This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Le Gall, F.
Right arrow Articles by Garnier, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Le Gall, F.
Right arrow Articles by Garnier, M.
Agricola
Right arrow Articles by Le Gall, F.
Right arrow Articles by Garnier, M.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, November 1998, p. 4566-4572, Vol. 64, No. 11
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Engineering of a Single-Chain Variable-Fragment (scFv) Antibody Specific for the Stolbur Phytoplasma (Mollicute) and Its Expression in Escherichia coli and Tobacco Plants

Fabrice Le Gall, Joseph-Marie Bové, and Monique Garnier*

Laboratoire de Biologie Cellulaire et Moléculaire, Institut National de la Recherche Agronomique et Université Victor Segalen Bordeaux 2, 33883 Villenave d'Ornon cedex, France

Received 20 January 1998/Accepted 12 August 1998

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

From a hybridoma cell line (2A10) producing an immunoglobulin G1 directed against the major membrane protein of the stolbur phytoplasma, we have engineered scFv (single-chain variable-fragment) antibodies from the variable heavy (VH) and light (VL) domains of the immunoglobulin. The scFv gene was cloned and expressed in Escherichia coli. The expressed protein of 30 kDa could be recovered from the periplasmic fraction of the bacterial cells and was shown to be fully functional toward its phytoplasmal antigen, since enzyme-linked immunosorbent assay or immunofluorescence (IF) detection of the stolbur phytoplasma antigen by the scFv was identical to that of the native immunoglobulin. The scFv gene was then cloned in plasmid pBG-dAb-BIN of Agrobacterium tumefaciens to transform tobacco plants. The transformed plants were screened by PCR and Northern blotting for the presence and expression of the transgene, respectively, and by IF for expression of the scFv. One transgenic tobacco line, 1A6, was selected for challenge inoculation with the stolbur phytoplasma. When grafted on a stolbur phytoplasma-infected tobacco rootstock, the transgenic tobacco shoots grew free of symptoms and flowered after 2 months, while normal tobacco shoots showed severe stolbur symptoms during the same period and eventually died.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Expression in plants of antibodies (plantibodies) that are able to interfere with the multiplication of pathogens can provide an efficient way to induce resistance to many diseases. Mollicutes are wall-less bacteria that infect humans, animals, and plants (4, 5, 20). They originated, in the course of evolution, from low-G+C gram-positive bacteria by gene loss and genome reduction (regressive evolution); in particular, they have lost the genes responsible for the synthesis of a bacterial cell wall (5). Thus, mollicutes are limited by a single cytoplasmic membrane. This is why metabolism and growth of mollicutes are inhibited by antibodies directed against their membrane epitopes. These inhibitions are generally followed by lysis of the mollicute (18). Thus, plant-pathogenic mollicutes are, a priori, ideal candidates for a plantibody-controlled resistance strategy.

Mollicutes (phytoplasmas and spiroplasmas) are responsible for more than 300 diseases of vegetable, ornamental, and perennial plants (20). These agents are localized exclusively in the sieve tubes of the phloem tissue (9), into which they are inoculated by insect vectors (leafhoppers and psyllids). Phytoplasmas, the largest group of plant-pathogenic mollicutes, cannot be grown in artificial media. As of today, diseases induced by plant mollicutes cannot be controlled.

Recently, several groups were able to express mouse-derived antibodies in plants (1, 2, 8, 14, 17, 22, 24), and reduction of virus multiplication has been observed in transgenic plants expressing whole immunoglobulin G (IgG) or single-chain variable-fragment (scFv) antibody directed against the virus coat protein (27, 28). Since the growth of mollicutes is inhibited by antibodies, constitutive expression in a plant of an antibody specific for a given mollicute should prevent its multiplication, especially since the number of mollicutes inoculated by an insect vector is small (<103). To evaluate the ability of antibodies to control mollicute diseases in plants, we have engineered and expressed in tobacco plants monoclonal antibody 2A10, directed against the major membrane protein of the stolbur phytoplasma (16). The stolbur phytoplasma induces diseases in all solanaceous species worldwide, including tobacco, a good model plant for transgenosis (15, 20), but also plants belonging to other species such as lavender and celery, where it induces decline and porcelain disease respectively. The stolbur agent has recently also been shown to be responsible for the following grapevine diseases: bois noir in France (3), Vergilbungskrankheit (VK) in Germany (25), and Australian yellows in Australia (7). Since the stolbur phytoplasma is transmitted by the polyphagous leafhopper Hyalesthes obsoletus (15), it is likely to be associated with other diseases as well.

In this paper, we describe the engineering of monoclonal antibody 2A10 into an scFv, its expression in Escherichia coli cells and tobacco plants, and the ability of the expressed scFv to bind the phytoplasma antigen. An experiment in which one transgenic tobacco line has been challenged with the stolbur phytoplasma is also presented.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Plant material. Healthy periwinkle (Catharantus roseus (L.) g. Don) and tobacco (Nicotiana tabacum (L.) cv. P B D6) plants were grown from seeds. Seeds of the commercial P B D6 tobacco variety were kindly provided by René Delon, Institut du Tabac, Bergerac, France. Stolbur phytoplasma-infected periwinkle plants were obtained as described previously (15). The stolbur phytoplasma was transmitted from periwinkle to tobacco via dodder (Cuscuta campestris L.) and then maintained in tobacco plants by graft inoculation of 1-month-old plants. The presence of the stolbur phytoplasma in graft-inoculated plants was assessed by symptom expression and confirmed by double-sandwich enzyme-linked immunosorbent assay (DAS-ELISA) (see below).

The plants were grown in a greenhouse at 25°C during the day and 20°C at night.

Mouse hybridoma cell lines. Hybridoma 2A10 producing a monoclonal antibody (MAb) (IgG1) against a membrane epitope of the stolbur phytoplasma (16) and hybridoma Myc-9E10-2 (ATCC CRL 1729) producing MAb 9E10 against the human c-myc protein (13) were used in this study.

E. coli strains and cloning vectors. The following E. coli strains and vectors were used: E. coli XL1-Blue and plasmid BluescriptSK+ (pBS; Stratagene, La Jolla, Calif.), for cloning variable heavy (VH) and variable light (VL) sequences, and E. coli JM109 (Promega, Madison, Wis.) and plasmids pUC18 and pUC19 (MBI Fermentas, Vilnius, Lithuania), for scFv expression. Plasmid pS8 (27) was also used for scFv constructions. Restriction enzymes SmaI, HindIII, XbaI, PstI, BstEII, EcoRI, SacI, SalI, and XhoI were purchased from MBI Fermentas. All standard techniques, if not described, were as described by Sambrook et al. (23). Plasmid pBG-dAb-BIN of Agrobacterium tumefaciens (27) was used for plant transformation.

mRNA isolation. Cells of hybridoma 2A10 producing the anti-stolbur phytoplasma MAb were cultured in Iscove modified medium containing 20% (vol/vol) fetal bovine serum, 2% (vol/vol) glutamine (200 mM), and 1% (vol/vol) gentamicin (10 mg/ml) in a 5% CO2 humidified incubator. RNAs were prepared from about 109 hybridoma cells by the guanidine isothiocyanate method as described by Chirgwin et al. (6). mRNAs were purified by affinity chromatography on an oligo(dT) cellulose column (Pharmacia, Uppsala, Sweden) as specified by the manufacturer.

cDNA synthesis and PCR amplification of Ig variable regions. First-strand cDNA was synthesized from the mRNA template with the First-Strand cDNA synthesis kit (Pharmacia) with primers VH1FOR (5' TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG 3') (21) and VK2FOR (5' CCGTTTGATCTCGAGCTTGGTGCC 3') (27) for amplification of the VH and VL regions, respectively. The VH regions were amplified with primers VH1FOR and VH1BACK (5' AGGTSMARCTGCAGSAGTCWGG 3') (21), in which S is C or G, M is A or C, R is A or G, and W is A or T. Primers VK2FOR and VK2BACK (5' GACATCGAGCTCACTCAGTCTCCA 3') (27) were used for amplification of the VL regions. PCR was done for 35 cycles (1 cycle is 1 min at 92°C, 1 min at 57°C, and 1 min at 72°C), in 50 µl of the following reaction mixture: 78 mM Tris-HCl (pH 8.8)-17 mM (NH4)2SO4-10 mM beta -mercaptoethanol-2 mM MgCl2-0.05% W-1 detergent (Gibco BRL, Gaithersburg, Md.)-0.2 mg of bovine serum albumin per ml-200 µM each dATP, dCTP, dGTP, and dTTP-1 µM each primer-10 ng of matrix-2.5 U of Taq DNA polymerase (Gibco BRL). The PCR products were analyzed on a 2% low-melting-point agarose-Tris acetate-EDTA (TAE) gel and visualized with ethidium bromide. PCR products of the expected size were excised from the gel and purified with a Geneclean II kit (Bio 101, Vista, Calif.) as specified by the manufacturer.

The fragment ends were made blunt with Klenow DNA polymerase, cloned into the SmaI site of pBS, and introduced into XL1-Blue E. coli competent cells. Clones pBS::VH2A10 and pBS::VL2A10 were sequenced by the dideoxy chain termination method with the T7 DNA polymerase sequencing kit (Pharmacia) and the universal forward and reverse primers.

Construction of pUC19::scFv-Secr[2A10] for expression in E. coli. A 900-bp HindIII-EcoRI fragment of plasmid pS8, containing a Shine-Dalgarno sequence, the pectate lyase signal peptide (pelB) of Erwinia carotovora (19), the c-myc peptide tag sequence (13), and an scFv sequence, was cloned into the HindIII-EcoRI sites of pUC19 to give pUC19::scFv-Secr[S8]. The SalI-XhoI fragment encoding VL2A10 from pBS::VL2A10 and the PstI-BstEII fragment encoding VH2A10 from pBS::VH2A10 were ligated into the SalI-XhoI and PstI-BstEII sites of pUC19::scFv-Secr[S8], respectively, to replace the original VH and VL fragments of the scFv contained in this plasmid. The resulting plasmid, pUC19::scFv-Secr[2A10], is shown in Fig. 1A. For control experiments, a similar construction in which the scFv gene was cloned in the reverse orientation was made in pUC18 and called pINV::scFv-Secr[2A10].


View larger version (15K):
[in this window]
[in a new window]
 
FIG. 1.   (A) Plasmid pUC19::scFv-Secr[2A10] used for expression of the scFv in E. coli. (B) Plasmid 35-pel-scFv[2A10] used to transform tobacco plants with A. tumefaciens. NOS terminator, nopaline synthase transcription terminator; Npt II, neomycin phosphotransferase II gene.

Construction of 35-pel-scFv[2A10] for expression in tobacco plants. The HindIII-EcoRI fragment of pUC19 containing the scFv[2A10] construction was modified to introduce XbaI and SalI sites at the 5' and 3' ends, respectively. For that purpose, mutagenesis by PCR was performed with Pfu DNA polymerase (Stratagene) with primers XBA (5' TCTAGACTCGAAGCTTGCATGC 3') and SAL (5' GTCGACGAATTCGAGCTGG 3'). Twenty-five cycles of PCR were allowed to take place under the conditions described above. The PCR products were digested with XbaI and SalI and cloned into plasmid pBG-dAb-BIN that had been linearized with the same enzymes. This produced plasmid 35-pel-scFv[2A10] (Fig. 1B), which was used for plant transformation.

Expression of scFv[2A10] in E. coli. E. coli JM109 cells transfected with pUC19::scFv-Secr[2A10] were grown at 30°C on a shaker overnight in 1 volume of Luria-Bertani medium (23) containing 120 mM glucose and 100 µM ampicillin. The cells were pelleted, washed twice in 1 volume of 50 mM NaCl, resuspended in 1 volume of Luria-Bertani medium containing 100 µM ampicillin and 1 mM IPTG (isopropyl-beta -D-thiogalactopyranoside), and incubated for 3 h at 30°C. The periplasmic and osmotic shock fractions of E. coli cells were obtained by a method derived from that of Dübel et al. (11). The cells were pelleted at 6,200 × g for 10 min at 4°C, the pellet was resuspended in 1/10 volume of the original culture in a buffer containing 50 mM Tris-HCl (pH 8.0), 20% (wt/vol) sucrose, and 1 mM EDTA and left for 30 min on ice with occasional shaking. After centrifugation, the supernatant representing the enriched periplasmic fraction was stored at 4°C. The bacterial pellet was resuspended by vortexing in 1/10 of the original culture volume in a buffer containing 5 mM MgSO4 and incubated for 30 min on ice with occasional shaking. After centrifugation at 6,200 × g for 10 min at 4°C, the supernatant representing the osmotic shock fraction was stored at 4°C. The E. coli periplasmic and osmotic shock fractions were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (15% acrylamide) with a 1.5-mm-thick gel in a V15.17 vertical gel electrophoresis apparatus (Gibco BRL). After separation, the protein bands were transferred to a nitrocellulose membrane (Amersham, Little Chalfont, United Kingdom) with a horizontal electrophoretic transfer system (Biolyon, Dardilly, France). The transblotted membrane was probed with the 9E10 anti-c-Myc antibody, washed, and incubated with rabbit anti-mouse IgG labelled with alkaline phosphatase (Sigma, Saint Louis, Mo.) as specified by the manufacturer. Nitroblue tetrazolium and 5-bromo-4-chloro-3-indolylphosphate p-toluidine (Boehringer GmbH, Mannheim, Germany) were used as substrates.

Plant transformation. A. tumefaciens LB4404 was electroporated with 35-pel-scFv[2A10] plasmid as specified previously (12). Transformation of leaf disks of P B D6 tobacco plants and regeneration were done as described previously (10).

Analysis of transgenic plants. Genomic DNA was extracted from fresh leaves with a DNeasy plant mini kit (Qiagen S.A.). The presence of the transgene was demonstrated by PCR amplification with BIS (5' CTGAGCGGATAACAATTTCAC 3') and BIR (5' GACCGGCAACAGGATTCAATC 3') primers for 35 cycles (1 cycle is 1 min at 93°C, 1 min at 58°C, and 1 min at 72°C) from 400 ng of plant DNA. Amplified products were analyzed on 1% agarose gels.

Northern blots. Total RNA was isolated from tobacco leaf tissue with the RNeasy mini kit (Qiagen S.A.). RNA (10 µg) was separated in 1% formaldehyde-agarose gel and blotted onto a nitrocellulose membrane (Hybond-C extra; Amersham). The blot was hybridized with the 902-bp HindIII-EcoRI fragment from pUC19::scFv-Secr[2A10], purified by the Geneclean II kit (Bio 101), and labelled with [alpha -32P]dATP by the random-priming procedure (random primers DNA labeling system; Gibco BRL).

Immunofluorescence. The immunofluorescence (IF) method described previously (16) for the detection of the stolbur phytoplasma on plant sections was used with the following modifications to test the reaction of the scFv produced by E. coli or tobacco plants with the phytoplasma.

For the E. coli-produced scFv, sections from healthy or stolbur phytoplasma-infected plants were incubated for 30 min at room temperature with the periplasmic or osmotic shock fractions obtained as described above. After being washed with phosphate-buffered saline containing 0.05% Tween 20 (PBS-Tween), they were incubated with hybridoma supernatant 9E10 for 30 min at room temperature. After a second wash with PBS-Tween, the sections were incubated with anti-mouse IgG-fluorescein isothiocyanate conjugate (Sanofi Diagnostic Pasteur, Marnes la Coquette, France) as specified by the manufacturer.

For scFv produced by tobacco plants, 1 g of a 2-month-old tobacco leaf was ground into 2 ml of PBS-Tween and filtered through cheesecloth. The filtrate was incubated for 30 min with sections of healthy or stolbur phytoplasma-infected plants and then processed as described above. Similar extracts from normal tobacco leaves were used as controls. IF reactions in which the scFv or MAb 9E10 was omitted were also performed.

ELISA. DAS-ELISA for the detection of the stolbur phytoplasma with MAb 2A10 was done as described previously (15).

For scFv produced by E. coli, the microplates were coated with a twofold dilution of the E. coli periplasmic fraction in sodium carbonate buffer (pH 9.5) at 37°C for 4 h. After being washed three times with PBS-Tween, the plates were incubated overnight at 4°C with the plant extracts obtained as described previously (15). After being washed with PBS-Tween, the plates were incubated with 2 µg of alkaline phosphatase-labelled 2A10 IgG (Sanofi Diagnostic Pasteur) per ml for 4 h at 37°C. The alkaline phosphatase activity was revealed with p-nitrophenyl phosphate at 1 mg/ml in substrate buffer. The optical density at 405 nm was measured after a 1-h incubation at room temperature.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Amplification of the VH and VL regions of IgG 2A10 and construction of the scFv. When the cDNA synthesized from hybridoma 2A10 mRNAs was amplified by PCR with universal primers for mouse IgG VH and VL regions, a 340-bp band was obtained for each PCR (Fig. 2, lanes 2 and 3). These amplified DNAs were cloned, sequenced, and shown to correspond to the VH and VL regions of mouse Igs.


View larger version (27K):
[in this window]
[in a new window]
 
FIG. 2.   Agarose gel electrophoresis of the DNA amplified with primers pairs VH1FOR and VH1BACK (lanes 1 and 2) and VK2FOR and VK2BACK (lanes 3 and 4) from water (lanes 1 and 3) or cDNAs corresponding to the H (lane 2) and L (lane 4) IgG chains. M, 1-kb ladder (Gibco BRL).

The VH and VL DNA fragments were then linked with the flexible peptide (Gly4 Ser)3 sequence as described in Materials and Methods. At each step, the sequences of the various clones were determined and compared to the initial sequences obtained for the VH and VL fragments to verify that the construction was in frame.

Cloning and expression of the scFv gene in E. coli. The scFv construct was cloned in pUC19 between the leader sequence pelB of Erwinia carotovora and a tag sequence coding for the 11-amino-acid product of the c-myc oncogene, under the control of the lacZ promoter. The expression of the construct is shown in Fig. 3, where E. coli total proteins (lanes 4 to 6) or periplasmic proteins (lanes 1 to 3) have been separated and probed with MAb 9E10, which is specific for the tag peptide. A protein of about 30 kDa, in agreement with the size of the scFv DNA, could be seen in lanes 3 and 4 corresponding to the periplasmic and total protein fractions of transformed E. coli cells. No proteins could be revealed by MAb 9E10 in nontransformed E. coli cells (lanes 1 and 6) or in E. coli cells transformed with a plasmid in which the scFv gene was cloned in the reverse orientation (lanes 2 and 5).


View larger version (62K):
[in this window]
[in a new window]
 
FIG. 3.   Western blot analysis with antibody 9E10 of the periplasmic (lanes 1 through 3) and total (lanes 4 through 6) proteins of nontransformed E. coli cells (lanes 1 and 6), E. coli cells transformed with pINV::scFv-Secr[2A10] (lanes 2 and 5), and E. coli cells transformed with pUC19::scFv-Secr[2A10] (lanes 3 and 4). M, Rainbow protein molecular mass marker (Amersham).

Antigen-binding activity of the secreted scFv. To verify the reactivity of the E. coli-expressed scFv versus the stolbur phytoplasma antigen, IF and ELISA reactions have been carried out. As shown in Fig. 4, a strong green fluorescence was observed in the phloem tissue of stolbur phytoplasma-infected periwinkle plants incubated with the E. coli-produced scFv (Fig. 4A), while only the yellow-green autofluorescence of the xylem tissue, but no fluorescence in the phloem, was observed on the healthy sections (Fig. 4B). The intensity of the scFv-induced IF reaction was similar to that obtained with the native IgG from hybridoma supernatant 2A10 (Fig. 4C). No fluorescence was observed with fractions obtained from nontransformed E. coli cells or when MAb 9E10 was omitted.


View larger version (140K):
[in this window]
[in a new window]
 
FIG. 4.   IF reactions obtained with the scFv 2A10 produced by E. coli cells (A and B), tobacco leaves (D), or native hybridoma-produced IgG (C) on healthy (B) or stolbur phytoplasma-infected (A, C, and D) midrib sections. P, phloem; X, xylem. Magnification, ×1,075.

Similarly, when E. coli-expressed scFvs were used to coat ELISA plates (Table 1), the OD405 obtained with stolbur phytoplasma-infected periwinkle extracts was high (OD405 = 1.102) and similar to that obtained with the native IgG (OD405 = 1.0). No reaction (OD405 = 0.06) was obtained with extracts prepared from healthy periwinkle plants or when the plant extract was replaced by PBS buffer (OD405 = 0.120).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   DAS-ELISA detection of the stolbur phytoplasma antigen with scFv 2A10 produced by E. coli cells

Cloning of the scFv in A. tumefaciens, transformation, and analysis of tobacco plants. The scFv construction from E. coli was cloned into plasmid pBG-dAb-BIN of A. tumefaciens under the control of the 35S cauliflower mosaic virus promoter. The construct was sequenced to verify that no modification had occurred and was used to transform tobacco P B D6 leaf discs. Twenty-eight kanamycin-resistant tobacco plants were obtained and studied. Table 2 shows a summary of the results of PCR, Northern blotting, and IF reactions, which are meant to detect the transgene, its mRNA, and the expressed scFv, respectively, in the kanamycin-resistant tobacco lines. The gene could be found by PCR in 18 of 28 plants. Examples of scFv gene amplification by PCR are illustrated in Fig. 5A for tobacco transformants 1A1 to 1A8 (lanes 1 to 8) and 1B1, 1B2, and 1B3 (lanes 9 to 11). The corresponding mRNAs could be detected in the 18 PCR-positive tobacco plants by Northern blotting. Figure 5B illustrates the Northern blots carried out on the same tobacco plants as in Fig. 5A. Expression of a functional scFv protein was demonstrated by IF in all 18 tobacco plant extracts in which the scFv gene and mRNA were detected. The positive IF reaction given by an extract of tobacco transformant 1A6, observed on a transverse section of a stolbur phytoplasma-infected tobacco plant, is illustrated in Fig. 4D. Ten tobacco transformants and the normal P B D6 control plant were negative in the three tests.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Analysis of kanamycin-resistant tobacco lines by PCR, Northern blotting, and IF for the presence of the scFv gene, mRNA, and protein


View larger version (37K):
[in this window]
[in a new window]
 
FIG. 5.   PCR (A) and Northern (B) analysis of kanamycin-resistant tobacco transformants. Lanes: 1 to 8, tobacco transformants 1A1 to 1A8; 9 to 11, 1B1 to 1B3; NT, nontransformed tobacco plant; P, plasmid 35-pel-scFv[2A10]; M, 1-kb ladder (Gibco BRL).

Challenge inoculation of normal and transgenic 1A6 tobacco plants. Five shoots (3 cm long) produced from axillary buds of the tobacco transformant 1A6 were excised and top-grafted onto stolbur phytoplasma-infected tobacco plants of the same variety, P B D6. As controls, five similar shoots from a normal tobacco plant also were top-grafted onto infected plants. The tobacco plants used as rootstocks were tested individually by ELISA for the presence of the phytoplasma before grafting. The OD405 of the ELISA of each plant was between 1.5 and 2. After 2 months, all the plants from the transgenic tobacco shoots had grown as well as the uninfected plants, were symptomless, and had developed flower buds. However, all the plants from the normal, nontransgenic tobacco shoots were severely stunted, had developed typical stolbur symptoms, including short internodes and leaf crinkle, and did not flower. This is illustrated in Fig. 6, where plants that developed from two transgenic shoots (Fig. 6C and D) are compared to one obtained from a nontransgenic shoot (Fig. 6B). A normal, ungrafted tobacco plant (Fig. 6A) is shown as a control.


View larger version (54K):
[in this window]
[in a new window]
 
FIG. 6.   (B to D) Normal (B) and transgenic (C and D) tobacco 1A6 plants 2 months after top-grafting onto stolbur phytoplasma-infected PBD6 rootstocks. The yellow arrow indicates the grafting point. (A) Uninfected PBD6 tobacco plant (control).

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

For the first time, we have engineered, cloned, and expressed in E. coli and tobacco plants a functional scFv specific for a mollicute, i.e., the stolbur phytoplasma.

Mollicutes are strictly restricted to the sieve tubes within the phloem tissues. The cauliflower mosaic virus promoter that we have used is known to result in expression in all plant tissues, including phloem (26). Even though further experiments are needed to analyze our transgenic tobacco plants, the protection against the phytoplasma infection witnessed in the transgenic tobacco transformant 1A6 is an indirect indication that the scFv molecule is indeed present in the phloem tissue and more precisely in the sieve tube sap, where the phytoplasmas are located. Since our scFv construction includes the leader sequence pelB, the scFv is likely to be expressed through the secretory pathway. A construction in which the scFv is cloned under the control of a "phloem-specific" promoter (26) will also be undertaken.

Our attempts to detect the scFv in tobacco protein extracts by Western blotting have failed (data not shown). Generally, an immunoaffinity chromatography step is required to purify and concentrate the scFv before Western blotting or ELISA analysis (27). This step is time-consuming, because many plants must be tested. In this work, we were able to rapidly screen the transgenic tobacco plants producing antibodies by performing a simple IF reaction involving stolbur-phytoplasma-infected leaf sections incubated with crude leaf extracts from the transformed tobacco plants. This allowed us to select the scFv-producing tobacco plants even before the scFv gene and mRNA were detected.

In the experiments reported here, shoots from transgenic tobacco plant 1A6 expressing the stolbur phytoplasma-specific scFv were challenged with the stolbur phytoplasma being top-grafted onto tobacco plants heavily infected by the phytoplasma. The tobacco plants from the transgenic shoots grew as well as uninfected plants did and were symptomless in spite of the large phytoplasma inoculum used for this experiment. This indicates that the plantibody strategy is likely to provide a way to control phytoplasma diseases. However, the experiment must be repeated on a larger scale, which could not be done with the F0 parental line, since only a few shoots were suitable for grafting. The homozygote tobacco lines, obtained after autopollenization of the F0 generation, produced in this work, will be used for such an experiment. Indeed, in this case, a large number of tobacco plants can be inoculated by the insect vector H. obsoletus or by side-grafting. The multiplication of the phytoplasma in transgenic or normal plants will be easily monitored during plant development.

    ACKNOWLEDGMENTS

This work was supported by grants from the French Ministry of Education Research and Technology and by the "Pôle Génie Biologique et Médical" d'Aquitaine. Fabrice Le Gall was supported by a thesis fellowship from INRA (Institut National de la Recherche Agronomique) and SEITA (Société d'Exploitation Industrielle des Tabacs et Allumettes).

We thank René Delon and François Dorlhac de Borne (Institut du Tabac, Bergerac, France) for providing the P B D6 tobacco seeds and for their contributions during transformation and regeneration of tobacco plants. We thank Patrizia Galeffi (ENEA, Rome, Italy) for providing us with plasmids for scFv cloning and for helpful discussions.

    FOOTNOTES

* Corresponding author. Mailing address: Laboratoire de Biologie Cellulaire et Moléculaire, INRA, BP 81, 33883 Villenave d'Ornon cedex, France. Phone: (33) (0) 5 56 84 31 49. Fax: (33) (0) 5 56 84 31 59. E-mail: garnier{at}bordeaux.inra.fr.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Baum, T. J., A. Hiatt, W. A. Parrott, L. H. Pratt, and R. S. Hussey. 1996. Expression in tobacco of a functional monoclonal antibody specific to stylet secretions of the root-knot nematode. Mol. Plant-Microbe Interact. 9:382-387.
2. Benvenuto, E., R. J. Ordas, R. Tavazza, G. Ancora, S. Biocca, A. Cattaneo, and P. Galeffi. 1991. "Phytoantibodies": a general vector for the expression of immunoglobulin domains in transgenic plants. Plant Mol. Biol. 17:865-874[Medline].
3. Boudon-Padieu, E. 1996. Jaunisses à phytoplasmes de la vigne. Diagnostic, epidémiologie, et développement des recherches. C. R. Acad. Agric. France 82:5-21.
4. Bove, J. M., P. Carle, M. Garnier, J. Renaudin, and C. Saillard. 1989. Molecular and cellular biology of spiroplasmas, p. 244-364. In C. Calavan, and J. M. Bove (ed.), The mycoplasmas, vol. V. Academic Press, Inc., New York, N.Y.
5. Bove, J. M. 1993. Molecular features of mollicutes. Clin. Infect. Dis. 17:10-31.
6. Chirgwin, J. M., A. E. Przybyla, R. J. McDonald, and W. J. Rutter. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:5294-5299[Medline].
7. Davis, R. E., E. L. Dally, D. E. Gundersen, I.-M. Lee, and N. Habili. 1997. "Candidatus Phytoplasma australiense," a new phytoplasma taxon associated with Australian grapevine yellows. Int. J. Syst. Bacteriol. 47:262-269[Abstract/Free Full Text].
8. De Neve, M., M. De Loose, A. Jacobs, H. Van Houdt, B. Kaluza, U. Weilde, M. Van Montagu, and A. Depickerl. 1993. Assembly of an antibody and its derived antibody fragment in Nicotiana and Arabidopsis. Transgenic Res. 2:227-237[Medline].
9. Doi, Y., M. Teranaka, K. Yora, and H. Asuyama. 1967. Mycoplasma or PLT group-like microorganisms found in the phloem elements of plants infected with mulberry dwarf and potato witches' broom. Ann. Phytopathol. Soc. Jpn. 33:259-266.
10. Dorlhac de Borne, F., M. Vincentz, Y. Chupeau, and H. Vaucheret. 1994. Cosuppression of nitrate reductase host genes and transgenes in transgenic tobacco plants. Mol. Gen. Genet. 243:613-621[Medline].
11. Dübel, S., F. Breitling, R. Kontermann, T. Schmidt, A. Skerra, and M. Little. 1995. Bifunctional and multimeric complexes of streptavidin fused to single chain antibodies (scFv). J. Immunol. Methods 178:201-209[Medline].
12. Dulk-Ras, A. D., and P. J. J. Hooykaas. 1995. Electroporation of Agrobacterium tumefaciens. Methods Mol. Biol. 55:63-72[Medline].
13. Evan, G. J., G. K. Lewis, G. Ramsay, and J. M. Bishop. 1985. Isolation of monoclonal antibodies specific for human c-myc proto-oncogene product. Mol. Cell. Biol. 5:3610-3616[Abstract/Free Full Text].
14. Firek, S., J. Draper, M. R. L. Owen, A. Gandecha, B. Cockburn, and G. C. Whitelam. 1993. Secretion of a functional single-chain Fv protein in transgenic tobacco plants and cell suspension cultures. Plant Mol. Biol. 23:861-870[Medline].
15. Fos, A., J. L. Danet, L. Zreik, M. Garnier, and J. M. Bové. 1992. Use of a monoclonal antibody to detect the stolbur mycoplasmalike organism in plants and insects and to identify a vector in France. Plant Dis. 76:1092-1096.
16. Garnier, M., G. Martin-Gros, M. L. Iskra, L. Zreik, J. Gandar, A. Fos, and J. M. Bové. 1990. Monoclonal antibodies against the MLOs associated with tomato stolbur and clover phyllody, p. 263-269. In G. Stanek, G. H. Cassel, J. G. Tully, and R. F. Whitcomb (ed.), Recent advances in mycoplasmology. Fischer Verlag, Stuttgart, Germany.
17. Hiatt, A., R. Cafferkey, and K. Bowdish. 1989. Production of antibodies in transgenic plants. Nature 342:76-78[Medline].
18. Kenny, G. E. 1979. Antigenic determinants, p. 351-380. In M. F. Barile, and S. Razin (ed.), The mycoplasmas, vol. I. Academic Press, Inc., New York, N.Y.
19. Lei, S. P., H. C. Lin, S. S. Wang, J. Callaway, and G. Wilcox. 1987. Characterization of the Erwinia carotovora pelB gene and its product pectate lyase. J. Bacteriol. 169:4379-4383[Abstract/Free Full Text].
20. McCoy, R. E., A. Caudwell, C. J. Chang, T. A. Chen, L. N. Chiykowski, M. T. Cousin, J. L. Dale, G. T. N. deLeeuw, D. A. Golino, K. J. Hackett, B. C. Kirkpatrick, R. Marwitz, H. Petzold, R. C. Sinha, M. Sugiura, R. F. Whitcomb, I. L. Yang, B. M. Zhu, and E. Seemüller. 1989. Plant diseases associated with mycoplasma-like organisms, p. 545-640. In R. F. Whitcomb, and J. G. Tully (ed.), The mycoplasmas, vol. 5. Spiroplasmas, acholeplasmas, and mycoplasmas of plants and arthropods. Academic Press, Inc., New York, N.Y.
21. Orlandi, R., D. H. Gussow, P. T. Jones, and G. Winter. 1989. Cloning immunoglobulin variable domains for expression by the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 86:3833-3837[Abstract/Free Full Text].
22. Rosso, M. N., A. Schouten, J. Roosien, T. Borst-Vrenssen, R. S. Hussey, F. J. Gommers, J. Bakker, A. Schots, and P. Abad. 1996. Expression and functional characterization of a single chain FV antibody directed against secretions involved in plant nématode infection process. Biochem. Biophys. Res. Commun. 220:255-263[Medline].
23. Sambrook, J., E. T. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
24. Schots, A. 1992. "Plantibodies": a flexible approach to design disease resistance. Neth. J. Plant Pathol. 98(Suppl. 2):123.
25. Seemüller, E., B. Schneider, R. Mäurer, U. Ahrens, X. Daire, H. Kison, K. H. Lorenz, and E. Stackebrandt. 1994. Phylogenetic classification of plant-pathogenic mycoplasmas by sequence analysis of 16S rDNA. Int. J. Syst. Bacteriol. 44:440-446[Abstract/Free Full Text].
26. Shi, Y., M. B. Wang, K. S. Powell, E. Van Damme, V. A. Hilder, A. M. R. Gatehouse, D. Boulter, and J. A. Gatehouse. 1994. Use of the rice sucrose synthase-1 promoter to direct phloem-specific expression of beta -glucuronidase and snowdrop lectin genes in transgenic tobacco plants. J. Exp. Bot. 45:623-631[Abstract/Free Full Text].
27. Tavladoraki, P., E. Benvenuto, S. Trinca, D. De Martinis, A. Cattaneo, and P. Galeffi. 1993. Transgenic plants expressing a functional single-chain Fv antibody are specifically protected from virus attack. Nature 366:469-472[Medline].
28. Voss, A., M. Niersback, R. Hain, H. J. Hirsch, Y. C. Liao, F. Kreuzaler, and R. Fischer. 1995. Reduced virus infectivity in N.tabacum secreting a TMV-specific full size antibody. Mol. Breed. 1:39-50.


Applied and Environmental Microbiology, November 1998, p. 4566-4572, Vol. 64, No. 11
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Malembic, S., Saillard, C., Bove, J. M., Garnier, M. (2002). Effect of Polyclonal, Monoclonal, and Recombinant (Single-Chain Variable Fragment) Antibodies on In Vitro Morphology, Growth, and Metabolism of the Phytopathogenic Mollicute Spiroplasma citri. Appl. Environ. Microbiol. 68: 2113-2119 [Abstract] [Full Text]  
  • Swennen, D., Paul, M.-F., Vernis, L., Beckerich, J.-M., Fournier, A., Gaillardin, C. (2002). Secretion of active anti-Ras single-chain Fv antibody by the yeasts Yarrowia lipolytica and Kluyveromyces lactis. Microbiology 148: 41-50 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Le Gall, F.
Right arrow Articles by Garnier, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Le Gall, F.
Right arrow Articles by Garnier, M.
Agricola
Right arrow Articles by Le Gall, F.
Right arrow Articles by Garnier, M.