Previous Article | Next Article 
Appl Environ Microbiol, June 1998, p. 2247-2255, Vol. 64, No. 6
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Establishment of New Genetic Traits in a Microbial
Biofilm Community
Bjarke B.
Christensen,1
Claus
Sternberg,1
Jens Bo
Andersen,1
Leo
Eberl,2
Søren
Møller,3
Michael
Givskov,1 and
Søren
Molin1,*
Department of Microbiology, The Technical
University of Denmark, DK-2800 Lyngby,1 and
NovoNordisk A/S, DK-2880 Bagsværd,3
Denmark, and
Lehrstuhl für Mikrobiologie, Technische
Universität München, D-80290 Munich,
Germany2
Received 6 February 1998/Accepted 19 March 1998
 |
ABSTRACT |
Conjugational transfer of the TOL plasmid (pWWO) was analyzed in a
flow chamber biofilm community engaged in benzyl alcohol degradation.
The community consisted of three species, Pseudomonas putida RI, Acinetobacter sp. strain C6, and an
unidentified isolate, D8. Only P. putida RI could act as a
recipient for the TOL plasmid. Cells carrying a chromosomally
integrated lacIq gene and a
lacp-gfp-tagged version of the TOL plasmid were introduced as donor strains in the biofilm community after its formation. The
occurrence of plasmid-carrying cells was analyzed by viable-count-based enumeration of donors and transconjugants. Upon transfer of the plasmids to the recipient cells, expression of green fluorescence was
activated as a result of zygotic induction of the gfp gene. This allowed a direct in situ identification of cells receiving the
gfp-tagged version of the TOL plasmid. Our data suggest
that the frequency of horizontal plasmid transfer was low, and growth (vertical transfer) of the recipient strain was the major cause of
plasmid establishment in the biofilm community. Employment of scanning
confocal laser microscopy on fixed biofilms, combined with simultaneous
identification of P. putida cells and transconjugants by
16S rRNA hybridization and expression of green fluorescence, showed
that transconjugants were always associated with noninfected P. putida RI recipient microcolonies. Pure colonies of
transconjugants were never observed, indicating that proliferation of
transconjugant cells preferentially took place on preexisting P. putida RI microcolonies in the biofilm.
| |
INTRODUCTION |
Biological wastewater treatment,
removal of organic compounds from contaminated soil, biogas reactors,
etc., all involve processes based on the action of microbial
communities. Increasing demands for improving the efficiencies of
degradation in these systems have resulted in the need for a better
understanding of the function and significance of the individual
organisms in the community. One way to stimulate degradation of certain
pollutants would be to introduce new genetic information into the
microbial community. This process, termed bioaugmentation, involves the
addition of new bacteria to the community, thus introducing new
biodegradation pathways for metabolic conversion of the pollutants.
However, enhancement of biodegradation often fails due to poor
establishment and/or survival of the new strain in the environment
(20, 25, 44). An alternative approach is to transfer the
relevant genes on conjugative plasmids to indigenous organisms, from
which the genes may spread further in the community (13, 15, 17,
18, 28, 32).
If plasmid genes (e.g., for resistance to heavy metals or antibiotics,
for metabolic pathways, etc.) are acquired from foreign organisms and
exchanged between members of the community, the capacity of a community
to develop new microbial traits may be increased, making the community
more responsive to environmental changes (19, 24, 40).
However, little is known about the features which are important for the
integration of new genetic traits by microbial communities.
Methods for determination of the organism composition and for tracing
specific genes in microbial communities include the use of nucleic acid
probes targeting specific DNA regions (for a review, see Sayler and
Layton [34]), frequently by including a PCR step to
amplify the region of interest (31, 39); in situ rRNA
hybridization employing 16S or 23S rRNA probes targeting specific
organisms (for a review, see Amann et al. [2]); or simple plating on selective plates.
During the last 5 to 10 years, several new techniques have been
developed for more detailed analysis of complex microbial communities.
The application of scanning confocal laser microscopy (SCLM) in
combination with a number of fluorescent biomarkers has been used for
analysis of structural features, such as the arrangement of cells,
polymers, and channels in microbial environments (27, 46,
47). In situ hybridization with fluorescence-labeled 16S or 23S
rRNA probes in combination with SCLM is a powerful approach for
visualization of the spatial distribution of important group organisms
in bacterial communities (29, 41).
Fluorescent markers may also be introduced by genetic engineering. The
gfp gene encoding the green-fluorescent protein (Gfp) (7) and enhanced by Cormack et al. (10) has been
very useful as a reporter for studies of gene expression in single
cells. For example, fusions between the relevant promoter and the
gfp gene have been used to monitor subcellular protein
localization during sporulation in Bacillus subtilis
(42) and to analyze mycobacterial interactions with
macrophages (14). Gfp has also been used as a reporter to
monitor the kinetics of TOL plasmid transfer between bacteria growing
on agar surfaces (8) as well as to track individual cells in
an activated-sludge community (16).
In the present work, we have investigated the establishment of the TOL
plasmid in a biofilm community growing on benzyl alcohol as the sole
carbon and energy source. A consortium of bacteria, originally isolated
from a creosote-polluted aquifer, was previously used in a waste gas
biofilter for the degradation of toluene (29). From this
complex consortium of bacteria, a model community consisting of three
species (Pseudomonas putida RI; a strain of
Acinetobacter sp.; and a strain, D8, tentatively associated
with the 
subgroup of Proteobacteria strains), isolated
as individual clones from the original waste gas biofilter, was defined
for our biofilm investigations. In situ rRNA hybridization was used to
identify the three species present in the community, and an approach
based on zygotic induction of the Gfp protein developed to study
plasmid transfer directly in the community (8) was employed
in order to localize conjugational activities.
| |
MATERIALS AND METHODS |
Strains, plasmids, and growth conditions.
The bacterial
strains and plasmids and their relevant characteristics are listed in
Table 1. The strains were grown in
Luria-Bertani (LB) broth (containing 10 g of tryptone, 5 g of
yeast extract, and 4 g of NaCl). When required, antibiotics were
added at final concentrations of 50 µg/ml for rifampin and nalidixic
acid and 10 µg/ml for kanamycin.
Mutants of the natural isolate P. putida RI, resistant to
either nalidixic acid or rifampin, were isolated as spontaneous mutants
on LB broth plates containing concentrations of 100 µg of nalidixic
acid or rifampin per ml, respectively.
A modified version of the pUT vector (
12), comprising a
mini-Tn
5 transposon with RP4 resolvase sites flanking the
npt gene
responsible for kanamycin resistance (pCK242)
(
23), was used
for insertion of the
lacIq gene (
38) into the chromosome
of KT2442. Triparental mating
among a donor strain (carrying the
lacIq delivery plasmid pSM1435), the helper
strain HB101(RK600), and
the recipient
P. putida KT2442
resulted in KT2442 derivatives
conferring kanamycin resistance with the
lacIq gene inserted in the chromosome.
Subsequently, the
npt gene was
deleted as described by
Christensen et al. (
8). One such kanamycin-sensitive
clone
was picked and designated SM1443.
The gene encoding the green fluorescent protein Gfpmut3b was obtained
from Cormack et al. (
10). The
gfpmut3b gene was
PCR
amplified as a 0.7-kb
SphI-
HindIII
fragment. When introducing
a
SphI site in the start codon of
gfpmut3b the sequence was changed
in the PCR such that the
Gfpmut3b protein contained an arginine
instead of a serine residue at
position 2.
The
gfpmut3b fragment was cloned downstream of the promoter
PA1/O4/O3 (
6), at an optimal distance
from a synthetic ribosome
binding site (RBSII, from plasmid pQE70;
Qiagen GmbH, Germany),
and upstream of a region with two strong
transcriptional terminators,
T
0 (from phage lambda) and
T
1 (from the
rrnB operon of
Escherichia coli), and with translational stop codons in all three reading
frames. The
NotI fragment from the resulting plasmid
(pJBA27),
containing RBSII,
gfpmut3b, the translational stop
codons, and
the transcriptional terminators, was inserted into the
NotI site
of pUTKm, resulting in the transposon delivery
vector pJBA28,
containing a cassette with
PA1/O4/O3::
gfpmut3b and the
npt gene.
Insertion of the
PA1/O4/O3::
gfpmut3b
cassette into the TOL plasmid was performed in two steps. First, a
triparental mating
was performed, in which the helper plasmid RK600 was
used to mobilize
the delivery plasmid pJBA28 from the donor strain,
CC118
pir,
into the recipient strain,
P. putida
KT2440. Selection on AB-minimal
plates (
9) containing 10 mM
citrate and 50 µg of kanamycin/ml
resulted in KT2440 derivatives
carrying the
PA1/O4/O3::
gfpmut3b
cassette inserted either in the chromosome or in the TOL plasmid.
Clones with the cassette integrated in the TOL plasmid were selected
from a second round of conjugation. Colonies from the first-round
selective plates (>1,000 on one plate) were suspended in 1 ml
of 0.9%
NaCl. The suspended cells were then mated with the kanamycin-sensitive
recipient, SM1443. Selection on plates containing 50 µg of
kanamycin/ml
and 50 µg of rifampin/ml resulted in SM1443
Km
r derivatives carrying the TOL plasmid with the
PA1/O4/O3::
gfpmut3b
cassette inserted at random positions. One clone (designated BBC443)
was chosen for subsequent experiments based on the following criteria:
it was able to grow on AB-minimal plates supplemented with either
5 mM
benzyl alcohol or 5 mM sodium benzoate as the sole carbon
and energy
source; the colonies were green fluorescent upon addition
of 1 mM IPTG
(isopropyl-
-
D-thiogalactopyranoside); and finally,
the
conjugation frequency on plates of the
gfp-tagged plasmid
was similar to that of the wild-type TOL plasmid.
Cultivation of biofilms.
The biofilm model community
comprised the following organisms: P. putida RI JB156, which
is resistant to nalidixic acid, or JB154, which is resistant to
rifampin; Acinetobacter sp. strain C6; and an unidentified
strain, isolate D8, of the subgroup of the class
Proteobacteria (Table 1). All of the strains are able to
mineralize toluene and benzyl alcohol (30).
Biofilms were cultivated as mixtures of the three species in
rectangular two- or four-channel flow cells (
47) with
individual
channel dimensions of 1 by 4 by 40 mm supplied with a flow
of
FAB substrate [1 mM MgCl
2, 0.1 mM CaCl
2,
0.01 mM Fe-EDTA [catalog
no. E6760; Sigma, St. Louis, Mo.), 0.15 mM
(NH
4)SO
4, 0.33 mM
Na
2HPO
4,
0.2 mM KH
2PO
4,
0.5 mM NaCl]. Benzyl alcohol (Merck KGaA, Darmstadt,
Germany) at a
concentration of 0.5 mM was used as the sole carbon
source.
Flow chamber experiments.
The flow system was assembled with
autoclaved silicone tubing. Complete sterilization was performed by
pumping a solution of 0.5% sodium hypochlorite into the system and
leaving it overnight. The following day approximately 0.2 liters of
sterile water per flow chamber was flushed through the system before
the medium was pumped in.
During biofilm growth, the medium was pumped through the flow cells at
a rate of 0.2 mm/s with a peristaltic pump (model 205S;
Watson-Marlow
Inc., Wilmington, Mass.). The flow cells were inoculated
with mixtures
of cultures of the three strains pregrown for 2
days in LB medium in
the ratio 1:10:5 for
P. putida,
Acinetobacter,
and isolate D8, respectively. The mixtures were sonicated with
a
Branson sonifier (Branson Ultrasonics Corp., Danbury, Conn.)
for 1 min
at output control 3 and duty cycle 40%, and 0.25 ml
of the mixed
culture was injected into each channel.
Sequencing of 16S rRNA.
Sequencing of 16S rRNA was performed
with an automatic 373A DNA sequencer (Applied Biosystems, Foster City,
Calif.) directly on PCR products generated from chromosomal DNA
extracts according to the manufacturer's recommendations. The
following primers were used (in the 5'
3' direction): 11F,
GTTTGATC(A/C)TGGCTCAGATTG; 344R,
CCCCACTGCTGCCTCCCGT; 515R,
GTATTACCGCGGC(G/T)GCTGGCAC; 922R, GCTTGTGCGGGCCCCCGTC;
1101R, GACAAGGGTTGCGCTCGTT; 1389R,
GTGACGGGCGGTGTGTACAAG; and 1465R,
CCCCAGTCATGAATCATAAAGTGGT. Initial phylogenetic
analysis of the sequenced rRNAs was obtained from on-line services of
the Ribosomal Database Project (SIMILARITY_RANK [26]).
In addition, potential signature sequences were identified as described
by Woese (45), allowing differentiation between the major
groups of the class Proteobacteria.
Oligonucleotide probes.
For 16S rRNA hybridization, the
probes EUB338 (specific for the domain Bacteria
[1]) and PP986 (specific for the P. putida subgroup A [29]) were used. Based on the sequence
information obtained, specific rRNA probes for Acinetobacter
sp. strain C6 and isolate D8 were designed. The specificities of Acn449
and D8_647 were tested against published sequences with the CHECK_PROBE program from the Ribosomal Database Project (26). All probes were tested against the organisms of the community and found to be
specific for their respective target organisms (data not shown). Oligonucleotide probes labeled with fluorescein isothiocyanate or the
indocarbocyanine fluorescent dyes CY3 and CY5 were purchased from
Hobolth DNA Syntese (Hillerød, Denmark).
Embedding of hydrated biofilm samples.
Embedding was
performed as a nondestructive method to maintain a fixed biofilm in its
3-dimensional native hydrated state and at the same time to allow easy
handling of the fixed biofilm. Throughout the embedding procedure,
pumping of solutions through the flow cells was performed at 0.8 mm/s.
Biofilms were fixed in freshly made 3% paraformaldehyde solution
(33) by pumping the solution through the flow channels with
attached biofilms. To ensure the complete fixation of all cells in the
biofilms, the solution was retained in the channels for 1 h at
room temperature before the biofilms were washed by flowthrough of
phosphate-buffered saline for 5 min. Embedding was performed by
introducing a solution of 1 ml of 20% acrylamide (200:1
acrylamide-bisacrylamide) mixed with 8 µl of
N,N,N',N'-tetramethylethylenediamine
(Kodak International Biotechnologies Inc., New Haven, Conn.), and
immediately prior to inoculation, 20 µl of ammonium persulfate (Kodak
International Biotechnologies Inc.) was also added. Approximately 0.5 ml of the solution was pumped into the channel, where it solidified within 2 min after addition of the ammonium persulfate.
Hybridization of embedded biofilm cells.
After fixation and
embedding, the polyacrylamide block with biofilm was placed on a 6-well
hybridization slide (Novakemi AB, Enskede, Sweden) and equilibrated for
15 min with hybridization buffer containing 30% formamide at 37°C.
Then 30 µl of hybridization mixture (30% formamide, 0.9 M NaCl, 100 mM Tris [pH 7.2], 0.1% sodium dodecyl sulfate) containing 75 ng of
probe was added to each hybridization well. Cells were incubated with
hybridization solution for 3 h at 37°C in a moisture chamber.
For washing, 50 µl of each washing solution was added to each well as
follows. First, the acrylamide blocks were washed in solution I (30%
formamide, 0.9 M NaCl, 100 mM Tris [pH 7.2], 0.1% sodium dodecyl
sulfate) for 40 min at 37°C, then they were washed for 40 min in
washing solution II (0.1 M Tris [pH 7.2], 0.9 M NaCl) at 37°C, and
finally, they were rinsed two times in 50 µl of distilled water. The
acrylamide blocks were mounted in 2× SlowFade phosphate-buffered
saline-based antifade solution (Molecular Probes, Eugene, Oreg.).
Microscopy and image analysis.
All microscopic observation
and image acquisition was performed on a TCS4D confocal microscope
(Leica Lasertechnik GmbH, Heidelberg, Germany) equipped with three
detectors and filter sets for simultaneous monitoring of fluorescein
isothiocyanate/green-fluorescent protein and the indocarbocyanine dyes
CY3 and CY5.
Multichannel simulated fluorescence projection (SFP; a shadow
projection) images and vertical cross sections through the biofilms
were generated with the IMARIS (Bitplane AG, Zürich, Switzerland)
software package running on an Indigo 2 (Silicon Graphics, Mountain
View, Calif.) workstation. The images were further processed for
display with Photoshop software (Adobe, Mountain View, Calif.).
The spatial distribution of organisms was estimated by measuring the
area covered by hybridization signal (represented by
different colors)
in series of two-channel optical sections by
using simple thresholding.
One channel represented the cells targeted
with the general eubacterial
probe EUB338 (
1), and the other
channel represented the
cells hybridized with a species-specific
probe. Before thresholding was
done, the images were preprocessed
with IMARIS: background was removed
by a lowpass filtering and
background subtraction, and a final
correction for loss of intensity
from deeper layers was performed with
the emission attenuation
algorithm of IMARIS. Thresholding was
performed on the processed
images with the HIPS image analysis package.
Nucleotide sequence accession number.
The sequence reported
here will appear in the EMBL, GenBank, and DDBJ nucleotide sequence
databases under accession no. Y11464 (Acinetobacter sp.
strain C6) and Y11465 (isolate D8).
| |
RESULTS AND DISCUSSION |
The model bacterial community.
Flow chamber biofilms were
established by mixing three strains which had been precultured
separately for 2 days at 30°C in LB media prior to inoculation.
Benzyl alcohol was added as the sole carbon and energy source for
growth of the community. A quantitative analysis of the distribution of
the different community members at different depths of a 7-day-old
biofilm was done by probing with fluorescent 16S ribosomal DNA probes.
Probes targeting the three selected species, P. putida,
Acinetobacter sp. strain C6, and isolate D8, were used for
identification. The analysis (Fig. 1A)
revealed that P. putida RI was the most common species in the upper layers, whereas Acinetobacter dominated the layers
near the substratum, where most of the overall biomass was observed (Fig. 1B). Isolate D8 was not a dominant community member at any depth
of the biofilm.
View larger version (27K):
[in this window]
[in a new window]
|
FIG. 1.
Quantitative analysis showing the spatial distribution
of the different organisms of the mixed-culture biofilm sampled at day
7. (A) Vertical profile through the biofilm showing percentage of
Acinetobacter sp. strain C6 ( ), P. putida RI
( ), and isolate D8 ( ) relative to the total number of cells
targeted with the general eubacterial 16S rRNA probe (EUB338
[1]). Each profile is an average of three images (each
consisting of 31 optical sections) captured at three random locations
in the biofilm. (B) Relative area covered by cells in each section,
taken as an average over six images. Standard deviations are indicated
by error bars.
|
|
Introduction of genes encoding the TOL biodegradation pathway into
the flow chamber community.
The three species comprising the
microbial community are able to utilize benzyl alcohol as their sole
carbon and energy source. Based on DNA hybridization and investigations
of substrate profiles and metabolite formation, we have previously
concluded that all the strains seem to harbor degradation pathways
similar to that of the P. putida plasmid TOL (pWWO)
(48). However, despite the similarities, the three pathways
are probably not identical (30).
To analyze the establishment of a new metabolic pathway in the
microbial community, the TOL plasmid was chosen. The TOL plasmid
derivative TOL
gfpmut3b (Table
1), which carries a
fluorescent
reporter tag and a kanamycin resistance marker gene, was
used
for this investigation. When grown in batch culture with benzyl
alcohol as the sole carbon source the doubling time of
P. putida RI was approximately 110 min (not shown). Introduction of
the
TOL plasmid into this strain by conjugation decreased the doubling
time to approximately 80 min. The TOL plasmid had no significant
effect
on host cell generation times in media supplemented with
carbon sources
unrelated to the TOL pathway.
Establishment of the TOL plasmid degradation pathway in the biofilm
community could occur through colonization of the biofilm
by the
plasmid-carrying donor strain, through plasmid transfer
to the
indigenous bacteria, or both. In the experiment, these
possibilities
could be monitored independently, and the experimental
results are
presented accordingly.
The population size of the incoming donor strain
a rifampin-resistant
derivative of
P. putida RI carrying the plasmid
TOL
gfpmut3b
(BBC516)
was determined as rifampin- and
kanamycin-resistant viable
counts present in the effluent from the flow
chamber. These determinations
represent good estimates of the total
biofilm populations, as
indicated by control experiments in which
entire biofilm communities
have been analyzed and compared with
effluents (not shown). Transfer
of the TOL plasmid to the indigenous
nalidixic acid-resistant
strain of
P. putida RI was
estimated from cell counts on selective
plates supplemented with
nalidixic acid and kanamycin. Reversal
of the antibiotic marker
phenotypes in the incoming and indigenous
strains of
P. putida did not influence the outcome of the experiment
(not
shown).
The donor strain was introduced 2 days after the initial colonization
of the model community. Three different concentrations
of an overnight
culture (5 · 10
4, 5 · 10
5, or
5 · 10
6 CFU/ml) were injected into separate flow
channels. Total cell
counts in the effluents, as well as relative
numbers of the indigenous
P. putida RI cells, were
marginally affected by the introduction
of the
P. putida RI
cells carrying the TOL plasmid (Fig.
2A
and
B). However, as shown in Fig.
2C, the relative proportion of
incoming
P. putida RI cells started to increase
exponentially immediately
after their introduction. Independent of
their abundance at the
start of the experiment, they reached a
steady-state level of
approximately 10% of the total count 6 to 7 days
after their introduction.
Despite their apparently more effective
degradation pathway (faster
growth) and their rapid rate of
establishment during the first
few days,
P. putida RI cells
carrying the TOL plasmid did not
outcompete the indigenous
P. putida RI cells (Fig.
2C), even over
a period of 40 days (data not
shown).
View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
Time course analysis of the distribution of donor cells,
P. putida RI, and transconjugants relative to the total
number of cells collected from flow channel effluents. The donor
(P. putida RI/TOLgfpmut3b) was introduced at day
2 in three different densities: 5 · 104 ( ),
5 · 105 ( ), and 5 · 106 ( )
CFU/ml. Total counts (A) were enumerated on pure LB broth plates. The
P. putida RI cells (Nalr) (B), donor cells
(Rifr) (C), and transconjugants (Nalr
Kmr) (D) were enumerated on LB broth plates containing the
appropriate antibiotics, and the numbers were taken relative to the
total counts. Each data point is the average of two independent
experiments.
|
|
Mating experiments performed on an agar surface showed that the
TOL
gfpmut3b plasmid could only be transferred to
P. putida RI. When the donor cells (
P. putida
RI/TOL
gfpmut3b) and the isogenic
recipient cells (
P. putida RI) were mixed in equal numbers on
an agar surface,
approximately 20% of the recipients hosted the
plasmid after 24 h. Based on these results, it was surprising
to see that plasmid
transfer occurring in the biofilm community
was almost negligible
during the first several days and remained
low throughout the
experiment (Fig.
2D).
In conclusion, the data presented in Fig.
2 show (i) that establishment
of the incoming donor strain in the biofilm was possible;
(ii) that the
TOL plasmid was established mainly by growth of
the incoming donor
cells (vertical transfer), possibly facilitated
by the growth advantage
mediated by the TOL degradation pathway;
and (iii) that the TOL plasmid
was transferred at a low but measurable
rate to recipient cells in the
community.
In a separate experiment, the influence of the strain background of the
incoming organism was investigated. The strain
P. putida
KT2442 (Rif
r) carrying the TOL
gfpmut3b plasmid
is not isogenic with
P. putida RI, although the 16S rRNA
sequences of the two strains only differ
by a few bases (unpublished
data). In addition, strain KT2442
grows in batch culture with benzyl
alcohol as the sole carbon
source with a doubling time of approximately
80 min, which is
significantly faster than that measured for cultures
of
P. putida RI. Furthermore, when
P. putida
KT2442 (Rif
r) carrying the TOL
gfpmut3b plasmid
was cocolonized with the other
three species, the strain constituted
more than 90% of the total
cell counts only a few days after
colonization (data not shown),
indicating that the strain is a good
colonizer and competitor
when introduced together with the three
community strains.
In the following experiment, presented in Fig.
3, the impact of the donor cell
background on the efficiency of establishment
in the biofilm was
investigated. The donor strain (KT2442/TOL
gfpmut3b)
was
introduced 2 days after the initial colonization of the microbial
flow
chamber community. The incoming donor was introduced into
separate flow
chambers in three different concentrations (5 ·
10
6,
5 · 10
7, or 5 · 10
8 CFU/ml) of an
overnight culture. Time course analysis of the
population profile of
cells collected from the effluents showed
that neither the total cell
count nor the relative proportion
of
P. putida RI cells was
significantly affected by the introduction
of the new strain (Fig.
3A
and B).
View larger version (21K):
[in this window]
[in a new window]
|
FIG. 3.
Time course analysis of the distribution of donor cells,
P. putida RI, and transconjugants relative to the total
number of cells collected from flow channel effluents. The donor
(P. putida KT2442/TOLgfpmut3b) was introduced at
day 2 in three different concentrations: 5 · 106
(), 5 · 107 (), and 5 · 108
() CFU/ml. Total counts (A) were enumerated on pure LB broth plates.
The P. putida RI cells (Nalr) (B), donor cells
(Rifr) (C), and transconjugants (Nalr
Kmr) (D) were enumerated on LB broth plates containing the
appropriate antibiotics, and the numbers were taken relative to the
total counts. Each data point is the average of two independent
experiments.
|
|
Figure
3C shows that the relative number of donor cells collected from
the flow channel effluents during the first few days
after their
introduction reflected the differences in the inoculation
concentrations. Moreover, there was an initial phase of washing
out of
this strain, in contrast to what was observed for incoming
P. putida RI cells (Fig.
2C). It should also be noted that KT2442,
when introduced at a concentration of 5 · 10
6
CFU/ml, was established in the community at a 1,000-fold-lower
level
than that observed for the RI strain. Thus, when KT2442
harboring the
TOL plasmid was introduced after initial colonization
of the three
community species it did not establish itself very
effectively, and
therefore the apparent growth advantage over
the indigenous RI strain,
as observed in batch cultures of suspended
cells, was not sufficient to
compete effectively in the biofilm
community.
The relative proportion of transconjugants produced upon transfer of
the TOL
gfpmut3b plasmid to the indigenous
P. putida RI
cells increased rapidly until it reached a steady-state
level
of approximately 10% of the total population (Fig.
3D).
The accumulation
of transconjugants (
P. putida
RI/TOL
gfpmut3b Nal
r) in this experiment
and the accumulation of the introduced donor
cells (
P. putida RI/TOL
gfpmut3b Nal
r) in the previous
experiment show similar kinetics (compare Fig.
2C and
3D). This
suggests that once
P. putida RI cells carrying
the TOL
plasmid are formed or introduced in the biofilm, they
grow and become
established independently of the way in which
they arise in the
population. The results also suggest that the
dominant mode of
establishment of the TOL plasmid in the present
community is through
the rapid growth of cells representing an
optimal host-plasmid
combination; actual plasmid transfer plays
a quantitatively minor role,
which only becomes significant in
situations where the donor strain
cannot establish itself directly.
This suggests that despite the
difficulty with which new organisms
may become established in already
existing microbial communities,
new genetic information can be
introduced quite effectively when
located on mobile elements, even if
the actual transfer rates
are low.
Similar observations have been made in more complex ecosystems: in soil
microcosms (
5,
13) and in freshwater flowthrough
systems
(
17,
18), strains carrying catabolic plasmids were
found to
be outcompeted shortly after their introduction, whereas
the plasmids
were transferred and established in a number of different
indigenous
community strains.
Vertical TOL plasmid transfer is dependent on the existing pool of
P. putida RI cells in the biofilm.
In the experiments
described so far the biofilm community has been kept constant, i.e.,
the relative proportion of recipient P. putida RI cells has
been high, constituting approximately half of the total population
(Fig. 2 and 3). The influence of recipient concentration in the flow
chambers on the rate of plasmid transfer and replication was
investigated subsequently. Three channels were cultivated with the
standard mixed-culture inoculum in the first channel (as in the
experiments described above), and in the other two channels we reduced
the number of inoculated P. putida RI cells 10 and 1,000 times, respectively, relative to the number of P. putida RI
cells introduced in the first channel.
Figure
4B shows that, when introduced in
low numbers,
P. putida RI cells grew rapidly during the
first 2 days after colonization,
followed by a slow decline. In all
three channels, donor cells
of the
P. putida strain KT2442
harboring the TOL plasmid described
above were introduced at day 2 at a
concentration of 10
8 CFU/ml. Figure
4C shows that the
relative proportion of donor
cells remaining in the biofilm decreased
approximately 1 order
of magnitude over the next 3 to 4 days in all
channels, in agreement
with the results shown in Fig.
3C, confirming
that this strain
of
P. putida does not become established
easily in the community.
Accumulation of transconjugants occurred
during the first 2 days
(Fig.
4D), but only in the channel with the
highest concentration
of indigenous
P. putida RI cells did
accumulation continue. It
is striking that even small decreases in the
relative numbers
of
P. putida RI cells in the community
eventually led to a cessation
of transconjugant accumulation. Thus, the
size of the preexisting
pool of
P. putida RI cells in the
biofilm community significantly
influenced transconjugant establishment
and the introduction of
new genetic traits.
View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4.
Time course analysis of the distribution of donor cells,
P. putida RI, and transconjugants relative to the total
number of cells collected from flow channel effluents. Without changing
the inoculation concentration of the two other isolates in the model
community, P. putida RI was introduced in three different
concentrations of 105 (), 107 (), and
108 () CFU/ml. Donor cells (P. putida
KT2442/TOLgfpmut3b) (5 · 108 CFU/ml) were
introduced at day 2. Total counts (A) were enumerated on pure LB broth
plates. The Nalr P. putida RI cells (B),
Rifr donor cells (C), and Nalr Kmr
transconjugants (D) were enumerated on LB broth plates containing the
appropriate antibiotics, and the numbers were taken relative to the
total counts. Each point is the average of two individual
experiments.
|
|
In situ visualization of transconjugants in the biofilm
community.
Tagging of the TOL plasmid with a gfp gene
(encoding the green fluorescent protein Gfpmut3b) fused to the strong
lac promoter PA1/O4/O3 (see Materials
and Methods) allowed us to monitor the in situ establishment of the
plasmid within the biofilm. To specifically follow the occurrence and
growth of transconjugants, we further inserted the lacI gene
in the chromosome of the donor strain, P. putida KT2442,
resulting in repression of gfp expression from the plasmid.
Thus, expression of the gfp gene will be induced upon
transfer of the TOL plasmid to a recipient in the community (P. putida RI) not harboring the lacI gene (zygotic
induction of fluorescence).
In an experiment where donor cells were introduced at a concentration
of 10
6 CFU/ml, regions with high densities of
transconjugants were observed.
One such "high-density zone" was
observed for 2 days. Five days
after introduction of the donor a
strongly green-fluorescent microcolony
was observed (Fig.
5A), and
other fluorescent microcolonies were
found downstream but not upstream
of this microcolony. In the
following days a progressively increasing
number of fluorescent
microcolonies were detected in this hot-spot
region (Fig.
5B).
Based on the results obtained here and described above, we suggest that
in the first microcolony shown in Fig.
5A
the TOL
plasmid initially transferred from a donor cell (
P. putida KT2442)
to a recipient cell (
P. putida RI). The
growth advantage of the
resulting transconjugant cell allowed the
transconjugant cell
and its progeny to grow quickly and consequently to
produce a
cluster of fluorescent cells. Subsequently, some of the cells
detached and were carried by the substrate flow further downstream,
where they again became established, forming new clusters of
transconjugants.
According to this interpretation, each "colony" of
transconjugants
in a flow channel arose from a single horizontal
plasmid transfer
event followed by effective proliferation of the
progeny cells.
View larger version (57K):
[in this window]
[in a new window]
|
FIG. 5.
On-line monitoring of transconjugant proliferation on
microcolonies in the direction of flow at days 5 and 6 after donor
introduction. The white patches are regions with strong
green-fluorescent signal (microcolonies with transconjugants), and the
gray regions are weak autofluorescent signals emitted from P. putida cells. This signal is easy to distinguish from the strong
green-fluorescent signal emitted from cells expressing Gfp and could be
used to visualize the location of noninfected microcolonies. On day 5 (A) a strongly green-fluorescent microcolony (solid arrow) was observed
and other green-fluorescent microcolonies were located in a region
straight downstream from this colony, but not upstream. On day 6 (B)
more green-fluorescent colonies were observed. The scale bar also
indicates the direction of flow. Open arrows indicate examples of
microcolonies which had been infected with transconjugants from day 5 to day 6.
|
|
The more precise organization of the transconjugants relative to the
indigenous recipient cells of
P. putida RI and the other
members of the community was investigated 8 days after introduction
of
10
8 CFU of donor cells of
P. putida KT2442/ml,
carrying the
gfp-tagged
TOL plasmid. The biofilm was fixed
and embedded, and in situ hybridization
was performed in combination
with SCLM. By using the probe PP986
targeting
P. putida
cells, the spatial distribution of transconjugant
(fluorescent) cells
and noninfected recipient cells could be visualized.
In addition, the
probe ACN449 was used to target
Acinetobacter,
the other dominant member
of the community.
Obviously, the donor and recipient
P. putida strains cannot
be distinguished with the specific 16S ribosomal DNA hybridization
probe used here. However, due to the poor establishment of the
P. putida KT2442 donor cells relative to the
P. putida RI
recipient
cells (compare Fig.
3C with B), most
P. putida
cells identified
by the PP986 probe were assumed to be
P. putida RI cells. Figure
6A shows a
representative region of the biofilm.
View larger version (71K):
[in this window]
[in a new window]
|
FIG. 6.
(A) Spatial distribution of green-fluorescent
transconjugants (green or yellow) relative to noninfected P. putida RI cells and Acinetobacter sp. strain C6 in a
biofilm analyzed 8 days after introduction of donor cells. The
organisms P. putida (red) and Acinetobacter sp.
strain C6 (purple) were identified by hybridization. After
hybridization, green-fluorescent transconjugants appear as either
yellow or green, depending on the ratio between the green Gfp signal
and the red hybridization signal. The x-y plot is presented as a SFP,
where long shadows indicate a large and/or high microcolony. Shown to
the right and below are vertical sections through the biofilm collected
at the positions indicated by the white triangles. (B) Magnification of
a P. putida colony with green-fluorescent cells covering the
surface. Vertical sections through the colony are shown to the right
and below. The microcolony is a SFP of a region 10 to 19 µm from the
glass surface.
|
|
Similar to the data presented in Fig.
1A,
Acinetobacter was
preferentially located in the substratum and
P. putida RI
cells
were located in the upper layers, organized in clusters
(microcolonies)
sticking up from the surface. With few exceptions, the
P. putida RI microcolonies were covered with
green-fluorescent transconjugant
cells.
A magnification of a microcolony is shown in Fig.
6B. A vertical cross
section of the colony further shows how the transconjugants
appear in
layers of cells covering the colony. Inspection of a
number of images
like the one presented in Fig.
6 showed that
transconjugant cells only
very rarely became established as new
microcolonies. Instead, they were
observed to be preferentially
on top of already established
microcolonies of recipient cells.
This supports the results shown in
Fig.
5, where it was observed
that the green-fluorescent clusters
always showed up on existing
microcolonies. Thus, the dominant mode of
establishment of cells
harboring new genetic information seems to be
colonization of
existing recipient microcolonies in the flow chambers.
This would
explain why accumulation of transconjugants in the biofilm
is
strongly dependent on the relative concentration of recipient
P. putida RI cells (as indicated in Fig.
4).
Although the transconjugant and recipient cells seemed to be extremely
tightly associated in the microcolonies, horizontal
transfer of the TOL
plasmid through the entire recipient colony
was never observed. This
observation is analogous to our previous
finding that TOL plasmid
transfer between isogenic
P. putida KT2442
donor and
recipient colonies growing on an agar surface only occurred
in a narrow
border zone between the two colonies (
8).
A number of explanations may account for these observations. Previous
studies have shown that TOL plasmid transfer is strongly
dependent on
the physiological state of the bacteria (
36,
37).
If the
P. putida RI microcolonies contained a steep substrate
gradient from the surface to the inner parts, only cells at the
surface
of the microcolony would be exposed to nutrient concentrations
sufficiently high to allow plasmid transfer.
Another explanation could be that although the TOL plasmid has been
reported to be naturally derepressed for pilus synthesis
(
5), this might only be true for cells grown under optimal
conditions in well-defined environments. In more complex environments,
where cells are organized in dense microbial communities, newly
formed
transconjugants may be exposed to a number of environmental
signals,
which could cause repression of pilus synthesis and consequently
suppress further conjugation.
It is also possible that the recipient cells in a colony and the newly
formed transconjugant cells on the surface of the colony
will grow and
develop as separate cell lines due to small differences
in their
phenotypes. Studies of colonies growing on agar surfaces
have shown
that even very small changes (a single mutation) in
a cell may give
rise to the formation of colony sectors caused
by individual cell lines
growing out from the center in separate
zones (
8,
35).
Finally, it is possible that the Gfp protein does not fold correctly
due to a low oxygen tension in the middle of a colony
a
possibility
that was tested as follows. The biofilm in one flow
chamber was
disintegrated, and it was found that the relative
proportion of
green-fluorescent cells constituted approximately
10% of the total
population when counted directly under the microscope,
a number which
correlated well with the proportion of kanamycin-
and
nalidixic-resistant cells (i.e., transconjugants) determined
by plating
on the selective plates, strongly indicating that all
the
transconjugants carrying the TOL plasmid are also green fluorescent.
In conclusion, we have shown that a new biochemical pathway offering a
growth-selective advantage can be introduced effectively
in a mixed
microbial surface community when carried on a conjugative
plasmid.
Successful establishment of the new genetic information
was independent
of the efficiency with which the donor strain
itself could be
established; however, proliferation of the transconjugant
cells
occurred primarily on the surfaces of preexisting colonies
of isogenic
recipient cells in the community.
| |
ACKNOWLEDGMENTS |
This work was supported by grants from the Danish Biotechnology
Program.
Brendan Cormack, Rafael Valdivia, and Stanley Falkow are acknowledged
for the gift of the gfpmut3b allele. We also thank Anne Nielsen and Tove Johansen for technical assistance.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology, Building 301, The Technical University of Denmark,
DK-2800 Lyngby, Denmark. Phone: 45 45 25 25 13. Fax: 45 45 88 73 28. E-mail: sm{at}im.dtu.dk.
| |
REFERENCES |
| 1.
|
Amann, R. I.,
L. Krumholz, and D. A. Stahl.
1990.
Fluorescent-oligonucleotide probing of whole cells for determinative, phylogenetic, and environmental studies in microbiology.
J. Bacteriol.
172:762-770[Abstract/Free Full Text].
|
| 2.
|
Amann, R. I.,
W. Ludwig, and K. H. Schleifer.
1995.
Phylogenetic identification and in situ detection of individual microbial cells without cultivation.
Microbiol. Rev.
59:143-169[Abstract/Free Full Text].
|
| 3.
|
Andersen, J. B.,
C. Sternberg,
L. K. Poulsen,
S. P. Bjørn,
M. Givskov, and S. Molin.
1998.
New unstable variants of green fluorescent protein for studies of transient gene expression in bacteria.
Appl. Environ. Microbiol.
64:2240-2246[Abstract/Free Full Text].
|
| 4.
|
Boyer, H. W., and D. Roulland-Dussoix.
1969.
A complementation analysis of the restriction and modification of DNA in Escherichia coli.
J. Mol. Biol.
41:459[Medline].
|
| 5.
|
Bradley, D. E., and P. A. Williams.
1982.
The TOL plasmid is naturally derepressed for transfer.
J. Gen. Microbiol.
128:3019-3024[Abstract/Free Full Text].
|
| 6.
|
Bujard, H., and M. Lanzer.
1988.
Promoters largely determine the efficiency of repressor action.
Proc. Natl. Acad. Sci. USA
85:8973-8977[Abstract/Free Full Text].
|
| 7.
|
Chalfie, M.,
Y. Tu,
G. Euskirchen,
W. W. Ward, and D. C. Prasher.
1994.
Green fluorescent protein as a marker for gene expression.
Science
263:802-805[Abstract/Free Full Text].
|
| 8.
|
Christensen, B. B.,
C. Sternberg, and S. Molin.
1996.
Bacterial plasmid conjugation on semi-solid surfaces monitored with the green fluorescent protein (Gfp) from Aequorea victoria as a marker.
Gene
173:59-65[Medline].
|
| 9.
|
Clark, J. D., and O. Maaløe.
1967.
DNA replication and the division cycle in Escherichia coli.
J. Mol. Biol.
21:99-112.
|
| 10.
|
Cormack, B. P.,
R. H. Valdivia, and S. Falkow.
1996.
FACS-optimized mutants of the green fluorescent protein (GFP).
Gene
173:33-38[Medline].
|
| 11.
|
de Lorenzo, V.,
M. Herrero,
U. Jakubzik, and K. N. Timmis.
1990.
Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in gram-negative eubacteria.
J. Bacteriol.
172:6568-6572[Abstract/Free Full Text].
|
| 12.
|
de Lorenzo, V., and K. N. Timmis.
1994.
Analysis and construction of stable phenotypes in Gram-negative bacteria with Tn5- and Tn10-derived mini-transposons.
Methods Enzymol.
235:386-405[Medline].
|
| 13.
|
De Rore, H.,
K. Demolder,
K. De Wilde,
E. Top,
F. Houwen, and W. Verstraete.
1994.
Transfer of the catabolic plasmid RP4::Tn4371 to indigenous soil bacteria and its effect on respiration and biphenyl breakdown.
FEMS Microbiol. Ecol.
15:71-78.
|
| 14.
|
Dhandayuthapani, S.,
L. E. Via,
C. A. Thomas,
P. M. Horowitz,
D. Deretic, and V. Deretic.
1995.
Green fluorescent protein as a marker for gene expression and cell biology of mycobacterial interactions with macrophages.
Mol. Microbiol.
17:901-912[Medline].
|
| 15.
|
DiGiovanni, G. D.,
J. W. Neilson,
I. L. Pepper, and N. A. Sinclair.
1996.
Gene transfer of Alcaligenes eutrophus JMP134 plasmid pJP4 to indigenous soil recipients.
Appl. Environ. Microbiol.
62:2521-2526[Abstract].
|
| 16.
|
Eberl, L.,
R. Schulze,
A. Ammendola,
O. Geisenberger,
R. Erhart,
C. Sternberg,
S. Molin, and R. I. Amann.
1997.
Use of green fluorescent protein as a marker for ecological studies of activated sludge communities.
FEMS Microbiol. Ecol.
149:77-83.
|
| 17.
|
Fulthorpe, R. R., and R. C. Wyndham.
1989.
Survival and activity of a 3-chlorobenzoate-catabolic genotype in a natural system.
Appl. Environ. Microbiol.
55:1584-1590[Abstract/Free Full Text].
|
| 18.
|
Fulthorpe, R. R., and R. C. Wyndham.
1991.
Transfer and expression of the catabolic plasmid pBRC60 in wild bacterial recipients in a freshwater ecosystem.
Appl. Environ. Microbiol.
57:1546-1553[Abstract/Free Full Text].
|
| 19.
|
Fulthorpe, R. R., and R. C. Wyndham.
1992.
Involvement of a chlorobenzoate-catabolic transposon, Tn5271, in community adaptation to chlorobiphenyl, chloroaniline and 2,4-dichlorophenoxyacetic acid in a freshwater ecosystem.
Appl. Environ. Microbiol.
58:314-325[Abstract/Free Full Text].
|
| 20.
|
Goldstien, R. M.,
L. M. Mallory, and M. Alexander.
1985.
Reasons for possible failure of inoculation to enhance biodegradation.
Appl. Environ. Microbiol.
50:977-983[Abstract/Free Full Text].
|
| 21.
|
Herrero, M.,
V. de Lorenzo, and K. N. Timmis.
1990.
Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable chromosomal insertion of foreign genes in gram-negative bacteria.
J. Bacteriol.
172:6557-6567[Abstract/Free Full Text].
|
| 22.
|
Kessler, B.,
V. de Lorenzo, and K. N. Timmis.
1992.
A general system to integrate lacZ fusions into the chromosomes of Gram-negative eubacteria: regulation of the Pm promoter of the TOL plasmid studied with all controlling elements in monocopy.
Mol. Gen. Genet.
233:293-301[Medline].
|
| 23.
|
Kristensen, C. S.,
L. Eberl,
J. M. Sanchez-Romero,
M. Givskov,
S. Molin, and V. de Lorenzo.
1995.
Site-specific deletions of chromosomally located DNA segments with the multimer resolution system of broad-host-range plasmid RP4.
J. Bacteriol.
177:52-58[Abstract/Free Full Text].
|
| 24.
|
Lawrence, J. R.,
D. R. Korber,
G. M. Wolfaardt, and D. E. Caldwell.
1995.
Bacterial behavioural strategies at interfaces, p. 1-75.
In
J. G. Jones (ed.), Advances in microbial ecology. Plenum Press, New York, N.Y.
|
| 25.
|
Leser, T. D.,
M. Boye, and N. B. Hendriksen.
1995.
Survival and activity of Pseudomonas sp. strain B13(FR1) in a marine microcosm determined by quantitative PCR and an rRNA-targeting probe and its effect on the indigenous bacterioplankton.
Appl. Environ. Microbiol.
61:1201-1207[Abstract].
|
| 26.
|
Maidak, B. L.,
G. J. Olsen,
N. Larsen,
R. Overbeek,
M. J. McCaughey, and C. R. Woese.
1997.
The RDP (Ribosomal Database Project).
Nucleic Acids Res.
25:109-110[Abstract/Free Full Text].
|
| 27.
|
Massol-Deyá, A. A.,
J. Whallon,
R. F. Hickey, and J. M. Tiedje.
1995.
Channel structures in aerobic biofilms of fixed-film reactors treating contaminated groundwater.
Appl. Environ. Microbiol.
61:769-777[Abstract].
|
| 28.
|
McClure, N. C.,
A. J. Weightman, and J. C. Fry.
1989.
Survival of Pseudomonas putida UWC1 containing cloned catabolic genes in a model activated-sludge unit.
Appl. Environ. Microbiol.
55:2627-2634[Abstract/Free Full Text].
|
| 29.
|
Møller, S.,
A. R. Pedersen,
L. K. Poulsen,
E. Arvin, and S. Molin.
1996.
Activity and three-dimensional distribution of toluene-degrading Pseudomonas putida in a multispecies biofilm assessed by quantitative in situ hybridization and scanning confocal laser microscopy.
Appl. Environ. Microbiol.
62:4632-4640[Abstract].
|
| 30.
|
Møller, S.,
C. Sternberg,
J. B. Andersen,
B. B. Christensen,
J. L. Ramos,
M. Givskov, and S. Molin.
1998.
In situ gene expression in mixed-culture biofilms: evidence of metabolic interactions between community members.
Appl. Environ. Microbiol.
64:721-732[Abstract/Free Full Text].
|
| 31.
|
Nielson, J. W.,
K. L. Josephson,
S. D. Pillai, and I. L. Pepper.
1992.
Polymerase chain reaction and gene probe detection of the 2,4-dichlorophenoxyacetic acid degradation plasmid, pJP4.
Appl. Environ. Microbiol.
58:1271-1275[Abstract/Free Full Text].
|
| 32.
|
Nüblein, K.,
D. Maris,
K. Timmis, and D. F. Dwyer.
1992.
Expression and transfer of engineered catabolic pathways harbored by Pseudomonas spp. introduced into activated sludge microcosms.
Appl. Environ. Microbiol.
58:3380-3386[Abstract/Free Full Text].
|
| 33.
|
Poulsen, L. K.,
G. Ballard, and D. A. Stahl.
1993.
Use of rRNA fluorescence in situ hybridization for measuring the activity of single cells in young and established biofilms.
Appl. Environ. Microbiol.
59:1354-1360[Abstract/Free Full Text].
|
| 34.
|
Sayler, G. S., and A. C. Layton.
1990.
Environmental application of nucleic acid hybridization.
Annu. Rev. Microbiol.
44:625-648[Medline].
|
| 35.
|
Shapiro, J. A.
1984.
The use of Mudlac transposons as tools for vital staining to visualize clonal and non-clonal patterns of organization in bacterial growth on agar surfaces.
J. Gen. Microbiol.
130:1169-1181[Abstract/Free Full Text].
|
| 36.
|
Smets, B. F.,
B. E. Rittmann, and D. A. Stahl.
1993.
The specific growth rate of Pseudomonas putida PAW1 influences the conjugal transfer rate of the TOL plasmid.
Appl. Environ. Microbiol.
59:3430-3437[Abstract/Free Full Text].
|
| 37.
|
Smets, B. F.,
B. E. Rittmann, and D. A. Stahl.
1995.
Quantification of the effect of substrate concentration on the conjugal transfer rate of the TOL plasmid in short-term batch mating experiments.
Lett. Appl. Microbiol.
21:167-172[Medline].
|
| 38.
|
Stark, M. J. R.
1987.
Multicopy expression vectors carrying the lac repressor gene for regulated high-level expression.
Gene
51:255-267[Medline].
|
| 39.
|
Steffan, R. J., and R. M. Atlas.
1988.
DNA amplification to enhance detection of genetically engineered bacteria in environmental samples.
Appl. Environ. Microbiol.
54:2185-2191[Abstract/Free Full Text].
|
| 40.
|
Veal, D. A.,
H. W. Stokes, and G. Daggard.
1992.
Genetic exchange in natural microbial communities.
Adv. Microb. Ecol.
12:383-430.
|
| 41.
|
Wagner, M.,
R. I. Amann,
P. Kämpfer,
B. Assmus,
A. Hartmann,
P. Hutzler,
N. Springer, and K. H. Schleifer.
1995.
Identification and in situ detection of gram-negative filamentous bacteria in activated sludge.
Syst. Appl. Microbiol.
17:405-417.
|
| 42.
|
Webb, C. D.,
A. Decatur,
A. Teleman, and R. Losick.
1995.
Use of green fluorescent protein for visualization of cell-specific gene expression and subcellular protein localization during sporulation in Bacillus subtilis.
J. Bacteriol.
177:5906-5911[Abstract/Free Full Text].
|
| 43.
|
Williams, P. A., and K. Murray.
1974.
Metabolism of benzoate and the methylbenzoates by Pseudomonas putida (arvilla) mt-2: evidence for the existence of a TOL plasmid.
J. Bacteriol.
120:416-423[Abstract/Free Full Text].
|
| 44.
|
Winkler, J.,
K. N. Timmis, and R. A. Snyder.
1995.
Tracking the response of Burkholderia cepacia G4 5223-PR1 in aquifer microcosms.
Appl. Environ. Microbiol.
61:448-455[Abstract].
|
| 45.
|
Woese, C. R.
1987.
Bacterial evolution.
Microbiol. Rev.
51:221-271[Free Full Text].
|
| 46.
|
Wolfaardt, G. M.,
J. R. Lawrence,
J. V. Headly,
R. D. Robarts, and D. E. Caldwell.
1994.
Microbial exopolymers provide a mechanism for bioaccumulation of contaminants.
Microb. Ecol.
27:279-291.
|
| 47.
|
Wolfaardt, G. M.,
J. R. Lawrence,
R. D. Robarts,
S. J. Caldwell, and D. E. Caldwell.
1994.
Multicellular organization in a degradative biofilm community.
Appl. Environ. Microbiol.
60:434-446[Abstract/Free Full Text].
|
| 48.
|
Worsey, M. J., and P. A. Williams.
1975.
Metabolism of toluene and xylenes by Pseudomonas (putida (arvilla) [sic] mt-2: evidence for a new function of the TOL plasmid.
J. Bacteriol.
124:7-13[Abstract/Free Full Text].
|
| 49.
|
Yanisch-Perron, C.,
J. Vieira, and J. Messing.
1985.
Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.
Gene
33:103-119[Medline].
|
Appl Environ Microbiol, June 1998, p. 2247-2255, Vol. 64, No. 6
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ragan, M. A., Beiko, R. G.
(2009). Lateral genetic transfer: open issues.. Phil Trans R Soc B
364: 2241-2251
[Abstract]
[Full Text]
-
Briandet, R., Lacroix-Gueu, P., Renault, M., Lecart, S., Meylheuc, T., Bidnenko, E., Steenkeste, K., Bellon-Fontaine, M.-N., Fontaine-Aupart, M.-P.
(2008). Fluorescence Correlation Spectroscopy To Study Diffusion and Reaction of Bacteriophages inside Biofilms. Appl. Environ. Microbiol.
74: 2135-2143
[Abstract]
[Full Text]
-
Krone, S. M., Lu, R., Fox, R., Suzuki, H., Top, E. M.
(2007). Modelling the spatial dynamics of plasmid transfer and persistence. Microbiology
153: 2803-2816
[Abstract]
[Full Text]
-
Massoudieh, A., Mathew, A., Lambertini, E., Nelson, K. E., Ginn, T. R.
(2007). Horizontal Gene Transfer on Surfaces in Natural Porous Media: Conjugation and Kinetics. Vadose Zone J
6: 306-315
[Abstract]
[Full Text]
-
Koh, K. S., Lam, K. W., Alhede, M., Queck, S. Y., Labbate, M., Kjelleberg, S., Rice, S. A.
(2007). Phenotypic Diversification and Adaptation of Serratia marcescens MG1 Biofilm-Derived Morphotypes. J. Bacteriol.
189: 119-130
[Abstract]
[Full Text]
-
Weigel, L. M., Donlan, R. M., Shin, D. H., Jensen, B., Clark, N. C., McDougal, L. K., Zhu, W., Musser, K. A., Thompson, J., Kohlerschmidt, D., Dumas, N., Limberger, R. J., Patel, J. B.
(2007). High-Level Vancomycin-Resistant Staphylococcus aureus Isolates Associated with a Polymicrobial Biofilm. Antimicrob. Agents Chemother.
51: 231-238
[Abstract]
[Full Text]
-
Kadouri, D., Venzon, N. C., O'Toole, G. A.
(2007). Vulnerability of Pathogenic Biofilms to Micavibrio aeruginosavorus. Appl. Environ. Microbiol.
73: 605-614
[Abstract]
[Full Text]
-
Moons, P., Van Houdt, R., Aertsen, A., Vanoirbeek, K., Engelborghs, Y., Michiels, C. W.
(2006). Role of Quorum Sensing and Antimicrobial Component Production by Serratia plymuthica in Formation of Biofilms, Including Mixed Biofilms with Escherichia coli. Appl. Environ. Microbiol.
72: 7294-7300
[Abstract]
[Full Text]
-
Musovic, S., Oregaard, G., Kroer, N., Sorensen, S. J.
(2006). Cultivation-Independent Examination of Horizontal Transfer and Host Range of an IncP-1 Plasmid among Gram-Positive and Gram-Negative Bacteria Indigenous to the Barley Rhizosphere.. Appl. Environ. Microbiol.
72: 6687-6692
[Abstract]
[Full Text]
-
Hall-Stoodley, L., Hu, F. Z., Gieseke, A., Nistico, L., Nguyen, D., Hayes, J., Forbes, M., Greenberg, D. P., Dice, B., Burrows, A., Wackym, P. A., Stoodley, P., Post, J. C., Ehrlich, G. D., Kerschner, J. E.
(2006). Direct detection of bacterial biofilms on the middle-ear mucosa of children with chronic otitis media.. JAMA
296: 202-211
[Abstract]
[Full Text]
-
Lee, S. H., Lee, S. Y., Park, B. C.
(2005). Cell Surface Display of Lipase in Pseudomonas putida KT2442 Using OprF as an Anchoring Motif and Its Biocatalytic Applications. Appl. Environ. Microbiol.
71: 8581-8586
[Abstract]
[Full Text]
-
De Gelder, L., Vandecasteele, F. P. J., Brown, C. J., Forney, L. J., Top, E. M.
(2005). Plasmid Donor Affects Host Range of Promiscuous IncP-1{beta} Plasmid pB10 in an Activated-Sludge Microbial Community. Appl. Environ. Microbiol.
71: 5309-5317
[Abstract]
[Full Text]
-
Sherlock, O., Vejborg, R. M., Klemm, P.
(2005). The TibA Adhesin/Invasin from Enterotoxigenic Escherichia coli Is Self Recognizing and Induces Bacterial Aggregation and Biofilm Formation. Infect. Immun.
73: 1954-1963
[Abstract]
[Full Text]
-
Arango Pinedo, C., Smets, B. F.
(2005). Conjugal TOL Transfer from Pseudomonas putida to Pseudomonas aeruginosa: Effects of Restriction Proficiency, Toxicant Exposure, Cell Density Ratios, and Conjugation Detection Method on Observed Transfer Efficiencies. Appl. Environ. Microbiol.
71: 51-57
[Abstract]
[Full Text]
-
Sherlock, O., Schembri, M. A., Reisner, A., Klemm, P.
(2004). Novel Roles for the AIDA Adhesin from Diarrheagenic Escherichia coli: Cell Aggregation and Biofilm Formation. J. Bacteriol.
186: 8058-8065
[Abstract]
[Full Text]
-
McNeill, K., Hamilton, I. R.
(2004). Effect of acid stress on the physiology of biofilm cells of Streptococcus mutans. Microbiology
150: 735-742
[Abstract]
[Full Text]
-
Molbak, L., Licht, T. R., Kvist, T., Kroer, N., Andersen, S. R.
(2003). Plasmid Transfer from Pseudomonas putida to the Indigenous Bacteria on Alfalfa Sprouts: Characterization, Direct Quantification, and In Situ Location of Transconjugant Cells. Appl. Environ. Microbiol.
69: 5536-5542
[Abstract]
[Full Text]
-
Nancharaiah, Y. V., Wattiau, P., Wuertz, S., Bathe, S., Mohan, S. V., Wilderer, P. A., Hausner, M.
(2003). Dual Labeling of Pseudomonas putida with Fluorescent Proteins for In Situ Monitoring of Conjugal Transfer of the TOL Plasmid. Appl. Environ. Microbiol.
69: 4846-4852
[Abstract]
[Full Text]
-
Gilbert, P., McBain, A. J.
(2003). Potential Impact of Increased Use of Biocides in Consumer Products on Prevalence of Antibiotic Resistance. Clin. Microbiol. Rev.
16: 189-208
[Abstract]
[Full Text]
-
Hendrickx, L., Hausner, M., Wuertz, S.
(2003). Natural Genetic Transformation in Monoculture Acinetobacter sp. Strain BD413 Biofilms. Appl. Environ. Microbiol.
69: 1721-1727
[Abstract]
[Full Text]
-
Kaplan, J. B., Meyenhofer, M. F., Fine, D. H.
(2003). Biofilm Growth and Detachment of Actinobacillus actinomycetemcomitans. J. Bacteriol.
185: 1399-1404
[Abstract]
[Full Text]
-
Christensen, B. B., Haagensen, J. A. J., Heydorn, A., Molin, S.
(2002). Metabolic Commensalism and Competition in a Two-Species Microbial Consortium. Appl. Environ. Microbiol.
68: 2495-2502
[Abstract]
[Full Text]
-
Gunasekera, T. S., Sorensen, A., Attfield, P. V., Sorensen, S. J., Veal, D. A.
(2002). Inducible Gene Expression by Nonculturable Bacteria in Milk after Pasteurization. Appl. Environ. Microbiol.
68: 1988-1993
[Abstract]
[Full Text]
-
Palmer, R. J. Jr., Kazmerzak, K., Hansen, M. C., Kolenbrander, P. E.
(2001). Mutualism versus Independence: Strategies of Mixed-Species Oral Biofilms In Vitro Using Saliva as the Sole Nutrient Source. Infect. Immun.
69: 5794-5804
[Abstract]
[Full Text]
-
Andersen, J. B., Heydorn, A., Hentzer, M., Eberl, L., Geisenberger, O., Christensen, B. B., Molin, S., Givskov, M.
(2001). gfp-Based N-Acyl Homoserine-Lactone Sensor Systems for Detection of Bacterial Communication. Appl. Environ. Microbiol.
67: 575-585
[Abstract]
[Full Text]
-
Li, Y.-H., Lau, P. C. Y., Lee, J. H., Ellen, R. P., Cvitkovitch, D. G.
(2001). Natural Genetic Transformation of Streptococcus mutans Growing in Biofilms. J. Bacteriol.
183: 897-908
[Abstract]
[Full Text]
-
Cvitkovitch, D.G.
(2001). Genetic Competence and Transformation in Oral Streptococci. CROBM
12: 217-243
[Abstract]
[Full Text]
-
Davey, M. E., O'toole, G. A.
(2000). Microbial Biofilms: from Ecology to Molecular Genetics. Microbiol. Mol. Biol. Rev.
64: 847-867
[Abstract]
[Full Text]
-
Joyner, D. C., Lindow, S. E.
(2000). Heterogeneity of iron bioavailability on plants assessed with a whole-cell GFP-based bacterial biosensor. Microbiology
146: 2435-2445
[Abstract]
[Full Text]
-
Aspiras, M. B., Kazmerzak, K. M., Kolenbrander, P. E., McNab, R., Hardegen, N., Jenkinson, H. F.
(2000). Expression of Green Fluorescent Protein in Streptococcus gordonii DL1 and Its Use as a Species-Specific Marker in Coadhesion with Streptococcus oralis 34 in Saliva-Conditioned Biofilms In Vitro. Appl. Environ. Microbiol.
66: 4074-4083
[Abstract]
[Full Text]
-
Ramos, C., Mølbak, L., Molin, S.
(2000). Bacterial Activity in the Rhizosphere Analyzed at the Single-Cell Level by Monitoring Ribosome Contents and Synthesis Rates. Appl. Environ. Microbiol.
66: 801-809
[Abstract]
[Full Text]
-
Sternberg, C., Christensen, B. B., Johansen, T., Toftgaard Nielsen, A., Andersen, J. B., Givskov, M., Molin, S.
(1999). Distribution of Bacterial Growth Activity in Flow-Chamber Biofilms. Appl. Environ. Microbiol.
65: 4108-4117
[Abstract]
[Full Text]
-
Licht, T. R., Christensen, B. B., Krogfelt, K. A., Molin, S.
(1999). Plasmid transfer in the animal intestine and other dynamic bacterial populations: the role of community structure and environment. Microbiology
145: 2615-2622
[Abstract]
[Full Text]
-
Hausner, M., Wuertz, S.
(1999). High Rates of Conjugation in Bacterial Biofilms as Determined by Quantitative In Situ Analysis. Appl. Environ. Microbiol.
65: 3710-3713
[Abstract]
[Full Text]
Top
Abstract
Introduction
