TEXT

Top Abstract Text References

Mosquitoes transmit a number of vector-borne tropical diseases, such as malaria, filariasis, and viral encephalitis. They also have developed resistance to most of the chemical pesticides deployed for their control, making existing abatement programs ineffective. Bacillus thuringiensis subsp. israelensis and Bacillus sphaericus are the two potential biological alternatives identified for mosquito control programs (9). During sporulation, B. sphaericus 1593M synthesizes two mosquito larvicidal proteins, of 51 and 42 kDa. These two peptides act together as a binary toxin that has a major role in the overall efficacy of B. sphaericus (4). While the individual peptides of 51 and 42 kDa are nontoxic, when mixed together they exhibit toxicity (4). The genes coding for the binary toxins from a number of highly toxic strains of B. sphaericus have been identified and sequenced (2). A model for the mode of action of these binary toxins has been proposed on the basis of gene deletion and in vivo binding studies. In this model, it has been suggested that an N-terminal region of the 51-kDa peptide binds to the gut epithelial cells while its C-terminal region is essential for the interaction with the N-terminal region of the 42-kDa peptide. This apparently results in internalization of the toxin complex (8, 9). It is not known whether the binary toxin acts as a monomer, oligomer, or multimer.

Site-directed mutagenesis has been employed to generate deletion derivatives of the binary toxin to localize the regions essential for biological activity (2). Further, mutants with deletions of the binary-toxin genes have been generated to study the structure-function relationship of this toxin (8). However, the contribution of individual amino acid residues of the binary toxin to its biological activity is not yet understood. An understanding of the mechanism of action of the binary toxins will greatly aid in enhancing their efficacy as well as preventing the emergence of resistance to these biocontrol agents in mosquitoes (3, 5). In the present study, site-directed mutagenesis was used to further investigate the mode of action of the binary toxin. Alanine residues were substituted for other amino acids located in the N- and C-terminal regions of the binary-toxin subunits, and the effect of these changes on biological activity was assessed.

Bacterial strains and plasmids. Escherichia coli CJ236 and E. coli MV1190 were supplied with the Bio-Rad Muta-Gene M13 in vitro mutagenesis kit. E. coli BL21(DE3) containing a prophage carrying the T7 RNA polymerase gene under the control of the lacUV promoter and the phagemid pRSET A containing the T7 promoter were from Invitrogen. The parental recombinant plasmid (pAR5) containing the binary-toxin genes was from our laboratory (10).

Recloning of binary-toxin genes in the pRSET A vector. A 3.1-kb DNA fragment containing the coding sequences for the binary toxin (open reading frame 1 [ORF1], encoding the 51-kDa toxin of 448 amino acids, and ORF2, encoding the 42-kDa toxin comprising 370 amino acids) was restricted from the parental clone pAR5 with the enzymes KpnI and HindIII. This 3.1-kb fragment was directionally cloned into pRSET A. Of the resulting transformants, one (pSV15) was characterized by restriction and PCR analysis for the presence of the insert (12).

Site-directed mutagenesis of binary-toxin genes. The EMBL accession numbers for the cloned genes encoding the 51- and 42-kDa peptides are XO7992 and Y00528, respectively. An analysis of the secondary structure of the binary toxin was performed for us with the Maxhorm multiple-alignment program (European Molecular Biology Laboratory). On the basis of the secondary-structure analysis and the published results of the deletion studies, we selected 13 sites for mutagenesis. The predicted secondary structures selected for disruption were the alpha helix, beta sheets, and loops. Oligonucleotides were synthesized by DNA Technologies, Lexington, Mass. The mutant oligonucleotide sequences complementary to the native sequences were as follows: 51N4, 5' GTT ATA AAA TTT TTT TGA TAT TTC TGG 3' (bp 104 to 131); 51C2, 5' T AGG ATA CGA TTG TAT ACC TGC CAA 3' (bp 1165 to 1190); 42N2, 5' ATT TTC TCT GCT ACA GAT TTC TGTC 3' (bp 128 to 152); and 42C2, 5' GCC TGT ATA TCT AAC AGG AA 3' (bp 925 to 945). The numbering of nucleotides starts from the initiation codon of the peptide. The underlined sequences were targeted for alanine (CGC) substitution. Site-directed mutagenesis (Muta-Gene M13 in vitro mutagenesis kit; Bio-Rad) was carried out as detailed in the manufacturer's manual. In brief, after complementary-strand synthesis with mutant primers, the DNA mixtures were transformed into E. coli MV1190. The single-stranded M13 DNA from the transformants was extracted and used for DNA sequencing to identify mutant clones. In the regions where mutations were introduced, about 100 to 150 bp upstream of the mutated site was sequenced to confirm the presence of the mutation. DNA sequencing was carried out by the dideoxy method of Sanger et al. (11) in accordance with the manufacturer's instructions (United States Biochemicals, Cleveland, Ohio). The specific primers used for DNA sequencing were 5' CCGAATCAAGAATCGAGG 3' for 51N4, 5' GTTAATTTTAGGTATTAATTC 3' for 51C2, 5' GTTTAAAGCAACCCATGGGAT 3' for 42C2, and 5' GATATCTGATACTACACTTGTGGC 3' for 42N2.

Purification of inclusion bodies from E. coli. The wild-type plasmid (pSV15) and the plasmid carrying the mutant genes were transformed into E. coli BL21(DE3) for expression. The inclusion bodies were purified as described previously (1) and solubilized in 50 mM Na₂CO₃ buffer, pH 9.5. The concentrations of the solubilized proteins were determined by the method of Lowry et al. (7). Solubilized wild-type and mutant toxins (10 µg of protein containing both the 51- and 42-kDa peptides) were used for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot analysis. The antibodies used for Western blot analysis were raised in rabbits against purified crystals of B. sphaericus 1593M.

Bioassay against mosquito larvae. The solubilized wild-type and mutant toxins were assessed for their toxicity against the second-instar larvae of Culex quinquefasciatus and Anopheles stephensi in accordance with a published protocol (6). Briefly, 20 mosquito larvae were added to disposable cups containing 30 ml of sterile distilled water to which different concentrations of proteins derived from different samples were added. Wild-type and mutant toxins were tested individually and in combination. For in vivo complementation studies, larvae were fed with one mutant toxin, and after 4 h, transferred to another cup containing distilled water to which another mutant toxin was added. The mortality rate was calculated after 24 h. Bioassays were carried out in triplicate and repeated more than five times. The 50% lethal concentration was defined and is expressed as the concentration of protein per milliliter of the assay medium that was required to kill 50% of the larval population in 24 h.

View larger version (49K): [in this window] [in a new window]   FIG. 1.   (a) SDS-PAGE analysis of wild-type and mutant binary toxins. Each lane was loaded with 10 µg of protein containing both the 51- and 42-kDa peptides. M, Molecular weight markers. (b) Western blot analysis of wild-type and mutant binary toxins. Binary-toxin peptides (51 and 42 kDa) were detected by immunoblotting with polyclonal antibodies. Lanes: 1, mutant 51N4; 2, mutant 51C2; 3, mutant 42N2; 4, mutant 42C2; 5, wild type.