Full Text]
-
Perz, J. F., Le Blancq, S. M.
(2001). Cryptosporidium parvum Infection Involving Novel Genotypes in Wildlife from Lower New York State. Appl. Environ. Microbiol.
67: 1154-1162
[Abstract]
[Full Text]
-
Xiao, L., Alderisio, K., Limor, J., Royer, M., Lal, A. A.
(2000). Identification of Species and Sources of Cryptosporidium Oocysts in Storm Waters with a Small-Subunit rRNA-Based Diagnostic and Genotyping Tool. Appl. Environ. Microbiol.
66: 5492-5498
[Abstract]
[Full Text]
-
Feng, X., Rich, S. M., Akiyoshi, D., Tumwine, J. K., Kekitiinwa, A., Nabukeera, N., Tzipori, S., Widmer, G.
(2000). Extensive Polymorphism in Cryptosporidium parvum Identified by Multilocus Microsatellite Analysis. Appl. Environ. Microbiol.
66: 3344-3349
[Abstract]
[Full Text]
-
Strong, W. B., Gut, J., Nelson, R. G.
(2000). Cloning and Sequence Analysis of a Highly Polymorphic Cryptosporidium parvum Gene Encoding a 60-Kilodalton Glycoprotein and Characterization of Its 15- and 45-Kilodalton Zoite Surface Antigen Products. Infect. Immun.
68: 4117-4134
[Abstract]
[Full Text]
-
Clark, D. P.
(1999). New Insights into Human Cryptosporidiosis. Clin. Microbiol. Rev.
12: 554-563
[Abstract]
[Full Text]
-
Widmer, G., Orbacz, E. A., Tzipori, S.
(1999). beta -Tubulin mRNA as a Marker of Cryptosporidium parvum Oocyst Viability. Appl. Environ. Microbiol.
65: 1584-1588
[Abstract]
[Full Text]
Top
Abstract
Introduction
