Previous Article | Next Article ![]()
Appl Environ Microbiol, July 1998, p. 2403-2408, Vol. 64, No. 7
Departamento de Microbiología y
Genética, Instituto de Microbiología
Bioquímica, Universidad de Salamanca, 37007 Salamanca,
Spain
Received 2 February 1998/Accepted 22 April 1998
Transcription of the repressible acid phosphatase gene
(KIPHO5) in Kluyveromyces lactis is strongly
regulated in response to the level of inorganic phosphate
(Pi) present in the growth medium. We have begun a study of
the promoter region of this gene in order to identify sequences
involved in the phosphate control of KIPHO5 expression and
to design new expression-secretion systems in K. lactis. Deletion analysis and directed mutagenesis revealed two
major identical upstream activating sequences (UAS) CACGTG at positions Kluyveromyces lactis has
recently become an attractive microbial host for the expression of
foreign genes and protein secretion for several reasons, including (i)
its food grade status, since K. lactis is present in
various milk products it is accepted as "GRAS" (generally
recognized as safe); (ii) its excellent fermentation characteristics (14); (iii) the existence of both
episomal and integrative vectors (45); and (iv) its
ability to secrete high-molecular-weight proteins (9, 14, 15, 34,
39).
The promoter and the secretory signal are key elements in all
expression systems. Several Saccharomyces cerevisiae
promoters, including UASgal/CYC1 (25),
PGK (7, 14), PHO5 (6), and GAL7 (4), and secretory signals, including MF The availability of a variety of K. lactis-based
expression systems is desirable both from a commercial standpoint and
from a research standpoint. Accordingly, our laboratory has
isolated several K. lactis-regulated genes. One of
them is the repressible KIPHO5 gene that encodes a secreted
acid phosphatase (APase [12]). The gene has all the
features necessary for the basis of an alternative expression system
for the secretion of heterologous proteins in K. lactis. The expression of KIPHO5 can be turned on by
the simple and cheap procedure of lowering the Pi
concentration in the medium (12).
Furthermore, to obtain deregulated strains of K. lactis
in response to Pi, we took advantage of the fact that the
KIPHO5 gene strongly resembles the ScPHO5 gene,
whose promoter region has been extensively analyzed (36,
43), as has its secretory signal (1, 2, 17) and its
use in heterologous protein production (7, 20). The present
study reports on a functional analysis, using a combination of deletion
and directed mutagenesis, of the KIPHO5 promoter. Three
upstream activating sequence (UAS) elements, UAS1, UAS2, and UAS3,
were located in the promoter. Deletions or nucleotide substitution
in all of them show reduced transcription of KIPHO5. The aim
of this study was to use the regulatory elements and the secretion
signal of the secreted KIPho5p encoded by the repressible
KIPHO5 gene of K. lactis to develop a
regulated secretion system for heterologous proteins with trout
growth hormone (coded by tGHII) as a model protein.
Strains and media.
The Escherichia coli strains
used for transformation and amplification of recombinant DNA were (i)
HB101 F
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Heterologous Protein Secretion Directed by a Repressible Acid
Phosphatase System of Kluyveromyces lactis: Characterization
of Upstream Region-Activating Sequences in the
KIPHO5 Gene
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References
430 (UAS1) and
192 (UAS2) relative to the ATG
initiation codon. These sequences are identical to those described for
Saccharomyces cerevisiae for the binding of Pho4p. Deletion
or directed mutagenesis of either one or both UAS reduce
KIPHO5 expression by the same amount (approximately 80%).
When fused to the coding region of trout growth hormone cDNA
(tGH-II), the promoter and signal peptide-encoding region
of the phosphate-repressible KIPHO5 gene drives the
expression of this gene and the secretion of the tGHII protein.
Synthesis of tGHIIp in K. lactis transformants
carrying this construct was found to be regulated by the Pi
present in the medium; derepression of heterologous protein expression
can therefore be achieved by lowering the Pi concentration.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References
(42), SUC2 (3), or those included in the
heterologous protein (HSA [13], prepro-HSA
[39]), have been used to generate heterologous protein secretion in K. lactis. Surprisingly, only three
K. lactis promoters (GAL7
[35], LAC4 [13, 39], and
ADH4 [11a]) and one secretory signal
(the one for the killer toxin [14, 35]) have been used in this context. Recently, efficient expression and secretion of mouse
-amylase (under the 128-kDa precursor protein and in shuttle vectors
with S. cerevisiae PHO5 and the PGK promoter and terminator sequences) into the culture medium have been described in
K. lactis (40).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results & Discussion
References
hsdS20 (rB
mB
) recA13 ara-14 proA2 lacY1 galK2
rpsL20 (Smr) xyl-5 mtl-1 supE44

(8); (ii) DH5
supE44
lacU169(
80 lacZ
M15)hsdR17 recA1 endA1
gyrA96 thi-1 relA1 (18); and (iii) MV1190
(lac-pro AB) thi supE
(sr1-recA)306::Tn10(Tetr)
(F': traD36 proAB lacIqZ
M15)
(Bio-Rad). E. coli strains were grown in Luria-Bertani broth.
1 as required. As derepression medium we used MM in
which the phosphate concentration was lowered to 10 mg/liter (low
Pi). The medium was buffered with 0.05 M citric acid-sodium
citrate (pH 4.3).
Cell extracts. Packed cells (approximately 18 mg, wet weight) were resuspended in citric buffer. Equal volumes of yeast cell suspension and glass beads (0.45 to 0.50 mm in diameter) were broken by mechanical shaking in a FastPrep FP120 homogenizer. This treatment disrupted >98% of the cells as judged by light microscope examination. The glass beads were removed by washing the broken-cell suspension. This fraction was called "total protein" (see Fig. 4) or cell extracts. The total amount of protein found in the culture medium was referred to as "extracellular protein."
Enzyme activity.
Acid phosphatase activity was assayed with
p-nitrophenyl phosphate (PNPP) (Sigma Chemical Co., St.
Louis, Mo.). The assay mixture was composed of 250 µl of enzyme
sample, 125 µl of 0.36 M citric acid-sodium citrate buffer (pH 4.3),
and 75 µl of 0.04 M PNPP. The reaction was initiated by the addition
of the substrate and terminated by the addition of 750 µl of 0.1 M
NaOH. One unit of activity was defined as the amount of enzyme which
released 1 nmol of p-nitrophenol in 1 min at 30°C.
-Galactosidase was assayed by the method of Miller (26).
1). K. lactis vectors are shown in Fig.
1A.
|
Protein assays. Protein content was determined colorimetrically by the method of Lowry et al. (24). Bovine serum albumin was used as a standard.
Endo H treatment.
Samples were incubated with
endo-
-N-acetylglucosaminidase H (Endo H) for the desired
times at 37°C in 0.05 M acetic acid-sodium buffer (pH 5.6) containing
0.001 M phenylmethylsulfonyl fluoride and 10 µM pepstatin.
Electrophoresis, electroblotting, and immunological detection. Slab gel electrophoresis was performed essentially as described by Laemmli (23). Electrotransfer of proteins to nitrocellulose membranes and immunological reactions were performed as described previously (11, 41).
Protein stains. Gel slabs were stained for protein by a silver staining method (27).
DNA manipulations. Total DNA from K. lactis was prepared as described for filamentous fungi (32). Restriction enzyme digestions and DNA ligations were performed according to the recommendations of the manufacturers. Isolation of plasmid DNA from E. coli was performed by standard procedures (37).
PCR amplifications. PCR experiments were performing with Taq DNA polymerase as recommended by the supplier (Perkin-Elmer Cetus Corp.). The PCR conditions to amplify K. lactis DNA were as follows: 10 ng of the selected plasmid was mixed with 50 pmol of each primer in a final reaction volume of 50 µl and subjected to 30 amplification cycles (95°C for 1 min, 42°C for 1 min, and 72°C for 1 min).
Sequence analysis of PCR fragment.
The DNA restriction
fragment harboring the corresponding KIPHO5 promoter fused
to the
-galactosidase was subcloned into the pBluescript plasmids
(SK+ and KS+; Stratagene), and a nested set of
closely spaced deletions was created by using exonuclease III (19,
37). All deletion endpoints, site-directed mutagenesis, and
the structures of each fusion plasmid were verified by DNA sequencing
and restriction mapping. The products of the sequencing reactions were
resolved on buffered gradient polyacrylamide-urea sequencing gels
(5) and exposed to Kodak XAR-5 X-ray film. DNA and
protein sequences were analyzed with the DNASIS and PROSIS
programs (Pharmacia-LKB and Hitachi), respectively.
| |
RESULTS AND DISCUSSION |
|---|
|
|
|---|
Basis of analysis of deletions and mapping cis-acting
regulatory sequences in the KIPHO5 flanking region.
To
mark important elements in the KIPHO5 promoter after its
comparison with the S. cerevisiae PHO5 promoter (12,
36), we defined a 456-bp upstream region that contained all the
putative cis-acting regulatory elements. Using complementary
oligonucleotides (pro1 and pro3 [see Fig. 3]), we PCR-amplified with
plasmid pEF1 as template (Fig. 1A) a 507-bp fragment comprising the
whole KIPHO5 promoter and all 17 amino acids of the signal
peptide, extended for HindIII (5') and SalI
(3') sites (the fragment was sequenced in order to ascertain the
correct PCR amplification). This fragment was fused with the E. coli lacZ gene, coming from plasmid pMC1871, as the reporter
(10) (Fig. 1B). An identical procedure was carried out
to amplify a 630-bp fragment of the KIPHO5 terminator with oligonucleotides ter 1 (AGTAACAAGTAAGTCTCATACCGA) and ter 3 (AAGATACCGGGTACCACTAGTATCGATCTTATATTTTGCTCT) to give plasmid
pEF10A (Fig. 1A). Insertion of this SpeI-SpeI fragment into the NheI fragment of KEp6 gave rise to
pEFLacK1 (Fig. 1A). We transformed a K. lactis ura3
strain previously constructed by us (12) with pEFLacK1 (see
Fig. 1A). On high-phosphate medium,
-galactosidase and acid
phosphatase activity levels remained constant regardless of
the incubation time (Fig. 2).
On low-phosphate medium, acid phosphatase and
-galactosidase were
derepressed (Fig. 2). The promoter region of KIPHO5 was then
screened for functionally important DNA sequences by the construction
of a series of deletion mutants (Fig. 3).
The effects of the deletions were assayed by measuring
-galactosidase activity on the Ura+ transformants
in low- and high-phosphate media. Our results pointed to an initial
regulatory region located between positions
436 and
352. Deletion
of this region elicited a decrease of 70 to 85% of total
-galactosidase activity. Further deletions did not produce any
further decrease in
-galactosidase activity (KD4, KD5, and KD6; Fig.
3). By comparison with the S. cerevisiae PHO5 promoter, we
identified two CACGTG upstream hexanucleotide sequences at
positions
430 and
192 in the KIPHO5 promoter.
|
|
Insertion of synthetic oligomers with modifications in the
UAS.
To confirm the putative UAS regulatory elements,
we carried out directed mutagenesis. We designed oligomers in
which the nucleotide sequence of each UAS had been changed (see Fig.
3). After PCR amplification and subcloning of the corresponding
fragments, all possible combinations were tested; the results are shown
in Fig. 3. Changes in the two previously described hexanucleotides
(UAS1 at position
430 and UAS2 at position
192) dramatically
decreased the level of
-galactosidase activity under derepression
conditions (low-Pi medium). The decrease in
-galactosidase activity was similar to that obtained by deletion of
the 276-bp fragment (KD6; Fig. 3).
430 and
425 and a proximal one
(UAS2) located between positions
192 and
187, and (ii) that
cooperation between both UAS is required for full expression of the
KIPHO5 gene.
In S. cerevisiae, genetic evidence has suggested that Pho2p
and Pho4p bind to or interact with UAS in the promoter region of the
phosphate-repressible acid phosphatase gene PHO5 (for a review, see reference 29). Conflicting data about
the binding sites of Pho4p and Pho2p in the S. cerevisiae
PHO5 promoter (4, 28, 36, 43) and for the
Penicillium chrysogenum phoA gene (16) have been
reported. The results shown in Fig. 3 are in agreement with those
described by Rudolph and Hinnen (36) and Vogel et al.
(43). We unequivocally identified the CACGTG
motif as being essential for the derepression of acid phosphatase
activity in K. lactis. The 6-bp motif was flanked by an
A residue (UAS1) or a G residue (UAS2) at the 5' end and by CA or TA
residues at the 3' end, respectively. Since no clear correlation
between the flanking sequences of either UAS, nor between those
described for S. cerevisiae, could be established, we
propose that only the hexanucleotide sequence would be relevant for
Pho4p binding to the promoter.
Another region, ACTTTCTAAGAAAGT (UAS3), located at
319 of
the ATG between UAS1 and UAS2, also reduces KIPHO5
expression (by approximately 20%; see KDC, Fig. 3) and appeared to be
involved in the regulation of KIPHO5 expression. This
region could be equivalent to the Pho2p binding site described in the
ScPHO5 promoter region (19, 43). Our
results, however, do not permit us to assign a defined role to this
region. No additive effects on
-galactosidase expression were
obtained by combining mutations in this region with mutations in UAS1
(KDD), UAS2 (KDE), or both (KDG) (Fig. 3).
Analysis of the promoter region of the Pichia pastoris acid
phosphatase (30) did not reveal any equivalent
hexanucleotide (CACGTG/T) over 313 bp upstream from the
initial ATG. Whether the identity between the cis-acting
elements in the ScPHO5 and KIPHO5 promoters might
be due to the close phylogenetic relationships between both yeasts
(31) or whether these UAS are essential regulatory elements
in all fungal acid phosphatases remains to be elucidated.
Detection and regulation by phosphate concentrations of tGHII secretion in K. lactis. Using the 456-bp promoter and the 51 bases corresponding to the 17 amino acids of the signal peptide of the KIPHO5, we accomplished an in-frame fusion with the trout growth hormone tGH-II gene (33) (Fig. 1C) to obtain plasmid pEFGHII (Fig. 1A). A BamHI-BamHI fragment of 1,686 kb was inserted into the BamHI site of plasmid KEp6 (Fig. 1A), yielding pEFKGHII (Fig. 1A). We transformed K. lactis 2353/152F with pEtGHII (Fig. 1A), which was kindly supplied by Eurogentec, and with our construction (pEFKGHII) selected eight Ura+ transformants from each transformation that were further analyzed. Liquid cultures were grown in MM, and cells in the exponential growth phase were collected and resuspended at 108 cells/ml in MM (Pi concentration, 1 g/liter [control culture]) and in low-Pi medium (Pi concentration, 0.01 g/liter [derepression medium]). The levels of tGHIIp in cell extracts and in the culture medium were determined by immunoassay. Figure 4A (lanes 1 and 3) shows that under repression conditions the amount of tGHIIp was undetectable. However, under derepression conditions trout growth hormone appeared both in cell extracts (Fig. 4A, lane 2) and in the culture medium (Fig. 4A, lane 4). The maximum amount of hormone was obtained after 8 to 10 h of incubation under derepression conditions, a finding that is in agreement with our previous results for obtaining the maximal amount of KIPho5p (12). All eight transformants assayed showed the same behavior. Trout growth hormone has two potential N-glycosylation sites (33), but the addition of tunicamycin to cell cultures or the treatment of cell extracts or supernatants with Endo H did not produce any alteration in the size of the band, suggesting that the protein was not glycosylated in K. lactis.
|
-factor signal
peptide remains to be elucidated.
Both types of expression vectors secrete the tGHII protein into the
culture medium efficiently (Fig. 4B, lanes 3 and 4). We quantified the
total amount tGHIIp produced with both vectors. Under our most
favorable conditions for acid phosphatase derepression (pH 4.3, 8 h of growth in low-Pi medium), we were able to produce about 20 times more tGHIIp (referred to as total cell or protein content) in the culture medium.
Our results show that it is possible to obtain high tGHIIp yields and
that even though further studies are needed to purify the hormone and
to test its biological activity, the useful regulatory properties of
the KIPHO5 promoter and the APase signal peptide may be
harnessed for production purposes.
| |
ACKNOWLEDGMENTS |
|---|
The authors wish to thank Eurogentec SA for providing plasmid pEtGHII and anti-tGHII rabbit antiserum.
This work was partially supported by grants from the CICYT (BIO92-0304 and BIO95-0518) and EU (BIO4-CT96-0003).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Departamento de Microbiología y Genética, Edificio Departamental, Avd. Campo Charro s/n, 37007 Salamanca, Spain. Phone: 34 923 294677. Fax: 34 923 224876. E-mail: ado{at}gugu.usal.es.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Arima, K.,
T. Oshima,
I. Kubota,
N. Nakamura,
T. Mizunaga, and A. Toh-e.
1983.
The nucleotide sequence of the yeast PHO5 gene: a putative precursor of repressible acid phosphatase contains a signal peptide.
Nucleic Acids Res.
11:1657-1673 |
| 2. | Bajwa, W., B. Meyhack, H. Rudolph, A. M. Schweingruber, and A. Hinnen. 1984. Structural analysis of the two tandemly repeated acid phosphatase genes in yeast. Nucleic Acids Res. 12:7722-7739. |
| 3. |
Bergkamp, R. J. M.,
I. M. Kool,
R. H. Geerse, and R. J. Planta.
1992.
Multiple-copy integration of the -galactosidase gene from Cyamopsis tetragonoloba into the ribosomal DNA of Kluyveromyces lactis.
Curr. Genet.
21:365-370[Medline].
|
| 4. |
Bergman, L. W.,
D. C. McClinton,
S. L. Madden, and L. H. Preiss.
1986.
Molecular analysis of the DNA sequences involved in the transcriptional regulation of the phosphate-repressible acid phosphatase gene (PHO5) of Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
83:6070-6074 |
| 5. |
Biggin, M. D.,
T. J. Gibson, and G. F. Hong.
1983.
Buffer gradient gels and 35S label as an aid to rapid DNA sequence termination.
Proc. Natl. Acad. Sci. USA
80:3963-3965 |
| 6. |
Blondeau, K.,
O. Boutur,
H. Boze,
G. Jung,
G. Moulin, and P. Galzy.
1994.
Development of high-cell-density fermentation for heterologous interleukin 1 production in Kluyveromyces lactis controlled by the PHO5 promoter.
Appl. Microbiol. Biotechnol.
41:324-329[Medline].
|
| 7. | Blondeau, K., H. Boze, G. Jung, G. Moulin, and P. Galzy. 1994. Physiological approach to heterologous human serum albumin production by Kluyveromyces lactis in chemostat culture. Yeast 10:1297-1303[Medline]. |
| 8. | Boyer, H., and D. Roulland-Dussoix. 1969. A complementary analysis of the restriction and modification of DNA in Escherichia coli. J. Mol. Biol. 41:459-472[Medline]. |
| 9. | Buckholz, R. G., and M. A. G. Gleeson. 1991. Yeast systems for the commercial production of heterologous proteins. Bio/Technology 9:1067-1072[Medline]. |
| 10. |
Casadaban, M. J.,
A. Martínez-Arias,
S. K. Shapira, and J. Chou.
1983.
-Galactosidase gene fusions for analyzing gene expression in Escherichia coli and yeasts.
Methods Enzymol.
100:293-308[Medline].
|
| 11. | Erickson, P. F., L. N. Minier, and R. S. Lasher. 1982. Quantitative electrophoretic transfer of polypeptides from SDS polyacrylamide gels to nitrocellulose sheets: a method for their re-use in immunoradiographic detection of antigens. J. Immunol. Methods 51:241-249[Medline]. |
| 11a. | Falcone, C. Personal communication. |
| 12. |
Fermiñán, E., and A. Domínguez.
1997.
The KIPHO5 gene encoding a repressible acid phosphatase in the yeast Kluyveromyces lactis: cloning, sequencing and transcriptional analysis of the gene, and purification and properties of the enzymes.
Microbiology
143:2615-2625 |
| 13. |
Fleer, R.,
X. J. Chen,
N. Amellal,
P. Yeh,
A. Fournier,
F. Guinet,
N. Gault,
D. Faucher,
F. Folliard,
H. Fukuhara, and J. F. Mayaux.
1991.
High-level secretion of correctly processed recombinant human interleukin-1 in Kluyveromyces lactis.
Gene
107:285-295[Medline].
|
| 14. | Fleer, R., P. Yeh, I. Maury, N. Amellal, A. Fournier, F. Bacchetta, P. Baduel, G. Jung, H. l'Hôte, J. Becquart, H. Fukuhara, and J. F. Mayaux. 1991. Stable multicopy vectors for high-level secretion of recombinant human serumalbumin in Kluyveromyces yeasts. Bio/Technology 9:968-975[Medline]. |
| 15. | Fleer, R. 1992. Engineering yeast for high level expression. Curr. Opin. Biotechnol. 3:486-496[Medline]. |
| 16. | Haas, J., B. Redl, E. Friedlin, and G. Stoffler. 1992. Isolation and analysis of the Penicillium chrysogenum phoA gene encoding a secreted phosphate-repressible acid phosphatase. Gene 113:129-133[Medline]. |
| 17. |
Haguenauer-Tsapis, R., and A. Hinnen.
1984.
A deletion that includes the signal peptidase cleavage site impairs processing, glycosylation and secretion of cell surface yeast acid phosphatase.
Mol. Cell. Biol.
4:2668-2675 |
| 18. | Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580[Medline]. |
| 19. | Henikoff, S. 1987. Unidirectional digestion with exonuclease III in DNA sequence analysis. Methods Enzymol. 155:156-165[Medline]. |
| 20. | Hinnen, A., B. Meyhack, and J. Heim. 1989. Heterologous gene expression in yeast, p. 193-213. In P. J. Barr, A. J. Brake, and P. Valenzuela (ed.), Yeast genetic engineering. Butterworths, London, England. |
| 21. | Hirst, K., F. Fisher, P. C. McAndrew, and C. R. Goding. 1994. The transcription factor, the Cdk, its cyclin and their regulator: directing the transcriptional response to a nutritional signal. EMBO J. 13:5410-5420[Medline]. |
| 22. | Kadowaki, H., T. Kadowaki, F. E. Wondisford, and S. I. Taylor. 1989. Use of polymerase chain reaction catalysed by Taq DNA polymerase for site-directed mutagenesis. Gene 76:161-166[Medline]. |
| 23. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline]. |
| 24. |
Lowry, O. H.,
N. J. Rosebrough,
A. L. Farr, and R. J. Randall.
1951.
Protein measurement with the Folin phenol reagent.
J. Biol. Chem.
193:265-275 |
| 25. | Martegani, E., N. Forlani, I. Mauri, D. Porro, W. D. Schleuning, and L. Albergina. 1992. Expression of high levels of human tissue plasminogen activator in yeast under the control of an inducible GAL promoter. Appl. Microbiol. Biotechnol. 37:604-608[Medline]. |
| 26. | Miller, J. H. 1972. Experiments in molecular genetics, p. 325-355. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 27. | Morrissey, J. M. 1981. Silver stain for proteins in polyacrylamide gels: a modified procedure with enhanced uniform sensitivity. Anal. Biochem. 117:307-310[Medline]. |
| 28. | Nakao, J., A. Miyanohara, A. Toh-e, and K. Matsubara. 1985. Saccharomyces cerevisiae PHO5 promoter region: location and function of the upstream activation site. Mol. Cell. Biol. 6:2613-2623. |
| 29. | Oshima, Y., N. Ogawa, and S. Harashima. 1996. Regulation of phosphate synthesis in Saccharomyces cerevisiae: a review. Gene 179:171-177[Medline]. |
| 30. | Payne, W. E., P. Gannon, and C. A. Kaiser. 1995. An inducible acid phosphatase from the yeast Pichia pastoris: characterization of the gene and its product. Gene 163:19-26[Medline]. |
| 31. | Pesole, G., M. Lotti, L. Alberghina, and C. Saccone. 1995. Evolutionary origin of non-universal CUGSer codon in some Candida species as inferred from a molecular phylogeny. Genetics 141:903-907[Abstract]. |
| 32. | Raeder, U., and P. Broda. 1985. Rapid preparation of DNA from filamentous fungi. Lett. Appl. Microbiol. 1:17-20. |
| 33. | Rentier-Deireu, F., D. Swennen, L. Mercier, M. Lion, O. Benrubi, and J. A. Martial. 1989. Molecular cloning and characterization of two forms of trout growth hormone cDNA: expression and secretion of tGH-II by Escherichia coli. DNA 8:109-117[Medline]. |
| 34. | Romanos, M. A., C. A. Scorer, and J. J. Clare. 1992. Foreign gene expression in yeasts: a review. Yeast 8:423-488[Medline]. |
| 35. | Rossolini, F. M., M. L. Riccio, E. Gallo, and C. L. Galeotti. 1992. Kluyveromyces lactis rDNA as a target for multiple integration by homologous recombination. Gene 119:75-81[Medline]. |
| 36. |
Rudolph, H., and A. Hinnen.
1987.
The yeast PHO5 promoter: phosphate-control elements and sequences mediating mRNA start-site selection.
Proc. Natl. Acad. Sci. USA
84:1340-1344 |
| 37. | Sambrook, J. E., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 38. |
Sánchez, M.,
F. J. Iglesias,
C. Santamaría, and A. Domínguez.
1993.
Transformation of Kluyveromyces lactis by electroporation.
Appl. Environ. Microbiol.
59:2087-2092 |
| 39. | Swinkels, B. W., A. J. J. van Ooyen, and F. J. Bonekamp. 1993. The yeast Kluyveromyces lactis as an efficient host for heterologous gene expression. Antonie Leeuwenhoek 64:187-201. |
| 40. |
Tokunaga, M.,
M. Ishibashi,
D. Tatsuda, and H. Tokunaga.
1997.
Secretion of mouse -amylase from Kluyveromyces lactis.
Yeast
13:699-706[Medline].
|
| 41. |
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of protein from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354 |
| 42. | van den Berg, J. A., K. J. van der Laken, A. J. J. van Ooyen, T. C. H. M. Renniers, K. Rietveld, A. Schaap, A. J. Brakes, R. J. Bishop, K. Shultz, D. Moyer, M. Richman, and J. R. Shuster. 1990. Kluyveromyces as a host for heterologous gene expression: expression and secretion of prochymosin. Bio/Technology 8:135-139[Medline]. |
| 43. |
Vogel, K.,
W. Hörz, and A. Hinnen.
1989.
The two positively acting regulatory proteins PHO2 and PHO4 physically interact with PHO5 upstream activation regions.
Mol. Cell. Biol.
9:2050-2057 |
| 44. |
von Heijne, G.
1986.
A new method for predicting signal sequence cleavage sites.
Nucleic Acids Res.
14:4683-4690 |
| 45. | Wesolowski-Louvel, M., K. D. Breunig, and H. Fukuhara. 1996. Kluyveromyces lactis, p. 139-201. In K. Wolf (ed.), Nonconventional yeasts in biotechnology. Springer-Verlag, Berlin, Germany. |
| 46. |
Wickerham, L. J.
1946.
A critical evaluation of the nitrogen assimilation tests commonly used in the classification of yeast.
J. Bacteriol.
52:293-301 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»