INTRODUCTION

Top Abstract Introduction Materials & Methods Results & Discussion References

The cell walls of monocotyledonous plants are composed of a variety of macromolecules, including cellulose, arabinoxylan, xyloglucan, pectin, and proteins. One of the major hemicelluloses of the walls of plants in the Poaceae is mixed-linked glucan (also called 1,3-1,4-glucan or -glucan), in which unbranched chains of 1,4-glucose are disrupted by periodic 1,3 linkages at a ratio of about 2:1. Several lines of evidence suggest that this polysaccharide is important for the control of plant cell expansion (4), and therefore it might have a critical role in maintaining the structural integrity of the wall during pathogen attack. Furthermore, the enzymes that degrade cereal mixed-linked glucans have potential medical and industrial significance because such glucans are an important component of soluble fiber in human diets and a major factor affecting the quality of fermented beverages (41).

Enzymes that can degrade mixed-linked glucan are called mixed-linked glucanases (MLGases), 1,3-1,4-glucanases, -glucanases, or lichenases. Some MLGases can also degrade other glucans (for example, 1,3-glucans and 1,4-glucans) (16, 28, 31, 35). Genes encoding MLGases have been cloned from a number of bacteria (31, 35, 38) and higher plants (34, 42). An enzyme with MLGase activity has been purified from the fungus Rhizopus arrhizus (6), but to the best of our knowledge no genes encoding MLGases have previously been isolated from fungi.

Cochliobolus carbonum, an ascomycetous pathogen of maize, penetrates into and ramifies through intact leaves and in the process obtains nutrients for growth from the plant cell cytoplasm and walls. For penetration, ramification, and nutrient assimilation, both as a pathogen and during the saprophytic phase of its life cycle, C. carbonum produces a variety of extracellular enzymes that can degrade the polymers of the plant cell wall, including pectinases, xylanases, 1,3-glucanases, cellulases, -xylosidase, -arabinosidase, and proteases (40).

A common feature of microbial extracellular degradative enzymes is redundancy; that is, most microorganisms make two or more chromatographically separable proteins that have the same or similar enzymatic activities. C. carbonum is no exception to this rule, because it secretes, for example, at least four endo-1,4-xylanases (2) and three proteases (21). Enzymatic redundancy can be due to multiple genes encoding proteins with similar or overlapping enzymatic activities, to alternative RNA processing (3), and/or to different posttranslational modifications. Apparent redundancy can also be caused by artifactual processes, such as partial proteolysis during fermentation or purification. Although difficult to establish by purely biochemical methods, the biogenic relationships between redundant enzymes can be substantially clarified by analyzing microbial strains specifically mutated in one or more of the encoding genes (1, 2, 21, 32).

In this study, we identified and characterized three extracellular enzymes (Mlg1a, Mlg1b, and Mlg2) that degrade -glucan from the filamentous fungus C. carbonum and demonstrated by performing cloning and targeted gene disruption experiments that one gene encodes two of the three MLGases.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results & Discussion References

Fungal culture and maintenance. C. carbonum race 1 strain 367-2A, which is a progeny of strain SB111 (= ATCC 90305), was grown on V8 juice agar plates. For MLGase production, two fungal plugs (5 mm²) were inoculated into a 1,000-ml Erlenmeyer flask containing 125 ml of mineral salts, 0.2% yeast extract, and trace elements (39) and grown in still culture for 9 days at 21 to 23°C. The supplemental carbon sources tested were Country Life maize bran (Country Life Natural Foods, Pullman, Mich.), Mother's Oat Bran cereal, and Quaker Oat Bran cereal (the latter two were obtained from The Quaker Oats Company, Chicago, Ill.). For routine enzyme production, cultures were grown on 1% maize bran plus 0.2% sucrose.

Enzyme assays. Routine glucanase assays were performed by using a reducing sugar assay (18) with barley -glucan (catalog no. G6513; Sigma) as the substrate. Laminarin (catalog no. L9634; Sigma) was used to test for 1,3-glucanase activity, and Avicel PH-101 (catalog no. 11365; Fluka), high-viscosity carboxymethyl cellulose (catalog no. C5013; Sigma), low-viscosity carboxymethyl cellulose (catalog no. C5678; Sigma), -cellulose (catalog no. C8002; Sigma), and microgranular Whatman cellulose were used to examine 1,4-glucanase activities. Most assays were performed by using substrate at a concentration of 0.2%; laminarin was used at a concentration of 0.1%. The substrates were dissolved or suspended in 50 mM sodium acetate buffer (pH 5.0), and most assays were performed at 37°C for 30 min with 10 to 20 µl of enzyme. When cellulosic substrates were used, the assay was performed for 17 h at 37°C. After the reaction mixtures were heated at 100°C for 10 min, 200 µl of each reaction mixture was placed in a 96-well microtiter plate and cooled to 22°C, and the A₄₁₀ was determined with an enzyme-linked immunosorbent assay plate reader (Bio-Tek). One unit of activity was defined as 1 nmol of glucose released per µl of enzyme per min at 37°C.

Protein purification. Concentration and purification of MLGase activities from culture filtrates by using low-pressure DEAE-cellulose chromatography and dialysis were performed by the method of Murphy and Walton (21), except that the 25 mM sodium acetate buffer was adjusted to pH 4.0. Fractionation on a polysulfylethyl aspartamide cation-exchange high-performance liquid chromatography (HPLC) column (The Nest Group, Southboro, Mass.) was accomplished by using a 30-min linear gradient from buffer A (25 mM sodium acetate [pH 4.0]) to buffer B (25 mM sodium acetate [pH 4.0] plus 0.4 M KCl) at a flow rate of 1 ml/min. The peak of UV absorption (at 280 nm) containing Mlg1a and Mlg1b was collected, adjusted to 1.7 M ammonium sulfate, and applied to a hydrophobic-interaction HPLC (HI-HPLC) column (Biogel TSK-Phenyl-5PW; Bio-Rad, Richmond, Calif.) (21). Fractions containing Mlg1a and Mlg1b activities were then individually passed over a gel filtration HPLC column (7.5 by 300 mm; Ultraspherogel SEC3000; Beckman). Purified Mlg1a and Mlg1b were lyophilized and were sequenced directly from the N terminus, as well as after digestion with trypsin and separation of peptides by microbore HPLC, by automated Edman degradation. Mlg2 was purified by using the same methods that were used for Mlg1a and Mlg1b through the HI-HPLC step. The fractions containing Mlg2 activity were then fractionated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (12% acrylamide), transferred to a ProBlot membrane (Applied Biosystems, Foster City, Calif.) (19), stained with 0.1% Coomassie brilliant blue R-250 in 40% methanol, and destained with 50% methanol. Mlg2 was excised from the blot and digested with trypsin. The resulting peptides were separated by HPLC and sequenced by automated Edman degradation.

Nucleic acid manipulations. DNA and RNA were isolated as described by Pitkin et al. (25) and Chomczynski and Sacchi (5), respectively. The methods used for genomic and cDNA library screening, probe labeling, DNA blotting, and hybridization have been described previously (21, 32). Sequencing with gene-specific primers was performed by automated fluorescent sequencing at the Michigan State University Department of Energy Plant Research Laboratory Plant Biochemistry Facility by using an Applied Biosystems model 373A sequencer for analysis of the products. The transcription start site of MLG1 was determined by using an Amplifinder RACE kit (Clonetech, Palo Alto, Calif.) (10). First-strand cDNA synthesis was primed with the reverse complement oligonucleotide GAAGGCGGGCCAAGAGCC (starting at nucleotide 727). PCR primer CGTGCGTGGGATCAGCGATATCTTC (reverse complement) (starting at nucleotide 439) and the anchor primer provided with the RACE kit were used to amplify the 5' end of the MLG1 transcript.

Cloning of MLG1. The PCR conditions used to amplify MLG1 and the protocol used to clone the PCR fragments have been described previously (21). Template DNA that generated the 340-bp product was isolated from phage lysate of a cDNA library prepared from mRNA from C. carbonum grown on maize cell walls (25). Total genomic DNA was used as a template for a reaction that yielded a 460-bp product. PCR primers ATHGAYACNTAYGAYGC and ATRTCDATYTCNCCYTG (H = A, C, or T; Y = C or T; N = any nucleotide; R = A or G; D = A, G, or T), corresponding to the sequences IDTYDA and QGEIDI, respectively, were used at an annealing temperature of 55°C for PCR amplification of a fragment of MLG1. Oligonucleotide sequence AARTTYAAYTTYGARGA, corresponding to amino acid sequence KFNFED, was end labeled (29) and hybridized at 45°C to the PCR products to confirm that a fragment of MLG1 had been amplified. The MLG1 PCR products were cloned into pBluescript II SK+ at the SmaI restriction site and sequenced. A 7.0-kb BamHI MLG1 genomic fragment from a EMBL3 phage that hybridized to the MLG1 cDNA was subcloned into pBluescript II SK+.

Targeted gene disruption of MLG1. The transformation vector was made by digesting an MLG1 cDNA clone, pC4-2.1, with XhoI and SalI to liberate a 345-bp fragment internal to the MLG1 locus, treating the fragment with T4 DNA polymerase, and ligating it into the SmaI restriction site of pHYG1 (36). The resulting vector, pJM5, was linearized at the unique SmaI restriction site and used to transform wild-type C. carbonum 367-2A.

Nucleotide sequence accession number. The nucleotide sequence of MLG1 has been deposited in the GenBank database under accession no. U81606.

	RESULTS AND DISCUSSION

Top Abstract Introduction Materials & Methods Results & Discussion References

Characterization and purification of Mlg1a, Mlg1b, and Mlg2. Several carbon sources were tested for optimal production of extracellular MLGase by C. carbonum. Maize bran was a better inducer than two commercial oat bran products (data not shown). Like endopolygalacturanase, exo-1,3-glucanase, xylanase, -xylosidase, -arabinosidase, and protease production, adding 0.2% sucrose enhanced production of MLGase. Unlike xylanase, exo--1,3-glucanase, or endopolygalacturanase activities, however, some MLGase activity was still produced when C. carbonum was grown on 2% (wt/vol) sucrose as the sole carbon source (data not shown) (21, 27).

View larger version (37K): [in this window] [in a new window]   FIG. 1.   Purification of Mlg1a, Mlg1b, and Mlg2. (A) Cation-exchange chromatography of culture filtrates. (B) HI-HPLC of peak 1 from panel A. (C) HI-HPLC of peak 2 from panel A. Solid lines, A280; dashed lines, MLGase activity.

View larger version (83K): [in this window] [in a new window]   FIG. 2.   Glycosylation of Mlg1a and Mlg1b. (A) Protein blot from SDS-PAGE gel of partially purified Mlg1a and Mlg1b stained with periodic acid-Schiff reagent (37). (B) SDS-PAGE of the samples in panel A stained with Coomassie brilliant blue R-250. Mlg1a and Mlg1b are the bands at 33.5 and 31 kDa, respectively. The positions of the molecular size standards are shown on the left; ovalbumin (45 kDa) is a glycoprotein.

Isolation and characterization of MLG1. Two 96-fold degenerate oligonucleotides based on the amino acid sequences IDTYDA and QGEIDI (Table 1) were used in a PCR to amplify a fragment of the encoding gene. This primer combination yielded a single, 340-bp PCR product when DNA from a C. carbonum cDNA library was used as a template and a single, 460-bp PCR product when C. carbonum genomic DNA was used as a template. To confirm that these PCR products encoded Mlg1b, they were blotted and probed with a third 36-fold degenerate oligonucleotide based on the amino acid sequence KFNFED (Table 1). Both products hybridized to the third oligonucleotide and were therefore cloned and sequenced. Sequencing indicated that the PCR products are identical except for the presence of two introns of 57 and 64 bp in the PCR product amplified from genomic DNA.

View larger version (92K): [in this window] [in a new window]   FIG. 3.   Nucleotide sequence and deduced amino acid sequence of MLG1. Amino acids are indicated below the corresponding codons. The amino acid sequences of the mature N terminus and the internal tryptic peptide are indicated by double underlining. The three introns are indicated by lowercase letters. The SalI, SmaI, and XhoI restriction sites indicated were used to construct and linearize pJM5 for the gene disruption experiments. The transcription start site is indicated by a pound sign, and the polyadenylation site is indicated by a plus sign (the pound and plus signs refer to the nucleotides below them). The predicted N-glycosylation site (amino acid 323) is underlined.

Transformation-mediated gene disruption of MLG1. A 345-bp SalI-XhoI fragment, which is within the open reading frame of MLG1 (Fig. 3), was subcloned into Cochliobolus transformation vector pHYG1. The resulting plasmid, pJM5, was linearized with SmaI and introduced into wild-type C. carbonum 367-2A by transformation of protoplasts. Hygromycin B-resistant transformants were characterized by DNA gel blot analysis. Figure 4A shows the wild-type MLG1 locus, whereas Fig. 4B shows the predicted map for single integration of pJM5 into MLG1. The results of a DNA gel blot analysis of strain T503-4A (Fig. 4C, lanes 3 and 6) are consistent with the pattern predicted for a single insertion event, as shown in Fig. 4B. The pattern of hybridization seen for strain T503-1A (Fig. 4C, lanes 2 and 5) is consistent with tandem integration of the 6-kb pJM5 vector.

View larger version (30K): [in this window] [in a new window]   FIG. 4.   Analysis of the MLG1 locus in the wild type and mlg1 mutants. (A) Restriction map of the wild-type MLG1 locus, showing the location of the MLG1 transcript (shaded box). (B) Predicted restriction map of the MLG1 locus with a single insertion of transforming plasmid pJM5. (C) DNA blot of the wild type (367-2A) and two transformants (T503-1A and T503-4A). Total genomic DNA was digested with BamHI (lanes 1 to 3) or HindIII (lanes 4 to 6), fractionated by agarose gel electrophoresis, blotted, and probed with the MLG1 cDNA C4-2.1. The disappearance of a 7.0-kb BamHI band and a 5.0-kb HindIII band and the appearance of 9.7- and 2.5-kb BamHI bands and 2.1- and 8.5-kb HindIII bands are as predicted from homologous integration of pJM5. The additional bands in digests of T503-1A are as predicted for homologous integration of more than one copy of pJM5. The shaded areas in panels A and B indicate MLG1 sequences. B, BamHI, S, SalI; P, PstI; X, XhoI; Sp, SphI; H, HindIII. HPH indicates the hygromycin resistance gene.

View larger version (33K): [in this window] [in a new window]   FIG. 5.   Analysis of MLGase in the mlg1 mutant. (A and B) Cation-exchange HPLC analysis of MLGase from the wild type (A) and mlg1 mutant T503-1A (B). (C and D) HI-HPLC analysis of peak 1 from cation-exchange HPLC of the wild type (C) and from cation-exchange HPLC of the mlg1 mutant (D). Solid lines, A280; dashed lines, MLGase activity.

Pathogenicity of mlg1 mutants. As the highest amounts of -glucan are in young maize seedlings (4), we tested whether infection of young seedlings by C. carbonum was impeded by mutating MLG1. There were no measurable differences in lesion morphology and development or the percentage of seedlings that germinated when the plants were inoculated with either wild-type strain 367-2A or mlg1 mutant strain T503-1A or T503-4A. The wild type and the mlg1 mutants were also indistinguishable with regard to lesion size, color, and rate of lesion formation when they were spray inoculated onto leaves of 14-day-old maize seedlings. Thus, MLG1 does not by itself make a significant contribution to the virulence of C. carbonum.