Previous Article | Next Article ![]()
Appl Environ Microbiol, April 1998, p. 1308-1312, Vol. 64, No. 4
Unité de Bioénergétique et
Ingéniérie des Protéines, IFRC1, Centre National
de la Recherche Scientifique, 13402 Marseilles Cedex 20, France
Received 13 October 1997/Accepted 5 February 1998
Multiheme cytochrome c proteins that belong to class
III have been recently shown to exhibit a metal reductase
activity, which could be of great environmental interest, especially in
metal bioremediation. To get a better understanding of these
activities, the gene encoding cytochrome c7
from the sulfur-reducing bacterium Desulfuromonas
acetoxidans was cloned from genomic DNA by PCR and expressed in
Desulfovibrio desulfuricans G201. The expression system was
based on the cyc transcription unit from
Desulfovibrio vulgaris Hildenborough and led to the
synthesis of holocytochrome c7 when transferred
by electrotransformation into the sulfate reducer
Desulfovibrio desulfuricans G201. The produced cytochrome was indistinguishable from the protein purified from
Desulfuromonas acetoxidans cells with respect to several
biochemical and biophysical criteria and exhibited the same metal
reductase activities as determined from electrochemical experiments.
This suggests that the molecule was correctly folded in the host
organism. Desulfovibrio desulfuricans produces functional
multiheme c-type cytochromes from bacteria belonging to
a different genus and may be considered a suitable host for the
heterologous biogenesis of multiheme c-type cytochromes for
either structural or engineering studies. This report, which
presents the first example of the transformation of a
Desulfovibrio desulfuricans strain by
electrotransformation, describes work that is the first necessary step
of a protein engineering program that aims to specify the structural
features that are responsible for the metal reductase activities of
multiheme cytochrome c7.
Sulfate- and sulfur-reducing
bacteria have an important influence on the geochemistry of sedimentary
environments and are of a great environmental interest as they are
involved in the reductive precipitation of highly toxic metals
(14, 15). Their enzymatic reduction ability may be a useful
tool for the bioremediation of waters and soils contaminated by heavy
metals. A more precise analysis of this phenomenon revealed the role of
the polyhemic cytochromes such as tetraheme cytochrome
c3, which is able to catalyze the reductive
precipitation of either U(VI) or Cr(VI) (16, 17). The
sulfur-reducing bacterium Desulfuromonas acetoxidans is
capable of Fe(III) and Mn(IV) reductions (22).
Interestingly, Desulfuromonas acetoxidans contains several
multiheme cytochromes, the most abundant being the triheme cytochrome
c7 (1, 7). The solution structure of
this triheme cytochrome, determined by nuclear magnetic resonance
testing, shows that the orientation of the three heme groups is similar
to that of three of four hemes of cytochrome c3,
the heme corresponding to heme 2 in cytochrome c3 being deleted in cytochrome
c7 (4). The three heme groups have
negative oxidoreduction potentials ranging from In the present paper, we report the cloning of the gene
encoding Desulfuromonas acetoxidans cytochrome
c7. We have also constructed a new
expression vector based on the sequence of the cyc
gene encoding D. vulgaris Hildenborough cytochrome
c3 (26) allowing the heterologous
production of holocytochrome c7 in D. desulfuricans. The biochemical properties and metal reductase
activities of recombinant cytochrome c7 have
been analyzed.
Strains, vectors, and media.
The bacterial strains and
plasmids used are described in Table 1.
Growth of Escherichia coli strains was carried out in
tryptone-yeast extract medium (18) supplemented with the
appropriate antibiotic, either 0.27 mM ampicillin or 0.17 mM kanamycin.
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The Desulfuromonas acetoxidans Triheme
Cytochrome c7 Produced in Desulfovibrio
desulfuricans Retains Its Metal Reductase Activity
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
102 to
177 mV
(9). Recent electrochemistry experiments have demonstrated the direct reduction of Fe(III) and other metals by cytochrome c7 (12, 13). Moreover, it has been
established that these metal reductase activities are specific to the
polyheme cytochrome c from class III as defined by Ambler
(2). The main characteristics of these cytochromes are the
bis-histidinyl coordination type of the heme iron atoms and the
negative oxidoreduction potentials. A large number of multiheme
cytochromes have been discovered in the sulfur- and sulfate-reducing
bacteria, leading to the description of a cytochrome
c3 superfamily in which the basic structural
unit would be of the cytochrome c3
(Mr, 13,000) type (6). Determination of the structural features responsible for the metal reductase activities of the members of this superfamily is of a great academic and environmental interest, and one of the best methods to assess these
parameters is based on protein engineering programs. However, in
engineering the c-type cytochromes, one of the main
challenges lies in the expression and maturation of the molecule in
heterologous organisms. Bacterial c-type cytochromes are
located at the periplasmic side on the cytoplasmic membrane. Their
posttranslational maturation pathway includes the presumptive transport
of the heme, the exportation of the apoprotein through the cytoplasmic
membrane toward the periplasm, and the covalent attachment of the heme
to the apoprotein. An expression system that uses Desulfovibrio
desulfuricans G200 as the host organism (27) has
allowed the expression of both fully matured (i.e., heme insertion)
monoheme (5) and multiheme (3, 20, 27)
c-type cytochromes from the closely related sulfate-reducing
Desulfovibrio vulgaris Hildenborough and
D. desulfuricans Norway strains, the latter
recently reclassified Desulfomicrobium norvegicum
(10). However, it is unknown whether the sulfate-reducing bacterium D. desulfuricans is able to produce multiheme
c-type cytochromes from organisms that are phylogenetically
more distant such as Desulfuromonas acetoxidans.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
TABLE 1.
Bacterial strains and DNA vectors
Expression vector construction. Two deoxyoligonucleotides, PCYC1 (5' GGGAGCGGCGTTAACCGGCAGC 3') and PCYC2 (5' GCGTCAGTCTGCCCGGGCTATTCGTGGC 3') were designed to introduce a unique HpaI site at position 211 and an XmaI site at position 544, respectively, into mp18cyc (26) by site-directed mutagenesis with the Sculptor IV in vitro mutagenesis kit from Amersham. The presence of the desired mutations was checked by dideoxy sequencing. The resulting phagemid was called mp18cycHS.
Amplification of the cytochrome c7 gene from Desulfuromonas acetoxidans genomic DNA. The DNA sequence encoding the cytochrome c7 protein was amplified from Desulfuromonas acetoxidans chromosomal DNA with two degenerate oligonucleotides, C7NT (5' GTGGCCGCIGA(TC)GTIGTIACITA(TC)GA(AG)AA(CT)AA(AG)AA(AG)GG 3') and C7CT (5' CTGTCCCGGGCTA(CT)TT(TGA)AT(AG)TG(AG)CAICCICC(AG)CA(TC)TT 3') by PCR with Pwo polymerase (Boehringer Mannheim). The PCR conditions were adjusted according to the protocol guide of the enzyme manufacturer. A 240-bp amplified fragment was isolated from agarose gel and digested with XmaI. This fragment was then subcloned into mp18cycHS, previously restricted by both HpaI and XmaI. The resulting phagemid was denoted mpc3c7. The construction was verified by dideoxy sequencing.
Electrotransformation of D. desulfuricans G201. The replicative form of mpc3c7 was digested with both EcoRI and HindIII. The resulting 530-bp fragment was gel isolated and ligated to pBMK7 (24) previously cut with the same enzymes to get pK7C7. Plasmid pK7C7, prepared from E. coli, was used for the electrotransformation of D. desulfuricans G201 as described by Rousset et al. (23). A 100-ml culture of D. desulfuricans G201, grown overnight in Postgate C medium (optical density at 600 nm, ~0.6) was centrifuged; the cell pellet was washed three times with sterile water and then suspended in a final volume of 200 µl with water. A 30-µl aliquot of this cell preparation was mixed with 4 µl of plasmid preparation (about 1 µg) and subjected to an electric pulse (5,000 V/cm, 6-ms impulsation time) by an electropulsator (PS15; Jouan SA, Saint Herblain, France) apparatus. The recombinant D. desulfuricans G201(pK7C7) cells were selected on the basis of kanamycin resistance. The same protocol was used to obtain the recombinant D. desulfuricans G201(pBMK7) strain.
Purification and characterization of recombinant cytochrome c7 in D. desulfuricans G201. D. desulfuricans G201(pK7C7) cells were obtained from 300-liter fermentations in Postgate C medium supplemented with 0.28 mM kanamycin. Cells were harvested, resuspended in 600 ml of 100 mM Tris-HCl-100 mM EDTA (pH 9) buffer, and stirred for 30 min at 37°C in a water bath. The mixture was then centrifuged at 27,000 × g for 1 h at 4°C, and the resulting supernatant was dialyzed overnight against distilled water at 4°C. This periplasmic extract was loaded onto a column of DEAE-cellulose (Whatman DE 52) equilibrated with 10 mM Tris-HCl, pH 7.6. The unadsorbed fraction that contained cytochrome c7 was then applied to a hydroxyapatite (Bio-Rad) column equilibrated with 10 mM Tris-HCl (pH 7.6). The cytochrome c7-containing fraction was eluted with 400 mM phosphate buffer (pH 7.6). After overnight dialysis against distilled water, this fraction was adsorbed on a hydroxyapatite (Bio-Rad) column and eluted with 1 M phosphate buffer (pH 7.6) in order to concentrate it. The cytochrome c7 fraction was then loaded onto a Superdex 75 column equilibrated with 50 mM Tris-HCl-100 mM NaCl buffer (pH 7.6). The purity of the samples was analyzed by polyacrylamide gel electrophoresis under denaturing conditions (PhastSystem; Pharmacia) and by N-terminal sequence determination (Applied Biosystems A470 Gas Phase Sequenator). Amino acid analyses were carried out on a Beckman amino acid analyzer (system 6300). The oxidoreduction potentials were determined by electrochemistry as previously described (11).
The total number of heme groups was determined by the pyridine ferrohemochromogen test: a known mass of the protein (determined by hydrolyzing an aliquot of protein solution and performing quantitative amino acid analysis) was added to an aqueous alkaline (7.5 mM NaOH) pyridine (25%) solution and reduced by the addition of a few crystals of sodium dithionite; the heme content was then determined from the pyridine ferrohemochrome spectrum by using the millimolar absorbance coefficient of 29.1 M
1 cm
1 at 550 nm for
the cytochrome c7 derivative (8).
Determination of the metal reductase activities of the cytochromes by electrochemistry. Cyclic voltammetry was performed with an EG&G PAR 263A potentiostat modulated by a microcomputer with EG&G M270 software. A three-electrode design cell was used. The auxiliary electrode was a platinum wire, and the reference electrode was a calomel (KCl-saturated) electrode. Potentials with respect to the normal hydrogen electrode can be obtained by adding 240 mV. The working electrode was a polished glassy carbon electrode. Polishing the glassy carbon electrode was done with 0.04-µm alumina slurry paper on a PRESI polishing wheel. After each polishing, the electrode was subjected to ultrasonication in a demineralized water bath and allowed to dry in the room atmosphere. The membrane electrode was constructed as previously described (11). Briefly, a small volume of protein solution (2 µl) was deposited onto the working electrode and covered with a piece of dialysis membrane (Visking PM 3000). A rubber ring was then fitted around the electrode body so that the entrapped protein solution formed a thin uniform layer. The membrane electrode was then placed into the electrochemistry cell containing the supporting electrolyte (100 mM citrate buffer [pH 6.3] or 100 mM Tris-HCl buffer [pH 7.6]) and the proper reagent, which was either iron(III) ammonium citrate (30 mM) or ammonium chromate (5 mM).
Cyclic voltammograms were recorded in the +140-to-
460-mV (with
respect to the normal hydrogen electrode) potential range. The
electrochemical signal obtained in the buffer solution with the protein
entrapped within the membrane electrode was first recorded. Then,
metals were added to the buffer solution and voltammetric curves were
again recorded. In each case, the cathodic current was measured in
order to determine the catalytic efficiency.
Nucleotide sequence accession number. The nucleotide sequence of the cyaA gene has been deposited in GenBank under accession no. AF005234.
| |
RESULTS |
|---|
|
|
|---|
Two degenerate oligonucleotides were designed on the basis of the N- and C-terminal sequences of Desulfuromonas acetoxidans cytochrome c7 (1). The first one, C7NT, corresponded to the nucleotide sequence that encodes the first 11 amino acids. Six bases encoding two extra amino acids (V and A) were added to the 5' end. Oligonucleotide C7CT was designed on the basis of the last eight amino acids of the molecule to whose coding sequence a stop codon followed by the recognition sequence pattern of XmaI was added. These two degenerate oligonucleotides allowed the amplification of a 240-bp fragment from the Desulfuromonas acetoxidans chromosomal DNA by PCR. Dideoxynucleotide sequencing of this amplified DNA fragment confirmed its sequence, which is described in Fig. 1. This 240-bp amplicon encoded the whole mature cytochrome c7 and was called cyaA. The deduced protein sequence perfectly matched the previously published cytochrome c7 amino acid sequence (1) except for the two extra N terminus amino acids (V and A).
|
To express the cyaA gene in the host organisms, it was inserted into an expression vector based on the cyc transcription unit encoding the D. vulgaris Hildenborough cytochrome c3 (Mr, 13,000) (26). Two endonuclease sites were introduced in the cyc gene just flanking the DNA sequence encoding the mature cytochrome c3 (Mr, 13,000); the HpaI site was introduced six nucleotides upstream from the signal peptide cleavage site, while the XmaI site was introduced just downstream from the stop codon. HpaI-XmaI double digestion of mp18cycHS released the 334-bp fragment that encodes the mature cytochrome c3. This fragment was then replaced by the cyaA amplicon previously digested with XmaI, which encodes cytochrome c7. The resulting phagemid, mpc3c7, contained cyaA encoding the mature sequence of cytochrome c7 fused in frame downstream from the sequence encoding the signal peptide of D. vulgaris Hildenborough cytochrome c3 (Mr, 13,000). The codons for the two extra amino acids (V and A) added to the N terminus sequence of the product of the cyaA gene conserved the same cleavage site of the signal sequence as that found in the cyc gene. This cyc-cyaA gene fusion thus encoded a polypeptide of 90 amino acids consisting of 68 amino acids corresponding to those of cytochrome c7 and an N terminus extension of 22 amino acids corresponding to the cytochrome c3 (Mr, 13,000) signal sequence (Fig. 1).
In order to express the cyc-cyaA gene fusion in D. desulfuricans G201, it was introduced into shuttle vector pBMK7 (24). This shuttle vector contains two origins of replication: the pMB1 origin from the pUC plasmid, which is functional in E. coli, and the origin from D. desulfuricans plasmid pBG1, which is functional in Desulfovibrio, thus allowing this vector to be used in the two organisms. Electrotransformation was used to introduce either plasmid pBMK7 or pK7C7 into the host organism, D. desulfuricans G201. Isolation of plasmids from D. desulfuricans G201(pBMK7) and D. desulfuricans G201(pK7C7) cells that were kanamycin resistant revealed the presence of pBMK7 and pK7C7, respectively.
Analysis of the periplasmic extracts from both D. desulfuricans G201(pBMK7) (control strain) and D. desulfuricans G201(pK7C7) by spectrophotometry revealed a higher cytochrome content in the latter than in the former strain (data not shown). This suggested that holocytochrome c7 was effectively synthesized and located in the periplasmic space of the D. desulfuricans G201(pK7C7) cells.
To confirm that cytochrome c7 was correctly processed in the periplasmic space of D. desulfuricans G201(pK7C7), a purification was performed with 300 g of cells (wet weight) obtained from a large-scale culture. Cytochrome c7 was found to be pure after the last molecular sieving step on a Superdex 75 column; 30 mg of pure cytochrome c7 was obtained from the periplasmic extract, indicating that the cytochrome c3 signal peptide effectively allowed the molecule to be exported across the cytoplasmic membrane. The N terminus sequence of the produced cytochrome was identical to that of the native protein purified from Desulfuromonas acetoxidans, showing that the signal peptide was correctly cleaved in D. desulfuricans G201 during the transport to the periplasm (Table 2). The pyridine ferrohemochromogen test showed that three heme groups were effectively bound to apocytochrome c7 when the gene fusion was expressed in D. desulfuricans G201 (Table 2). D. desulfuricans G201 is thus able to correctly process the apocytochrome c7 expressed from the gene fusion in its periplasmic space. The three midpoint redox potentials of the hemes were determined by electrochemistry; no significant differences between the values measured for the cytochrome c7 produced in D. desulfuricans G201 and those measured for the cytochrome c7 isolated from Desulfuromonas acetoxidans were observed (Table 2). In the same way, the molar extinction coefficients at 553 nm in the reduced state were also found to be the same (data not shown). All these data show that cytochrome c7 produced in D. desulfuricans G201 is indistinguishable from the same molecule produced by Desulfuromonas acetoxidans with respect to several biochemical and biophysical properties, thus suggesting that the folding of the two proteins is likely the same.
|
The metal reductase activities of both cytochromes were tested by cyclic voltammetry. Two metals, known for their capability to be reduced by cytochrome c7 (12, 13), were used as Fe(III) ammonium citrate and Cr(VI) ammonium. The same catalytic process was observed when cytochrome c7 produced in D. desulfuricans G201 was used, as illustrated in Fig. 2 for Fe(III). The reversible wave recorded without any metal turns into a sigmoidal curve. A sharp increase in the cathodic current occurs, with complete vanishing of the anodic wave. These effects are related to the catalysis of the reduction of Fe(III) by the reduced form of cytochrome, which tends to continuously regenerate the oxidized form of the cytochrome in the vicinity of the electrode. The ratio of the catalytic current (Ik) to the peak current recorded when no metal was added to the bulk solution (Id), is indicative of the catalytic efficiency. The same catalytic process occurred when ammonium chromate was used (Table 2). In the present work, a comparison of the catalytic efficiencies reported to the metal concentrations of cytochrome c7 proteins isolated from both Desulfuromonas acetoxidans and D. desulfuricans G201(pK7C7) points out the equality of the metal reductase activities (Table 2).
|
| |
DISCUSSION |
|---|
|
|
|---|
The gene encoding Desulfuromonas acetoxidans cytochrome c7 has been cloned from the genomic DNA. In order to initiate protein engineering programs on this molecule, this gene has been inserted into a new expression vector, leading to the production of a protein fusion in Desulfovibrio desulfuricans. Indeed, to limit the problem of the recognition of the Desulfuromonas acetoxidans expression signals by D. desulfuricans, two organisms belonging to different genera, a gene fusion in which the DNA region encoding the mature sequence of cytochrome c7 is fused in frame downstream from the sequence encoding the signal peptide of D. vulgaris Hildenborough cytochrome c3 has been constructed. The expression of the gene fusion depends on both transcription and translation initiation and termination signals for the cyc gene, which is highly expressed in D. desulfuricans cells (27). In this construction, the final cellular location of the cyc-cyaA gene product is also controlled by the cyc signal sequence. The gene fusion has been introduced into D. desulfuricans cells by electrotransformation with pBMK7 as the shuttle vector. It has been suggested that previously unsuccessful electrotransformation of either D. desulfuricans Norway or D. vulgaris Hildenborough was due to a restriction problem (28). One hypothesis to explain the successful transformation of D. desulfuricans cells with pBMK7 is the presence of the pBG1 OriV, which allows a rapid replication of the plasmid immediately after it enters the cell, thus balancing the restriction system by a kinetic effect. Because holocytochrome c7 is produced in the periplasmic space, the pK7C7-D. desulfuricans system is a suitable vector-host organism couple for the heterologous production of cytochrome c7.
The ability of the host organism to produce a foreign molecule in a native state can be, in some cases, the limiting factor for any protein engineering program. While several cases of monoheme cytochrome production in E. coli have been reported (25), there is, to our knowledge, no example of heterologous expression in E. coli of genes encoding multiheme cytochromes that led to the formation of holocytochromes. On the other hand, Desulfovibrio desulfuricans has been shown to be effective for the production of either the tetraheme cytochrome c3 (Mr, 13,000) (27), the octaheme cytochrome c3 (Mr, 26,000) (3), or the hexadecaheme Hmc (20) from other Desulfovibrio species.
Our results show that D. desulfuricans is able to correctly mature and produce multiheme c-type cytochromes from organisms belonging to a different genus, such as Desulfuromonas acetoxidans. D. desulfuricans is therefore a more suitable host than E. coli for performing heterologous expression of multiheme cytochrome c proteins for either structural or engineering programs. The heme insertion might be more efficient in the sulfate reducer than in E. coli, in which the de novo-synthesized apocytochrome would then be rapidly degraded because of the high protease activity. The heme content in the cell might also be a limiting factor to holocytochrome c formation. Attempts to express multiheme cytochrome c proteins from various organisms by the same approach are in progress in order to determine whether D. desulfuricans can be considered as a universal host for heterologous production of any multiheme c-type cytochromes.
Analysis of the cytochrome content of the recombinant D. desulfuricans G201(pK7C7) cells revealed that holocytochrome c7 is synthesized in the periplasmic space of the bacterium with a relatively high rate of expression (about 90 mg per kg of cells [wet weight]). The recombinant cytochrome c7 was found to be identical to the molecule purified from Desulfuromonas acetoxidans cells with respect to several biochemical and biophysical criteria, showing that this expression system works correctly. Moreover, the two have the same metal reductase activities. Overproduction of active cytochrome c7 in D. desulfuricans is an important step in the development of fixed-enzyme reactors or organisms with enhanced metal reductase activities for the bioremediation of contaminated waters and soils. The cloning of the cyaA gene and the heterologous production of cytochrome c7 are the first necessary steps of a protein engineering program which is intended to specify the structural features that are responsible for the metal reductase activities of this molecule.
| |
ACKNOWLEDGMENTS |
|---|
The D. desulfuricans G201 strain was kindly provided by J. Wall (Columbia, Mo.). The large-scale cultures were performed at the Unit Fermentation Plant (LCB, Marseilles, France). This work is a part of a collaborative project with I. Bertini and L. Banci (Florence, Italy).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: BIP-IFR1, CNRS, 31 ch. J. Aiguier, 13402 Marseilles Cedex 20, France. Phone: 33 4 91 16 41 44. Fax: 33 4 91 77 95 17. E-mail: bruschi{at}ibsm.cnrs-mrs.fr.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Ambler, R. P. 1971. The amino acid sequence of cytochrome c-551.5 (cytochrome c7) from the green photosynthetic bacterium Chloropseudomonas ethylica. FEBS. Lett. 18:351-353[Medline]. |
| 2. | Ambler, R. P. 1991. Sequence variability in bacterial cytochrome c. Biochim. Biophys. Acta 1058(1):42-47[Medline]. |
| 3. |
Aubert, C.,
G. Leroy,
M. Bruschi,
J. D. Wall, and A. Dolla.
1997.
A single mutation in the heme 4 environment of Desulfovibrio desulfuricans Norway cytochrome c3 (Mr 26000) greatly affects the molecule reactivity.
J. Biol. Chem.
275:15128-15134 |
| 4. |
Banci, L.,
I. Bertini,
M. Bruschi,
P. Sompornpisut, and P. Turano.
1996.
NMR characterization and solution structure determination of oxidized cytochrome c7 from Desulfuromonas acetoxidans.
Proc. Natl. Acad. Sci. USA
93:14396-14400 |
| 5. | Blanchard, L., D. Marion, B. Pollock, G. Voordouw, J. Wall, M. Bruschi, and F. Guerlesquin. 1993. Overexpression of Desulfovibrio vulgaris Hildenborough cytochrome c553 in Desulfovibrio desulfuricans G200. Evidence of a conformational heterogeneity in the oxidized protein by NMR. Eur. J. Biochem. 218:293-301[Medline]. |
| 6. | Bruschi, M. 1994. Cytochrome c3 (Mr 26000) isolated from sulfate reducing bacteria and its relationships to other polyhemic cytochromes from Desulfovibrio. Methods Enzymol. 243:140-155[Medline]. |
| 7. | Bruschi, M., M. Woudstra, B. Guigliarelli, M. Asso, E. Lojou, Y. Petillot, and C. Abergel. 1997. Biochemical and spectroscopic characterization of two new cytochromes isolated from Desulfuromonas acetoxidans. Biochemistry 36:10601-10608[Medline]. |
| 8. | Falk, J. E. 1964. , p. 240-248. Porphyrins and metalloporphyrins. Their general physical and coordination chemistry and laboratory Elsevier Science Publishing, Inc., New York, N.Y. |
| 9. | Feichtner, M. D., and R. J. Kassner. 1979. The redox properties and heme environment of cytochrome c-551.5 from Desulfuromonas acetoxidans. Biochim. Biophys. Acta 579:269-278[Medline]. |
| 10. |
Genthner, B. R. S.,
S. D. Friedman, and R. Devereux.
1997.
Reclassification of Desulfovibrio desulfuricans Norway 4 as Desulfomicrobium norvegicum comb. nov. and confirmation of Desulfomicrobium escambiense (corrig., formerly "escambium") as a new species in the genus Desulfomicrobium.
Int. J. Syst. Bacteriol.
47:889-892 |
| 11. | Haladjian, J., P. Bianco, F. Nunzi, and M. Bruschi. 1994. A permselective-membrane electrode for the electrochemical study of redox proteins. Application to cytochrome c552 from Thiobacillus ferrooxidans. Anal. Chem. 289:15-20. |
| 12. | Lojou, E., P. Bianco, and M. Bruschi. Kinetic studies on the electron transfer between various c-type cytochromes and iron (III) using a voltammetric approach. Electrochim. Acta, in press. |
| 13. | Lojou, E., M. Bruschi, and P. Bianco. Unpublished data. |
| 14. |
Lovley, D. R., and E. J. P. Phillips.
1992.
Reduction of uranium by Desulfovibrio desulfuricans.
Appl. Environ. Microbiol.
58:850-856 |
| 15. | Lovley, D. R. 1993. Dissimilatory metal reduction. Annu. Rev. Microbiol. 47:263-290[Medline]. |
| 16. |
Lovley, D. R.,
P. K. Widman,
J. C. Woodward, and E. J. P. Phillips.
1993.
Reduction of uranium by cytochrome c3 of Desulfovibrio vulgaris.
Appl. Environ. Microbiol.
59:3572-3576 |
| 17. |
Lovley, D. R., and E. J. P. Phillips.
1994.
Reduction of chromate by Desulfovibrio vulgaris and its c3 cytochrome.
Appl. Environ. Microbiol.
60:726-728 |
| 18. | Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. . Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 19. | Pfenning, N., and H. Biebl. 1976. Desulfuromonas acetoxidans gen. nov. and sp. nov. A new anaerobic sulfur reducing acetate oxidizing bacterium. Arch. Microbiol. 110:1-10. |
| 20. |
Pollock, W. B. R.,
M. Loutfi,
M. Bruschi,
B. J. Rapp-Giles,
J. D. Wall, and G. Voordouw.
1991.
Cloning, sequencing, and expression of the gene encoding the high-molecular-weight cytochrome c from Desulfovibrio vulgaris Hildenborough.
J. Bacteriol.
173:220-228 |
| 21. | Postgate, J. R. 1984. . The sulphate reducing bacteria, 2nd ed. Cambridge University Press, Cambridge, United Kingdom. |
| 22. |
Roden, E. E., and D. R. Lovley.
1993.
Dissimilatory Fe(III) reduction by the marine microorganism Desulfuromonas acetoxidans.
Appl. Environ. Microbiol.
59:734-742 |
| 23. | Rousset, M., Z. Dermoun, M. Chippaux, and J. P. Belaich. 1991. Marker exchange mutagenesis of the hydN genes in Desulfovibrio fructosovorans. Mol. Microbiol. 5:1735-1740[Medline]. |
| 24. | Rousset, M., L. Casalot, B. J. Rapp-Giles, Z. Dermoun, P. De Philipp, J. P. Belaich, and J. D. Wall. Submitted for publication. |
| 25. | Thony-Meyer, L., P. Kunzler, and H. Hennecke. 1997. Biogenesis of respiratory cytochromes in bacteria. Microbiol. Mol. Biol. Rev. 61:337-376. [Abstract] |
| 26. | Voordouw, G., and S. Brenner. 1986. Cloning and sequencing of the gene encoding cytochrome c3 from Desulfovibrio vulgaris Hildenborough. Eur. J. Biochem. 159:347-351[Medline]. |
| 27. |
Voordouw, G.,
W. B. R. Pollock,
M. Bruschi,
F. Guerlesquin,
B. J. Rapp-Giles, and J. Wall.
1990.
Functional expression of Desulfovibrio vulgaris Hildenborough cytochrome c3 in Desulfovibrio desulfuricans G200 after conjugational gene transfer from Escherichia coli.
J. Bacteriol.
172:6122-6126 |
| 28. | Wall, J. D. 1993. Genetics of the sulfate-reducing bacteria, p. 77-87. In J. M. Odom, and R. Singleton Jr (ed.), The sulfate-reducing bacteria: contemporary perspectives. Springer-Verlag, New York, N.Y. |
| 29. |
Weimar, P. J.,
M. J. van Kavelaar,
C. B. Michel, and T. K. Ng.
1988.
Effect of phosphate on the corrosion of carbon steel and on the composition of corrosion products in two-stage continuous cultures of Desulfovibrio desulfuricans.
Appl. Environ. Microbiol.
54:386-396 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»