Previous Article | Next Article 
Appl Environ Microbiol, March 1998, p. 948-954, Vol. 64, No. 3
Department of Plant Pathology, North Carolina
State University, Raleigh, North Carolina 27695
Received 7 August 1997/Accepted 15 December 1997
We have developed a PCR procedure to amplify DNA for quick
identification of the economically important species from each of the
six taxonomic groups in the plant pathogen genus
Phytophthora. This procedure involves amplification
of the 5.8S ribosomal DNA gene and internal transcribed spacers (ITS)
with the ITS primers ITS 5 and ITS 4. Restriction digests of the
amplified DNA products were conducted with the restriction enzymes
RsaI, MspI, and HaeIII. Restriction
fragment patterns were similar after digestions with RsaI
for the following species: P. capsici and
P. citricola; P. infestans,
P. cactorum, and P. mirabilis;
P. fragariae, P. cinnamomi, and
P. megasperma from peach; P. palmivora, P. citrophthora, P. erythroseptica, and P. cryptogea; and
P. megasperma from raspberry and P. sojae. Restriction digests with MspI separated
P. capsici from P. citricola and
separated P. cactorum from P. infestans and P. mirabilis. Restriction digests
with HaeIII separated P. citrophthora
from P. cryptogea, P. cinnamomi from
P. fragariae and P. megasperma on
peach, P. palmivora from P. citrophthora, and P. megasperma on raspberry
from P. sojae. P. infestans and P. mirabilis digests were identical and P. cryptogea and P. erythroseptica digests were
identical with all restriction enzymes tested. A unique DNA sequence
from the ITS region I in P. capsici was used to
develop a primer called PCAP. The PCAP primer was used in PCRs with ITS 1 and amplified only isolates of P. capsici,
P. citricola, and P. citrophthora
and not 13 other species in the genus. Restriction digests with
MspI separated P. capsici from the other
two species. PCR was superior to traditional isolation methods for
detection of P. capsici in infected bell pepper tissue
in field samples. The techniques described will provide a powerful tool
for identification of the major species in the genus
Phytophthora.
Phytophthora
species are responsible for economically important diseases of a wide
range of agronomic and ornamental crops. Species identification for
Phytophthora has traditionally been based upon
microscopic examination of morphological characters and growth
characteristics of the pathogen on specific media (27, 35).
Variations in the morphological characters of both the sexual and
asexual stages of this group of pathogens exist, leading to
difficulties in accurate identification by traditional methods. In
addition, identification based on pathogenicity assays or growth characteristics are time-consuming. Accurate and rapid identification of Phytophthora species in plant material is
important for several reasons. First, in many hosts, such as citrus,
walnut, strawberry, raspberry, potato, and tomato, multiple species of
Phytophthora can infect the plant, and the relative
severity of disease and the plant part infected can vary among pathogen
species (6, 25, 37, 43). Preplant identification of
Phytophthora species can be important for quarantine
purposes and is important for restricting the spread of pathogens in
plant material (23). In addition, accurate diagnosis of the
species of Phytophthora is important in disease
management and control.
Molecular tools including isozyme analysis, restriction fragment length
polymorphisms in nuclear and mitochondrial DNA, randomly amplified
polymorphic DNA PCRs, serological assays, DNA probes, and PCR of
internal transcribed spacer (ITS) regions and nuclear small- and
large-subunit ribosomal DNA (rDNA) have been used to evaluate
intraspecific and interspecific variation in
Phytophthora species (1, 5, 8, 11, 13, 14, 22,
28). Molecular techniques have also been used to study genetic
diversity and evolutionary origins in populations of many different
fungal genera (2). Nucleotide sequences of rRNA genes have
been used in studies of phylogenetic relationships over a wide range of
taxonomic levels with many organisms (2, 9, 31, 41). The
nuclear small-subunit rDNA sequences evolve relatively slowly and are
useful for studying distantly related organisms, whereas the ITS
regions and intergenic region of the nuclear rRNA repeat units evolve
the fastest and may vary among species and populations (41).
Mitochondrial rRNA genes also evolve rapidly and can be useful at the
ordinal or family level (41). The evolutionary lineage of
the oomycetes has been elucidated by sequencing studies with
small-subunit rRNA sequences (9).
We have adopted a quick extraction procedure for DNA and a reliable PCR
technique for amplification of DNA from Phytophthora species. This method is based on procedures developed by Lee and Taylor
(21) and Lee et al. (22) for
Phytophthora species and involves amplification of
the ITS and 5.8S rDNA. We used ITS primers 5 and 4 and PCR to amplify
the entire 5.8S rDNA gene, both ITS regions I and II, and a portion of
the 18S nuclear small-subunit rDNA gene. The amplified DNA was then cut
with a series of restriction enzymes to develop species-specific
restriction fragment patterns for rapid identification of the important
plant-pathogenic Phytophthora species from all the
different taxonomic groups in the genus that infect economically
important hosts (35). In addition, we devised a PCR primer
to specifically amplify P. capsici, an important pathogen of pepper, and used this primer (PCAP) to compare PCR to
traditional isolation methods for identification of the pathogen in
infected pepper tissue from the field.
Culture preparation and PCR methods.
Mycelium of each
Phytophthora species was grown in pea broth. Pea
broth was prepared by autoclaving 120 g of frozen peas in 500 ml
of distilled water for 5 min. The filtrate was brought to 1 liter with
distilled water and autoclaved for 25 min. Multiple cultures of
authenticated isolates from each of the six taxonomic groups in the
genus, including group I, P. cactorum (Lebert & Cohn)
Schroter; group II, P. capsici Leonian, P. citrophthora (R. E. Sm & E. H. Smith), P. nicotianae Breda de Haan (15), P. palmivora (E. Butler); group III, P. citricola
(Saw.); group IV, P. infestans (Mont.) de Bary and
P. mirabilis; group V, P. fragariae
(C. J. Hickman), P. megasperma (Drechs.), and
P. sojae (Hildebr.); and group VI, P. cinnamomi (Rands), P. cryptogea (Pethybr. & Laff.), and P. erythroseptica (Pethybr.), were
collected from researchers (Table 1).
These taxonomic groups are based on growth characteristics of the
pathogen on media, morphological characters of the sexual and asexual
propagules, and cardinal temperatures for growth (35).
Isolates of P. infestans and P. fragariae were grown in pea broth for 1 week at 18 and 20°C,
respectively, while the other species were grown in pea broth for 1 week at 25°C. Mycelium was filtered from the pea broth and frozen in
cryogenic vials at
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
PCR Amplification of Ribosomal DNA for Species Identification
in the Plant Pathogen Genus Phytophthora
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
20°C for subsequent work.
TABLE 1.
Species, plant host, source and designation of isolates
of Phytophthora species used in PCR experiments
20°C after the addition
of 0.1 volume of 3 M sodium acetate (pH 8.0) and 2 volumes of cold
100% ethanol. The supernatant was discarded, and the pellets were
washed with 70% ethanol and then dried by vacuum centrifugation. DNA
was resuspended in 100 µl of TE (10 mM Tris-HCl, 0.1 mM EDTA [pH
8.0]) and then diluted 1:100 for use in PCRs in TE. Extracted DNA was
electrophoresed in 1% agarose gels at 25 mA for 3 h. The gels
were stained for 15 min in ethidium bromide (0.5 µg/ml) and destained
for 15 min in distilled water; alternatively, ethidium bromide was
incorporated directly into the gels at a rate of 0.5 µg/ml. The gels
were photographed under UV light, and digital images were scanned onto
diskettes with a gel scanner (UVP Imagestore 7500).
PCRs were conducted in 50-µl reaction volumes. Each reaction tube
contained approximately 1 µl of a 1-ng/µl DNA template, 5 µl of
10× PCR buffer (Boehringer Mannheim, Indianapolis, Ind.), 36.6 µl of
sterile distilled water, 2 µl (each) of 1.25 mM deoxynucleoside triphosphates (Pharmacia Biotech, Piscataway, N.J.), 2 µl of 10 mM
MgCl2 (Sigma, St. Louis, Mo.), 2 µl each of 10 µM
forward and reverse primers (41), and 0.4 µl of
Taq (5 U/µl; Boehringer Mannheim). Two drops of mineral
oil was placed on the top of each reaction mixture before thermal
cycling. The thermal cycling parameters were initial denaturation at
96°C for 2 min followed by 35 cycles consisting of denaturation at
96°C for 1 min, annealing at 55°C for 1 min, and extension at
72°C for 2 min. A final extension at 72°C for 10 min was done at
the end of the amplification. Negative controls (no DNA template) were
used in every experiment to test for the presence of contamination in
reagents. Separate pipettes fitted with filter pipette tips were used
in a UV-irradiated hood to prepare master mix reagents for PCR. DNA was
pipetted in a separate location with different pipettes.
The ITS primers ITS 5 (5'-GGAAGTAAAAGTCGTAACAAGG) and ITS 4 (5'-TCCTCCGCTTATTGATATGC) (41) amplify the ITS
region I between the 18S and 5.8S rDNAs, the 5.8S rDNA, the ITS region
II, and a portion of the 28S rDNA. In the first experiments with
P. infestans, we used the three primer pairs ITS 5 and
ITS 4, ITS 5 and ITS 2 (5' GCTGCGTTCTTCATCGATGC), and ITS 3 (5'-GCATCGATGAAGAACGCAGC) and ITS 4. All the primer
sequences are written 5' to 3'. Odd-numbered primers are 5'-to-3'
primers, and even-numbered primers are 3'-to-5' primers. ITS region I
between the 18S rDNA and the 5.8S rDNA is flanked by ITS 5 and ITS 2 (41). ITS region II between the 5.8S rDNA and the 28S rDNA
is flanked by ITS 3 and ITS 4 (41). In subsequent
experiments, primers ITS 4 and ITS 5 were used with all the
Phytophthora species.
Amplified fragments were digested with the restriction enzymes
RsaI, HaeIII, and/or MspI. Restriction
digests consisted of 3 µl of enzyme mixture (1 µl of REact buffer
[Gibco BRL, Gaithersburg, Md.], 1 µl of restriction enzyme, and
8 µl of sterile distilled water) and 30 µl of amplified PCR
product. DNA was digested at 37°C for 1.5 h and then at 65°C
for 10 min. Digested DNA was electrophoresed on a 2% agarose gel at 25 mA for 3 h. The gels were stained in ethidium bromide (0.5 µg/ml) to visualize polymorphisms in amplified DNA fragments. The
sizes of the restriction fragments of all the species were measured
directly from the same gels and compared to standards ladders. Fragment
sizes in base pairs were calculated with the shareware program SEQAID
II (32). Representative restriction fragment patterns of
individual isolates are shown in the figures; however, all the isolates
in Table 1 were tested in individual experiments.
Development of a P. capsici-specific primer. DNA from two isolates of P. capsici (B1HB14 and B2HH4) was amplified with PCR primers ITS 1 (5'-TCCGTAGGTGAACCTGCGG) and ITS 4. The amplified DNA was cleaned with a Gene Clean kit (Bio 101, Vista, Calif.) by standard procedures. DNA from the two isolates was subjected to automated DNA sequencing on a Perkin-Elmer DNA sequencer at the Iowa State University DNA Sequencing Facility (Ames, Iowa). The DNA sequences were aligned with published sequences from five other Phytophthora species (21) by using the sequence alignment program CLUSTAL (18). Regions of dissimilarity in the ITS region I were used to design and construct a primer specific for P. capsici, called the PCAP primer. The best sequence for the PCAP primer was 5'-TAATCAGTTTTGTGAAATGG. This sequence was published by Lee and Taylor (22) and was developed as an oligonucleotide probe for P. capsici. The PCAP primer was paired with primer ITS 1 and tested with 38 isolates of P. capsici obtained from a variety of vegetable hosts including pepper, tomato, pumpkin, squash, and cucumber (Table 1). The PCAP primer was also tested on isolates comprising 13 different species of Phytophthora (Table 1) in PCRs as described above.
PCR detection in plant tissue. Field samples of bell pepper that either were asymptomatic, contained visible lesions, or were dead from infections caused by P. capsici were sampled from field plots in 1995. The lesions were cut in half to compare recovery after culture on isolation media to the PCR method. The tissue was surface disinfested in 0.05% sodium hypochlorite and plated on a semiselective medium for isolation of the pathogen (20). For PCR, a portion of the remaining lesion (10 mg) was lysed with 0.5 N NaOH (10 µl/mg), and then 5 µl was diluted immediately in 495 µl of 100 mM Tris buffer (pH 8.0) (39). A 1-µl volume of this extract was used as the DNA template for PCR with the PCAP and ITS 1 primers. Twenty-five plants from each symptom category were sampled, and the PCR experiments were repeated twice.
Nucleotide sequence accession numbers. The complete ITS sequences of the two pepper isolates of P. capsici have been submitted to the GenBank at the National Center for Biotechnology Information (accession no. AF007021 and AF007022).
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
DNA extracted from P. infestans was amplified with ITS primer pairs ITS 5/2, ITS 5/4, and ITS 3/4 (Fig. 1). Pythium ultimum, a related oomycete in a different genus, was amplified for comparison (Fig. 1, lanes 4, 8, and 12). PCR amplification of P. infestans with ITS primers 5/2, 5/4, and 3/4 yielded an estimated 363-bp product, a 946-bp product, and a 612-bp product, respectively. PCR amplification of P. ultimum with ITS primers 5/4 and 3/4 yielded slightly larger products than did amplification of P. infestans, whereas amplification of P. ultimum with ITS 5/2 yielded a similar-size product (Fig. 1).
|
P. infestans ITS DNA was digested with a panel of restriction enzymes. Restriction analysis of ITS DNA and 5.8S rDNA from P. infestans amplified with primer pairs ITS 5/2, ITS 5/4, and ITS 3/4 was conducted. Restriction digests with BstNI, HhaI, HinfI, RsaI, PstI, and HaeIII were done. None of the enzymes tested digested the 363-bp product from P. infestans, but RsaI cut the larger 946-bp product into smaller fragments approximately 433, 286, 100, and 79 bp in length. Restriction sites for enzymes BstNI, HhaI, and HinfI were also found in the amplified 946-bp fragment and the 612-bp fragment.
Amplified rDNA from isolates of P. cactorum from taxonomic group I was digested with RsaI, MspI, and HaeIII. Four restriction fragments were observed in P. cactorum after digestion with RsaI (Fig. 2, lane 2; Table 2). The restriction fragment pattern for P. cactorum was identical to the patterns observed for P. infestans and P. mirabilis (Fig. 3, lanes 2 to 4). MspI digests of amplified DNA distinguished P. cactorum (Fig. 4, lane 2; Table 3) from P. infestans and P. mirabilis (Fig. 4, lanes 3 and 4; Table 3). P. infestans and P. mirabilis had identical restriction fragment patterns when digested with MspI (Fig. 4, lanes 3 and 4). Restriction sites for HaeIII were not found in amplified DNA from P. infestans and P. mirabilis, but two fragments of approximately 717 and 189 bp were observed in digested rDNA of P. cactorum (Table 3).
|
|
|
|
|
Restriction fragment patterns were similar between all taxonomic group II isolates of P. capsici tested (Fig. 2, lane 3; Table 1) and taxonomic group III isolates of P. citricola (Fig. 2, lane 10). Since P. capsici and P. citricola had similar restriction fragment patterns in this amplified region of DNA, further digests with other restriction enzymes were done. Isolates of P. capsici were differentiated from isolates of P. citricola after digestion with MspI (Fig. 4, lanes 5 and 6; Table 3). In contrast, taxonomic group II isolates of P. citrophthora from citrus (Fig. 2, lane 4; Table 2) had different restriction fragment length patterns from P. capsici and P. citricola after digestion with RsaI (Fig. 2, lanes 3 and 10). Only one isolate of P. citrophthora from walnut was tested in our study (lane 5), and it had a slightly different restriction fragment pattern from the citrus isolates of P. citrophthora (lane 4). Other isolates from walnut need to be tested to confirm or refute this restriction fragment pattern for the walnut P. citrophthora.
Isolates of P. nicotianae (formerly P. parasitica) from tobacco, tomato, walnut, boxwood, vinca, rhododendron, azalea, and citrus are classified into taxonomic group II (Table 1). All isolates of P. nicotianae tested had the same restriction fragment patterns in this amplified region of ITS and 5.8S rDNA, and four fragments were visible after restriction digestion with RsaI (Fig. 2, lanes 6 to 8; Tables 1 and 2).
P. palmivora from citrus (Fig. 2, lane 9) had a similar restriction fragment pattern to P. citrophthora from citrus (lane 4) when digested with RsaI but had a different pattern from isolates of P. nicotianae from citrus (lane 6). P. palmivora could be distinguished from P. citrophthora after digestion with HaeIII (Fig. 5, lanes 2 and 5; Table 3). P. palmivora was not digested by HaeIII, but P. citrophthora was digested (Fig. 5, lanes 2 and 5; Table 3).
|
All taxonomic group IV isolates of P. infestans from potato and tomato showed the same restriction fragment pattern after digestion with RsaI (Fig. 3, lanes 2 and 3). Four fragments were observed, and the restriction patterns were identical to those of P. mirabilis (Fig. 3, lane 4; Table 2). In contrast, P. erythroseptica, which causes pink rot of potato, gave a restriction fragment pattern different from that of P. infestans in this amplified region when digested with RsaI (Fig. 3, lane 11; Table 2).
All isolates of P. fragariae (taxonomic group V) from strawberry had identical restriction fragment patterns when amplified DNA was digested with RsaI and yielded four fragments (Fig. 3, lane 5). Variation in the restriction fragment patterns was observed within the group of isolates identified as P. megasperma. Isolates of P. megasperma from raspberry (Fig. 3, lane 6), apricot, and cherry had the same restriction fragment patterns when digested with RsaI (Tables 1 and 2). However, the putative isolates of P. megasperma from peach (Fig. 3, lane 7) and walnut (not shown) had restriction fragment patterns similar to P. fragariae (lane 5) and P. cinnamomi (lane 9) after digestion with RsaI. P. sojae isolates from soybean (lane 8) had identical restriction fragment patterns to P. megasperma from raspberry, apricot, and cherry when digested with RsaI (Fig. 3, lane 6; Table 2). However, restriction digestion with HaeIII separated these two species (Fig. 5, lanes 8 and 9; Table 3).
All the isolates of P. cinnamomi (taxonomic group VI) from a variety of hosts including rhododendron, fraser fir, camellia, shore juniper, and leucothe (Table 1) had similar restriction fragment patterns when digested with RsaI and yielded four fragments (Fig. 3, lane 9; Table 2). These bands were similar in size to the restriction fragments observed when DNA from P. fragariae and P. megasperma from peach were digested with RsaI (Fig. 3, lanes 5 and 7; Table 2). Digestion of amplified DNA with HaeIII differentiated P. cinnamomi from P. fragariae (Fig. 5, lanes 6 and 7). Both P. cryptogea isolates from safflower had the same restriction fragment patterns when digested with RsaI and yielded three fragments (Fig. 3, lanes 10). These restriction fragments were similar to those of RsaI-digested P. citrophthora (Fig. 2, lane 4) and P. erythroseptica (Fig. 3, lane 11). However, digestion of amplified DNA with HaeIII differentiated isolates of P. cryptogea and P. erythroseptica (Fig. 5, lanes 3 and 4; Table 3) from P. citrophthora (Fig. 5, lane 5). P. erythroseptica and P. cryptogea had the same restriction fragment patterns after digestion with HaeIII, and we were unable to distinguish between these two species with the range of restriction enzymes tested.
Development of the PCAP primer. The PCAP primer amplified an approximately 172-bp fragment of DNA in all isolates of P. capsici tested from a range of hosts (Fig. 6, lanes 2 to 9 and 12; Table 1). The primer also amplified a similar-size fragment in isolates of P. citricola (Fig. 6, lane 11). Isolates of P. citrophthora were also amplified by the PCAP primer, but the amplified product was larger than that of P. capsici or P. citricola (lane 10). Digestions of the 172-bp fragment with MspI differentiated P. capsici from P. citrophthora and P. citricola, which were not digested by this enzyme (Fig. 7). Apparently two different PCR products, both approximately 172 bp in size, were amplified by the PCAP and ITS 1 primer pair. Restriction digestion with MspI yielded a 172-bp product and several smaller products in isolates of P. capsici (Fig. 7, lanes 2 to 9 and 12). P. capsici and P. citricola can also be differentiated by restriction digestion of ITS DNA with MspI (Fig. 4, lanes 5 and 6; Table 3). None of the other species of Phytophthora tested, including P. cactorum, P. palmivora, P. nicotianae, P. infestans, P. mirabilis, P. fragariae, P. sojae, P. megasperma, P. cinnamomi, P. cryptogea, and P. erythroseptica, were amplified with the PCAP primer.
|
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Species identification in the genus Phytophthora is difficult and requires the use of taxonomic keys and knowledge of the host range of the pathogen. The PCR procedures we describe in this work will provide a powerful tool for plant disease diagnosticians and researchers who are interested in the identification of many of the major species in the genus. Currently, the taxonomic key of Stamps et al. (35), which is based on earlier work by Waterhouse (40), is the standard reference for identification of pathogens in the genus Phytophthora by classical methods. The tabular key divides the genus into six morphological groups based on characteristics of the sporangia, gametangia, growth at specific temperatures, and culture characters. We analyzed restriction fragment patterns of amplified ITS DNA from a sample of many isolates from each of six morphological groups described previously (35).
Based on morphological characteristics, isolates of P. capsici and P. citricola are placed in taxonomic groups II and III; however, these two species had common restriction fragment patterns when digested with RsaI. The PCAP primer also amplified P. capsici, P. citricola, and P. citrophthora, indicating that there is sequence homology in the spacer I region between the 18S and 5.8S rDNA among these three species from taxonomic groups II and III. Forster et al. (11) and Cooke and Duncan (3) sequenced the ITS region I of DNA in a large number of Phytophthora species and identified a cluster among isolates of P. capsici, P. citricola, and P. citrophthora isolates. In addition, isozyme, mitochondrial DNA restriction fragment length polymorphism, and ITS DNA sequence studies have demonstrated close relationships among these three species (8, 21, 29). Lee and Taylor (21) analyzed ITS variability in several Phytophthora species, and their data support a close relationship between cacao isolates of P. capsici and P. citrophthora (21). The PCR primer developed by Ersek et al. (5) for P. citrophthora also amplified DNA of P. capsici. These three species have papillate or semipapillate sporangia. Our data and the data of others support the phylogenetic grouping of P. capsici, P. citricola, and P. citrophthora into a distinct cluster (3, 11).
Isolates of P. nicotianae tested from citrus, tomato, tobacco, and many ornamental plants were genetically similar after restriction digests with RsaI in this amplified region of ITS DNA. Restriction fragment length polymorphism analysis of genomic DNA of this species indicated little variation among tobacco and citrus isolates (30). Hall (15) redescribed this species as a single species and suggested elimination of the forma specialis designations after extensive testing of 31 morphological, physiological, and biochemical characters (15). We did not test the host pathogenicity or physiological and biochemical traits of isolates in our work, but our data indicate little genetic variation among the isolates we tested.
P. fragariae, P. cactorum, P. nicotianae, and P. citricola are pathogens of strawberry plants in the United States (6, 24). These pathogens can be transported in infected propagation material and introduced into fields. P. fragariae, P. cactorum, P. nicotianae, and P. citricola are from four different taxonomic groups (V, I, II, and III, respectively) but can be easily distinguished after digestion of amplified ITS DNA with RsaI. In addition, the PINF primer we developed in related work for the potato and tomato late blight pathogen P. infestans also amplifies P. cactorum (38), and the PCAP primer described in our present work for P. capsici amplifies P. citricola. Primer sequences which amplify P. fragariae isolates from strawberry, P. fragariae var. rubi from raspberry, and P. nicotianae have been reported (4, 5, 33, 34). Both specific and universal PCR primers could be used to screen plant material and improve the detection of all the major Phytophthora pathogens of strawberry. Strawberry plants are vegetatively propagated, and Phytophthora species can spread readily in infected plant material.
A number of Phytophthora species, including P. nicotianae, P. citrophthora, P. palmivora, P. citricola, P. syringae, and P. hibernalis, infect citrus (14, 42). Four of these six species were examined in this study. P. nicotianae and P. citrophthora are the two most common species on citrus, and they were easily distinguished after restriction digestion with RsaI. P. citrophthora and P. nicotianae both cause gummosis and root rot of citrus, but P. citrophthora is more active in the fruit and aerial plant parts than P. nicotianae. The incidence of brown rot on fruit caused by P. palmivora has increased in recent years in Florida (14a).
There was variation in restriction fragment patterns of ITS DNA among the group V isolates of P. megasperma. Variation within this species has also been noted by others (7, 10, 11, 16, 17, 30, 43). The host-specialized form species of isolates that infect legumes within P. megasperma have been given species designations and include P. sojae, P. medicaginis, and P. trifolii (17). However, the isolates of P. megasperma from woody hosts were placed into the broad-host-range (BHR) lineage and separated into electrophoretic types BHR, AC, and DF karyotypes (16, 17). Sequence differences in the ITS spacer I region indicate that the pathogens in this BHR group do not represent a single biological species (11). In our work, two isolates of P. megasperma from peach and walnut had restriction patterns that differed from the other isolates from raspberry, apricot, and cherry. One of these isolates from peach (NY 412) was studied previously by others and is the A/C electrophoretic type sensu Hansen et al. (17, 42a). This isolate is in a morphologically, culturally, and electrophoretically distinct group that has been referred to as the small-oospore, high-temperature type group of P. megasperma (44). Further work must be done with a larger number of isolates of P. megasperma from the woody-host group to further delineate fruit tree isolates. Separate species designations for the fruit tree isolates are probably warranted, as has been done with the legume isolates (7), to clarify the taxonomy of Phytophthora megasperma.
P. infestans, P. mirabilis, and P. cactorum had identical restriction fragment patterns when their ITS DNA was digested with RsaI. These three species also yielded an identical product when amplified with the PINF primer (38). Others also developed a PCR primer that amplifies both P. infestans and P. mirabilis and found similarities in the ITS region II between these species (36, 37). P. cactorum can be easily differentiated from P. infestans after restriction digests with MspI. The ITS region I DNA sequences of P. cactorum and P. infestans were similar, and these species also formed a cluster in phylogenetic analysis (3, 11). In our work, P. mirabilis and P. infestans were not distinguishable after restriction digestion with a number of enzymes including RsaI, MspI, EcoRI, and HaeIII. These data suggest that the two species have considerable sequence homology in this region of ITS DNA. P. mirabilis was first described as a new species on Mirabilis jalapa in Mexico in 1985 (12). Other authors have suggested that P. mirabilis should be called a forma specialis of P. infestans (26). P. infestans and P. mirabilis have similar mitochondrial DNA restriction patterns (26). An oligonucleotide probe, pL121-3, was developed to differentiate P. mirabilis from P. infestans, but the reaction of the probe with other potato pathogens was not examined (26). We have not yet sequenced the ITS DNA of P. mirabilis, but our data also suggest that two species designations may be unwarranted.
It is evident from our work and that of others (3, 11, 28, 29) that the morphological differentiations of the major species of Phytophthora do not necessarily represent genetic differences among the species. Isolates with divergent sporangial characters, temperature requirements, and hosts have sequence homology in their ITS DNA. The isolates used in our present study were well characterized by morphological criteria before the advent of PCR. Identification by classical methods requires expertise and is time-consuming. The molecular methods we describe will provide useful and rapid tools for identification of the economically important species within this plant-pathogenic genus.
| |
ACKNOWLEDGMENTS |
|---|
This work was funded in part by a research experience for undergraduates (REU) supplemental grant from the National Science Foundation (M. Madritch) and in part by a USDA National Research Initiatives Competitive Grant.
J.B.R. is grateful to Dina St. Clair, University of California, Davis, and David Francis, Ohio State University, Wooster, for sharing techniques, intellectual expertise, and enthusiasm during a visit in November 1994 of the senior author to UC Davis. Appreciation is also expressed to Michael Benson, Barbara Christ, John Duniway, William Fry, Jim Graham, John Menge, Robert Milholland, John Mircetich, David Shew, Paul Shoemaker, Greg Weidemann, Wayne Wilcox, and X. B. Yang and former graduate student Dawn Fraser for generously providing cultures of the Phytophthora species used in this work. The assistance of former graduate student Ronald French with PCR work with P. capsici and discussions with Lee Campbell and Marcia Gumpertz on sampling strategies are also acknowledged.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Box 7616, Department of Plant Pathology, North Carolina State University, Raleigh, NC 27695. Phone: (919) 515-3257. Fax: (919) 515-7716. E-mail: Jean_Ristaino{at}ncsu.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
| 1. | Benson, D. M. 1991. Detection of Phytophthora cinnamomi in azalea with commercial serological assay kits. Plant Dis. 75:478-482. |
| 2. | Bruns, T. D., T. J. White, and J. W. Taylor. 1991. Fungal molecular systematics. Annu. Rev. Ecol. Syst. 22:525-564. |
| 3. | Cooke, D. E. L., and J. M. Duncan. 1997. Phylogenetic analysis of Phytophthora species based on ITS 1 and 2 sequences of the rDNA gene repeat. Mycol. Res. 101:667-677. |
| 4. | Duncan, J. 1995. . Fungal and bacterial diseases. Report of the Scottish Crops research Institute, Dundee, Scotland. |
| 5. |
Ersek, T.,
J. E. Schoeltz, and J. T. English.
1994.
PCR amplification of species-specific DNA sequences can distinguish among Phytophthora species.
Appl. Environ. Microbiol.
60:2616-2621 |
| 6. | Farr, D. F., G. F. Bill, G. P. Chamuris, and A. Y. Rossman. 1989. . Fungi on plants and plant products in the United States. American Phytopathological Society Press, St. Paul, Minn. |
| 7. | Forster, H., T. G. Kinscherf, S. A. Leong, and D. P. Maxwell. 1989. Restriction fragment length polymorphism of the mitochondrial DNA of Phytophthora megasperma isolated from soybean, alfalfa, and fruit trees. Can. J. Bot. 67:529-537. |
| 8. | Forster, H., P. Oudemans, and M. D. Coffey. 1990. Mitochondrial and nuclear DNA diversity within six species of Phytophthora. Exp. Mycol. 14:18-31. |
| 9. | Forster, H., M. Coffey, H. Elwood, and M. L. Sogin. 1990. Sequence analysis of the small subunit ribosomal RNA's of three zoosporic fungi and implications for fungal evolution. Mycologia 82:306-312. |
| 10. | Forster, H., and M. D. Coffey. 1993. Molecular taxonomy of Phytophthora megasperma based on mitochondrial and nuclear DNA polymorphisms. Mycol. Res. 97:1101-1112. |
| 11. | Forster, H., G. Learn, and M. D. Coffey. 1995. Towards a better understanding of the evolutionary history of the species of the genus Phytophthora using isozymes, DNA RFLP's, and rDNA spacer sequences, p. 42-54. In L. J. Dowley, E. Bannon, L. R. Cooke, T. Keane, and E. O'Sullivan (ed.), Phytophthora 150. European Association for Potato Research. Boole, Ltd., Dublin, Ireland. |
| 12. | Galindo, A. J., and H. R. Hohl. 1985. Phytophthora mirabilis a new species of Phytophthora. Sydowia 38:87-96. |
| 13. | Goodwin, P. H., B. C. Kirkpatrick, and J. M. Duniway. 1989. Cloned DNA probes for identification of P. parasitica. Phytopathology 79:716-721. |
| 14. |
Goodwin, P. H.,
B. C. Kirkpatrick, and J. M. Duniway.
1990.
Identification of Phytophthora citrophthora with cloned DNA probes.
Appl. Environ. Microbiol.
56:669-674 |
| 14a. | Graham, J. Personal communication. |
| 15. | Hall, G. 1993. An integrated approach to the analysis of variation in Phytophthora nicotianae and a redescription of the species. Mycol. Res. 97:559-574. |
| 16. | Hansen, E. M., C. M. Braiser, D. S. Shaw, and P. B. Hamm. 1986. The taxonomic structure of Phytophthora megasperma: evidence for emerging biological species groups. Trans. Br. Mycol. Soc. 87:557-573. |
| 17. | Hansen, E. M., and D. P. Maxwell. 1991. Species of the Phytophthora megasperma complex. Mycologia 83:376-381. |
| 18. |
Higgins, D. G., and P. M. Sharp.
1989.
Fast and sensitive multiple sequence alignments on a microcomputer.
CABIOS
5:151-153.
|
| 19. | Innis, M. A., D. H. Gelfand, J. J. Sninsky, and T. J. White. 1990. . PCR protocols: a guide to methods and applications. Academic Press, Inc., New York, N.Y. |
| 20. | Kannwischer, M. E., and D. J. Mitchell. 1978. The influence of a fungicide on the epidemiology of black shank of tobacco. Phytopathology 68:1760-1765. |
| 21. | Lee, S. B., and J. W. Taylor. 1992. Phylogeny of five fungus-like protoctistan Phytophthora species, inferred from internal transcribed spacers of ribosomal DNA. Mol. Biol. Evol. 9:636-653[Abstract]. |
| 22. | Lee, S. B., T. J. White, and J. W. Taylor. 1993. Detection of Phytophthora species by oligonucleotide hybridization to amplified ribosomal DNA spacers. Phytopathology 83:177-181. |
| 23. | MacDonald, J. D., J. Stites, and J. Kabashima. 1990. Comparison of serological and culture plate methods for detection of Phytophthora species. Plant Dis. 74:655-659. |
| 24. | Milholland, R. D. 1994. . A monograph of Phytophthora fragariae and the red stele disease of strawberry. North Carolina Agricultural Research Service technical bulletin 306. North Carolina Agricultural Research Service, Raleigh. |
| 25. | Mircetich, S. M., G. T. Browne, W. Krueger, and W. Schreader. 1985. Phytophthora species isolated from surface water irrigation sources in California. Phytopathology 75:1346-1347. |
| 26. | Moller, E. M., A. W. A. M. De Cock, and H. H. Prell. 1993. Mitochondrial and nuclear DNA restriction enzyme analysis of the closely related Phytophthora species, P. infestans, P. mirabilis, and P. phaseoli. J. Phytopathol. 139:309-321. |
| 27. | Newhook, F. J., G. M. Waterhouse, and O. J. Stamps. 1976. Tabular key to the species of Phytophthora. Mycotaxon 32:199-217. |
| 28. | Oudemans, P., and M. D. Coffey. 1991. A revised systematics of twelve papillate Phytophthora species based on isozyme analysis. Mycol. Res. 95:1025-1046. |
| 29. | Oudemans, P., H. Forster, and M. D. Coffey. 1994. Evidence for distinct isozyme subgroups within Phytophthora citricola and close relationships with P. capsici and P. citrophthora. Mycol. Res. 98:189-199. |
| 30. | Panabieres, F., A. Marais, F. Trentin, P. Bonnet, and P. Ricci. 1989. Repetitive DNA polymorphism analysis as a tool for identifying Phytophthora species. Phytopathology 79:1105-1109. |
| 31. | Redecker, D., H. Thierfelder, C. Walker, and D. Werner. 1997. Restriction analysis of PCR-amplified internal transcribed spacers of ribosomal DNA as a tool for species identification in different genera of the order Glomales. Appl. Environ. Microbiol. 63:1756-1761[Abstract]. |
| 32. | Rhodes, D. D., and D. J. Roufa. 1989. . SEQAID II. University of Kansas, Manhattan. |
| 33. | Stammler, G., and E. Seemuller. 1993. Specific and sensitive detection of Phytophthora fragariae var. rubi in raspberry roots by PCR amplification. J. Plant Dis. Prot. 100:394-400. |
| 34. | Stammler, G., E. Seemuller, and J. M. Duncan. 1993. Taxonomic characterization of Phytophthora fragariae by DNA hybridization and restriction fragment length polymorphism analysis. Mycol. Res. 97:150-156. |
| 35. | Stamps, D. J., G. M. Waterhouse, F. J. Newhook, and G. S. Hall. 1990. . Revised tabular key to the species of Phytophthora. Mycology papers no. 162. C.A.B. International Mycological Institute, Egham, England. |
| 36. | Tooley, P. W., M. M. Carras, and K. F. Falkenstein. 1996. Relationships among group IV Phytophthora species inferred by restriction analysis of ITS 2 region. J. Phytopathol. 144:363-369. |
| 37. | Tooley, P. W., B. A. Bunyard, M. M. Carras, and E. Hatziloukas. 1997. Development of PCR primers from internal transcribed spacer region 2 for detection of Phytophthora species infecting potatoes. Appl. Environ. Microbiol. 63:1467-1475[Abstract]. |
| 38. | Trout, C. L., J. B. Ristaino, M. Madritch, and T. Wangsoomboondee. 1997. Rapid detection of Phytophthora infestans in late blight infected potatoes and tomatoes using PCR. Plant Dis. 81:1042-1048. |
| 39. |
Wang, H.,
M. Qi, and A. J. Cutler.
1993.
A simple method of preparing plant samples for PCR.
Nucleic Acids Res.
21:4153-4154 |
| 40. | Waterhouse, G. M. 1963. . Key to the species of Phytophthora de Bary. Mycological Papers 92. Commonwealth Mycological Institute, Kew, Surrey, England. |
| 41. | White, T. J., T. Bruns, S. Lee, and J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p. 315-322. In M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols: a guide to methods and applications. Academic Press, Inc., New York, N.Y. |
| 42. | Whiteside, J. O., S. M Garnsey, and L. W. Timmer. 1988. . Compendium of citrus diseases. American Phytopathological Society Press, St. Paul, Minn. |
| 42a. | Wilcox, W. F. Personal communication. |
| 43. | Wilcox, W. F. 1989. Identity, virulence and isolation frequency of seven Phytophthora species causing root rot of raspberry in New York. Phytopathology 79:93-101. |
| 44. | Wilcox, W. F., and J. Mircetich. 1987. Lack of host specificity among isolates of P. megasperma. Phytopathology 77:1132-1137. |
Appl Environ Microbiol, March 1998, p. 948-954, Vol. 64, No. 3
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Tambong, J. T., de Cock, A. W. A. M., Tinker, N. A., Levesque, C. A.
(2006). Oligonucleotide Array for Identification and Detection of Pythium Species. Appl. Environ. Microbiol.
72: 2691-2706
[Abstract] [Full Text] -
Hacker, C. V., Brasier, C. M., Buck, K. W.
(2005). A double-stranded RNA from a Phytophthora species is related to the plant endornaviruses and contains a putative UDP glycosyltransferase gene. J. Gen. Virol.
86: 1561-1570
[Abstract] [Full Text] -
Gonzalez, P., Labarère, J.
(1998). Sequence and Secondary Structure of the Mitochondrial Small-Subunit rRNA V4, V6, and V9 Domains Reveal Highly Species-Specific Variations within the Genus Agrocybe. Appl. Environ. Microbiol.
64: 4149-4160
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»