Appl Environ Microbiol, July 1998, p. 2513-2519, Vol. 64, No. 7
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Sequencing and Characterization of the xyl Operon of a
Gram-Positive Bacterium, Tetragenococcus halophila
Yasuo
Takeda,1
Kazuma
Takase,1
Ichiro
Yamato,1,* and
Keietsu
Abe2
Department of Biological Science and
Technology, Science University of Tokyo, 2641 Yamazaki,1 and
Research and
Development Division of Kikkoman Corporation, 399 Noda,2 Noda-shi, Chiba 278, Japan
Received 22 January 1998/Accepted 16 April 1998
 |
ABSTRACT |
The xyl operon of a gram-positive bacterium,
Tetragenococcus halophila (previously called
Pediococcus halophilus), was cloned and sequenced. The DNA
was about 7.7 kb long and contained genes for a ribose binding protein
and part of a ribose transporter, xylR (a putative
regulatory gene), and the xyl operon, along with its
regulatory region and transcription termination signal, in this order.
The DNA was AT rich, the GC content being 35.8%, consistent with the
GC content of this gram-positive bacterium. The xyl operon consisted of three genes, xylA, encoding a xylose
isomerase, xylB, encoding a xylulose kinase, and
xylE, encoding a xylose transporter, with predicted
molecular weights of 49,400, 56,400, and 51,600, respectively. The
deduced amino acid sequences of the XylR, XylA, XylB, and XylE proteins
were similar to those of the corresponding proteins in other
gram-positive and -negative bacteria, the similarities being 37 to
64%. Each polypeptide of XylB and XylE was expressed functionally in
Escherichia coli. XylE transported D-xylose in a sodium ion-dependent manner, suggesting that it is the first described xylose/Na+ symporter. The XylR protein contained
a consensus sequence for binding catabolites of glucose, such as
glucose-6-phosphate, which has been discovered in glucose and fructose
kinases in bacteria. Correspondingly, the regulatory region of this
operon contained a putative binding site of XylR with a palindromic
structure. Furthermore, it contained a consensus sequence, CRE
(catabolite-responsive element), for binding CcpA (catabolite control
protein A). We speculate that the transcriptional regulation of this
operon resembles the regulation of catabolite-repressible operons such
as the amy, lev, xyl, and
gnt operons in various gram-positive bacteria. We discuss
the significance of the regulation of gene expression of this operon in
T. halophila.
| |
INTRODUCTION |
A gram-positive bacterium,
Tetragenococcus halophila (previously called
Pediococcus halophilus) (7), is used to ferment soy sauce. Soy sauce tends to form browning pigments when stored for a
long time because of the amino-carbonyl reaction of amino acids with
aldoses, especially pentoses (1). The elimination of
pentoses from soy sauce should reduce the browning pigments (1). However, pentose utilization genes are under the
regulation of catabolite repression, which represses gene expression in
the presence of glucose and related catabolites. As a result, pentoses tend to remain unused after the fermentation of soy sauce
(1). Therefore, elucidation of the catabolite repression
regulatory system in this bacterium is the necessary step to establish
a strain which can use pentoses even in the presence of glucose and
thus improve the shelf life of soy sauce.
In gram-negative bacteria, catabolite repression is mediated via the
crr-cya signal transduction network (25). In
gram-positive bacteria, cyclic AMP is not necessarily found, and
catabolite repression is thought to be mediated via the HPr kinase and
CcpA pathways (12, 17, 22, 25, 34). Furthermore, many
catabolite repression systems are reported to be subject to inducer
exclusion or inducer expulsion (8, 19, 27, 33), which
prevents the uptake of or extrudes, respectively, the inducers of the
metabolic systems, making regulation more strict. The entire regulatory system of catabolite repression and inducer exclusion or inducer expulsion is called catabolite control.
The utilization of D-xylose in T. halophila is
strictly regulated by the presence of D-xylose as an
inducer and by the presence of glucose and related catabolites (1,
2). Neither inducer exclusion nor inducer expulsion has been
detected for this system (1). Some xylose metabolic systems
in other bacteria are reported to be moderately repressed by glucose
and its catabolites, and others are reported to be subject to inducer
exclusion or expulsion in addition to catabolite repression
(8-10, 13, 14, 21, 26, 33, 34, 36-38).
In this report, we sequenced the xyl operon of T. halophila and compared it with other xyl operons to
obtain insights into the regulatory mechanism of this operon.
| |
MATERIALS AND METHODS |
Abbreviations.
Abbreviations used are as follows: CRE,
catabolite-responsive element; CcpA, catabolite control protein A; HPr,
heat-stable histidine-containing protein; RBS, ribosome binding site.
Cloning and sequencing of the DNA containing the xyl
operon.
As the first step, we used two DNA sequences as the probes
for cloning: 23I
[GG(T/C)TCIT(T/G)IGG(T/C)TTIGG(T/C)TC(T/G/A)AT] and
17 [TTGGGG(T/C)GG(T/C)CG(T/C)GA(A/G)GG]. We
synthesized probe DNAs containing IMP and corresponding to the amino
acid sequences of the XylA protein of Lactobacillus pentosus
(29a); 23I and 17 correspond to the amino acid sequences
from positions 233 to 240 and from positions 190 to 195 of the L. pentosus XylA protein, respectively. T. halophila was
cultured in 1 liter of MRS medium (Difco) at 30°C for 2 days without
shaking (1). DNA from T. halophila was prepared
according to a previously described method (4). The DNA was
partially cut with Sau3AI, and 5- to 20-kb fragments were
fractionated by agarose gel electrophoresis and then extracted from the
gel (35). The DNA was inserted into a BamHI site
on 
phage vector EMBL3 (35) to construct a phage bank. A positive clone was selected by plaque hybridization with 23I or
17 DNA end labeled with [
-32P]ATP as a probe
(35). A SalI fragment (4.6 kb) was subcloned into
a phagemid pBluescriptII KS+ SalI site, producing pBKS+2-2. The cloned DNA lacked the upstream region of the xylA gene.
As the next step, we isolated a HindIII-SalI
fragment (1 kb) corresponding to the 5' part of the xylA
gene on pBKS+2-2 as the hybridization probe. T. halophila
DNA was cut with HindIII, and 3- to 8-kb fragments were
fractionated by centrifugation on a sucrose density gradient
(35). The DNA was used to make a phage bank by insertion
into a HindIII site on the ZAP Express vector.
Positive clones were used to infect Escherichia coli
XL1-Blue MRF' [
(mcrA)183
(mcrCB-hsdSMR-mrr)173 endA1 supE44 thi-1 recA1 gyrA96 relA1 lac (F' proAB lacIqZ
M15 Tn10)] and were subjected to in vivo excision
with the ExAssist helper phage, producing plasmid pBKXYL, according to the manufacturer's protocol (see below).
We determined all the nucleotide sequences for both strands of the
fragments on pBKS+2-2 and pBKXYL. The methods for sequencing and
computer analysis of the genes have been described elsewhere (41). A search of the homologous proteins in the EMBL and
GenBank Database Libraries was performed by use of the BLAST network
service (BLASTP version 1.4).
Expression of the xylA, xylB, and
xylE genes in E. coli.
We subcloned the
xylA, xylB, or xylE gene in E. coli expression vector pUTE500' (Kikkoman Co. Ltd., Tokyo, Japan)
(31) by inserting a PCR-amplified fragment obtained by use
of DNA primers corresponding to DNA sequences at the amino-terminal
region, including the appropriate NdeI restriction site at
the initiation codon of the respective gene, and at the
carboxyl-terminal region, including the appropriate NdeI
restriction site downstream of the termination codon (the GTG
initiation codons for xylB and xylE were changed to ATG). Primer sequences for xylA were
5'-GAAAGGTGGAAATCATATGGACTATTTTGAAAACGTTCC and
5'-C ATAATCCATTTCAATCACATATGCCTTCTATACCAAATAGTCATTAA GAAGCG, those for xylB were
5'-GGTATAGAAGGTACATATGATTGAAATGGATTATGTATTAGGTC and
5'-GAGTAGTAGCTACCTCATATGTTGAATTCCTTATTTAAACCGGGTCTTCAC,
and those for xylE were
5'-CAA GAGGGAGGGATAGAAGACATATGAAGTCACACCCGCTTACGCTTA CTC
and
5'-TTATTTTTTTCCATATGTTCTTATAACCAAGTATTTTCTAATTGTTCAAGCG; the underlined sequences correspond to the NdeI
restriction site. The subcloned expression plasmids were introduced
into Escherichia coli JM109 (35). The
transformants were aerobically grown in LB medium (35) with
0.2 mM isopropyl-
-D-thiogalactopyranoside to the
mid-exponential phase at 37°C.
Assay of XylE activity in E. coli and T. halophila.
Cells were harvested at the exponential phase and
washed with B7 minimal salts medium (42) supplemented with
20 mM NaCl. The assay procedure was essentially similar to a previously
reported protocol (42).
D-[14C]xylose was added to the cell
suspension at a final concentration of 2 µM to start the uptake
reaction at 30°C. The reaction was stopped by diluting the reaction
mixture (100 µl) into 5 ml of cold B7 medium plus 20 mM NaCl, the
mixture was filtered on a nitrocellulose filter (pore size, 0.45 µm;
Toyo Roshi Co. Ltd., Tokyo, Japan), and the filter was washed once with
cold B7 medium plus 20 mM NaCl. The radioactivity on the filter was
measured with a liquid scintillation counter.
When the sodium ion dependence of the xylose uptake activity in
E. coli or T. halophila was examined, cells
were washed and suspended in B7 minimal salts medium (42).
T. halophila was cultured in M-17 medium (Difco)
supplemented with 5% NaCl and 1% xylose (instead of lactose) without
aeration at 30°C for 2 days. The uptake activity was assayed as
described above.
Assay of XylB activity in E. coli.
Cells were
harvested at the exponential phase, washed three times with 10 mM
Tris-HCl (pH 7.5)-1 mM EDTA, and suspended in the same buffer (final
concentration, 10 mg of protein/ml). Cells were disrupted by sonication
on ice (five times for 1 min each time; Branson Sonifier 250). After
removal of nondisrupted cells by centrifugation at 30,000 × g and 4°C for 10 min, the supernatant was assayed for
activity.
XylB activity was assayed according to the method of Lawlis et al.
(29). The reaction mixture (1 ml) contained 50 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 1 mM EDTA, 1 mM phosphoenolpyruvate,
0.5 mM ATP, 1 mM xylulose, 0.01 mM NADH, 80 U of lactate dehydrogenase, and 80 U of pyruvate kinase. The reaction was started by the addition of sample (100 µl) at 30°C. The A340 of the
reaction mixture was monitored.
Assay of XylA activity in E. coli.
Cells were
harvested at the exponential phase, washed three times with 10 mM
Tris-HCl (pH 7.5)-1 mM dithiothreitol-150 mM NaCl, and suspended in
the same buffer (final concentration, 10 mg of protein/ml). Cell
lysates were obtained as described for the assay of XylB activity.
XylA activity was assayed according to the method of Ghangas and Wilson
(16). The reaction mixture (0.95 ml) contained 50 mM
Tris-maleate (pH 6.6), 1 mM MnCl2, 5 mM
D-xylose, and 100 µl of cell lysate. The reaction was
started by the addition of D-xylose at 37°C and stopped
by the addition of 50 µl of 50% trichloroacetic acid after
incubation for 5 min. The precipitate was removed by centrifugation at
10,000 × g for 5 min, and the supernatant was analyzed
for xylulose by the cysteine-carbazole method (39).
Materials.
Restriction enzymes, T4 DNA ligase, and the
deletion kit for kilobase sequencing were purchased from
Takara Shuzo Co. (Kyoto, Japan). GIGAPACKII Plus,
BcaBEST labeling kit, phage vector EMBL3
(35), phagemid pBluescriptII KS+, ZAP Express
vector, ExAssist helper phage, and E. coli
XL1-Blue MRF' were purchased from Stratagene, La Jolla, Calif. PCR was
done according to the manufacturer's recommendations with
Taq DNA polymerase obtained from Takara Shuzo Co. or KOD DNA
polymerase obtained from Toyobo Co. Ltd., Tokyo, Japan.
[-32P]ATP (110 TBq/mmol) and
D-[14C]xylose (3.26 GBq/mmol) were
obtained from Amersham Co. Ltd., Tokyo, Japan. Lactate dehydrogenase
and pyruvate kinase were obtained from Oriental Yeast Co. Ltd., Tokyo,
Japan. Other chemicals were commercial products of analytical
grade.
Nucleotide sequence accession number.
The nucleotide
sequence discussed in this article has been deposited in the
DDBJ/EMBL/GenBank nucleotide sequence databases under accession number
AB009593.
| |
RESULTS |
Sequence of the DNA.
Nearly complete portions of the
inserts in pBKS+2-2 and in pBKXYL were sequenced. The G+C content
for the entire 7.7-kb fragment was 35.8%, in good agreement with the
value determined previously for the T. halophila genome
(15). Figure 1 shows the gene
organization of the xyl operon in our clone and the
nucleotide sequence of its regulatory region.
View larger version (16K):
[in this window]
[in a new window]
|
FIG. 1.
Gene organization of the xyl operon of
T. halophila and putative regulatory elements in its
regulatory region. In the top line, the genes are indicated by arrows,
which are not drawn to scale. The directions of transcription indicated
by the arrows are putative. The noncoding regions following the
xylE and xylR genes contained sequences with a
potential structure in the mRNA that was similar to the rho-independent
transcription termination signal of E. coli; we think that
they are the termination signals (indicated by mushroom-like marks).
Most open reading frames contained an ATG start codon, except for
xylB and xylE, which started with a GTG codon and
were preceded by possible RBSs at distances that fell within a range of
5 to 12 nucleotides. The assigned initiation codons are putative. The
termination codons were TAG for xylA, xylR, and
rbsB and TAA for xylB, xylE, and
rbsC. The intergenic noncoding regions in the xyl
cluster were 12 bp between xylA and xylB and 319 bp between xylB and xylE. They did not seem to
form any secondary structures in the mRNA. The line drawn below the
genes represents an enlarged outline of the regulatory elements in the
regulatory region between xylR (left) and xylABE
(right). The black boxes indicate the  35 and 10 regions for the
xylR and xylABE promoters. Arrows indicate the
putative operator with a palindromic sequence. In the bottom lines, the
nucleotide sequence of the regulatory region for xylABE is
shown. ATG in white letters indicates the location of the start codon
for xylA. A cis-acting CRE is indicated by a
double-headed arrow. Broken arrows indicate the putative operator with
a palindrome. Putative 35 and 10 sequences are underlined. An RBS
is also underlined.
|
|
We found a gene cluster consisting of three genes, designated
xylA, xylB, and xylE (Fig. 1);
xylA, xylB, and xylE code for a xylose
isomerase, a xylulose kinase, and a xylose/Na+ symporter,
respectively. All genes were in the same direction. There was no
potential open reading frame immediately upstream of the 5' end of
xylA or downstream of the 3' end of xylE in this direction; the minimum size for a putative open reading frame used to
analyze the sequences was 40 amino acids. The xyl gene cluster seems to form an operon (Fig. 1). Upstream of xylA,
there was an open reading frame in the opposite direction. We believe that it is a regulatory gene of the xyl operon,
xylR (Fig. 1). Further upstream of xylA, there
were two open reading frames in the same direction as the
xyl operon. The deduced amino acid sequences resembled those
of a ribose binding protein gene, rbsB, and a ribose
transporter gene, rbsC (Fig. 1) (5, 18, 40).
Figure 1 also shows the nucleotide sequence upstream of the 5' end of
the xylA gene. A potential "core" sequence of the RBS for enterococcal genes is GGAGG (41); members of the genus
Enterococcus are gram-positive bacteria having DNA and
proteins showing high homology to those of T. halophila, such as the gene for HPr (3; unpublished data). A possible RBS sequence (GGTGG) preceded the ATG
start codon of the xylA gene. Sequences of so-called 35
and 10 (or Pribnow) boxes (9) were found (Fig. 1). A
reading frame designated xylR, which is thought to function
as the repressor for the xyl operon, started at 367 bp
upstream of the xylA gene in the complementary sequence, in
which the potential RBS sequence and the sequences of 35 and 10
boxes were also observed (Fig. 1). There was a typical palindromic
sequence in the 5'-untranslated region upstream of the xylA
gene (Fig. 1). Since this xylose isomerase is an inducible enzyme whose
amount is regulated by the addition of D-xylose
(1), the palindromic sequence may be involved in the
regulation of gene expression by D-xylose. Overlapping the 35 sequence, there was a consensus sequence for CRE (Fig. 1), which
has been found for catabolite-repressible genes in other gram-positive
bacteria and to which CcpA is thought to bind (17, 20, 22, 23,
34).
Primary amino acid sequences of the xyl gene
products.
Searches of current protein databases with the BLAST
network service revealed that several xyl gene products
showed significant homologies with various xylose metabolic enzymes
(Table 1).
The xylA, xylB, xylE, and
xylR gene products were predicted to be composed of 435, 502, 474, and 386 amino acids and to have molecular weights of 49,400, 56,400, 51,600, and 43,400, respectively. The sequences for XylA, XylB,
and XylR were homologous to those of other xylose isomerases,
xylulose kinases, and xylose repressors from various bacteria (Table
1). Furthermore, the homology search for XylR revealed
sequences similar to hexose phosphate binding site sequences of
hexose kinases from Streptococcus mutans and Streptomyces coelicolor (Fig.
2).
View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2.
Similarity of amino acid sequence of T. halophila XylR to those of S. mutans fructokinase
(DDBJ/EMBL/GenBank accession no. D13175) and S. coelicolor
glucokinase (Swiss-Prot accession no. P40184). Asterisks indicate
identical amino acid residues. Numbers for each line are
those of amino acid residues starting from the amino terminus. Dashes
indicate gaps.
|
|
Recently, a gene for a xylose transporter (xylT) was
first reported for a gram-positive bacterium, Bacillus
megaterium (38). The amino acid sequence alignment
showed that the residues of T. halophila XylE were 51 and 64% identical to those of E. coli XylE
(11) and B. megaterium XylT (38) and
60 and 81% similar, with equivalent substitutions, respectively.
Hydropathy analysis by the method of Kyte and Doolittle (28)
suggested that the xylE gene product encodes a hydrophobic
protein with 12 membrane-spanning regions. The xylE gene is
the second reported xylose transporter gene for gram-positive bacteria.
Comparison of the arrangement of the T. halophila
xyl genes with those of other xyl genes.
Figure
3 shows the gene arrangements of
xyl operons in bacteria. The arrangement of the genes for
the T. halophila xyl operon was the same as that for
the B. megaterium xyl operon (38), with the
order xylR (on the reverse coding frame) and
xylABE (or xylABT). Like the B. megaterium
xyl operon, the T. halophila xyl operon contained
the xylE (xylose transporter) gene in the operon, indicating
that xylose transport activity itself is repressed in the absence of
D-xylose and is subject to catabolite repression.
View larger version (11K):
[in this window]
[in a new window]
|
FIG. 3.
Organization of xyl genes of T. halophila and various bacteria. DNA sequence analysis of a 6.4-kb
region revealed the presence of four open reading frames. T. halophila xylA codes for a xylose isomerase, xylB codes
for a xylulose kinase, and xylE codes for a xylose
transporter. xylR, transcribed in the opposite direction,
codes for a xyl repressor. A, isomerase; B, kinase; R,
repressor; E, transporter (for B. megaterium, T); R-T,
activator; P and Q, regulatory proteins for gene expression
(24). Sources for other bacteria were as follows: B. megaterium (38), L. pentosus
(DDBJ/EMBL/GenBank accession no. M57384), Bacillus subtilis
(DDBJ/EMBL/GenBank accession no. U66480), Streptococcus
violaceoniger (29a), and E. coli
(DDBJ/EMBL/GenBank accession no. U00039).
|
|
Expression of XylA, XylB, and XylE activities in E. coli.
The xylA, xylB, or xylE
gene was subcloned into the cloning site, NdeI, in an
E. coli expression vector (31) which has the lac promoter and operator, the lac RBS sequence,
and the ATG initiation codon in the unique NdeI restriction
site. The activities for XylB and XylE were successfully expressed and
detected in E. coli, suggesting that the putative open
reading frames and the initiation codons for these genes were probably
correct.
The xylose transport activity of T. halophila was
measured with B7 medium. The activity was about 0.4 nmol/min/mg of
protein in the presence of 10 mM NaCl. The activity depended on the
presence of NaCl (Fig. 4) but was not
affected by the presence of KCl (data not shown). The apparent affinity
for Na+ of the transport activity was estimated to be about
10 mM from Hanes-Woolf plots of the activity versus NaCl concentration.
This is the first report of an Na+-dependent xylose
transport system in bacteria. The xylose transport activity expressed
in E. coli cells was 0.11 nmol/min/mg of protein after
induction with 0.2 mM isopropyl--thiogalactoside; the background activity was 0.01 nmol/min/mg of protein. The activity expressed in
E. coli showed a similar property of sodium ion dependence. Therefore, XylE of T. halophila is likely a
xylose/Na+ symporter. It is noteworthy that the amino acid
sequence of the T. halophila xylose transporter is
similar to that of the E. coli xylose/H+
symporter (11), which is a member of the large Glut family of transporters (6, 30).
View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4.
Effects of NaCl concentration on xylose uptake activity
in T. halophila. The initial rate of xylose uptake in
intact cells of T. halophila I-13 was measured in the
presence of 0 to 70 mM NaCl and 2 µM
D-[14C]xylose for 1 minute as described in
Materials and Methods. A Hanes-Woolf plot of xylose uptake activity in
intact cells versus outside NaCl concentration is shown. (Inset) Xylose
uptake activity in intact cells versus outside NaCl concentration.
|
|
XylB activity measured with E. coli lysates was about 10.7 µmol of NADH oxidized/min/mg of protein; the background activity was
negligible (below 0.01 µmol of NADH oxidized/min/mg of protein).
XylA activity measured with E. coli lysates was not
different from the background activity; we concluded that XylA activity was not functionally expressed in E. coli.
| |
DISCUSSION |
In clones pBSK+2-2 and pBKXYL we found gene clusters containing a
portion of the rbs operon (rbsB and a portion of
rbsC), xylR, and the xyl operon,
consisting of three genes (xylA, xylB, and
xylE, which code for a xylose isomerase, a xylulose kinase, and a xylose transporter, respectively). It is interesting that the
genes for the ribose (a pentose) metabolic pathway were found next to
the xyl operon, which is susceptible to catabolite
repression (1). Intergenic regions in the xyl
operon did not seem to form any secondary structures in mRNA which may
work as signals for transcription termination or regulation; in the
B. megaterium xyl operon, the intergenic region between
xylA and xylB has been shown to work as a
transcription termination signal (38). We speculate that
only one mRNA is transcribed for this xylA-xylB-xylE operon.
Studies of the transcriptional regulation of this xyl operon
are in progress.
The deduced amino acid sequences of the Xyl gene products were
homologous to those of respective gene products in other bacteria (Table 1). It is noteworthy that XylE of T. halophila,
which is likely to be the first described xylose/Na+
symporter, is homologous to the xylose/H+ symporter of
E. coli (11). The xylose transport activity in T. halophila was not susceptible to inducer exclusion
or inducer expulsion (1). Sequences relevant to inducer
exclusion in transporter proteins of gram-positive bacteria need to be
elucidated. It is interesting that the carboxyl-terminal hydrophilic
region in XylE of T. halophila is shorter than those of
the gene products of E. coli xylE and B. megaterium xylT (11, 38), since this region was
suggested to be relevant to inducer exclusion in MelB of E. coli (27) and LacS of Streptococcus
thermophilus (32).
The arrangement of the genes for the xyl operon was the same
as that of the B. megaterium xyl operon (38).
This arrangement is relevant to the observation that the xylose
transport activity in T. halophila was not susceptible
to inducer exclusion but that it was strictly repressed in the absence
of D-xylose and was subject to catabolite repression
(1, 2).
The xylB and xylE genes were successfully
expressed in E. coli, suggesting that they are
open reading frames. The initiation codons that we assigned are
putative and await confirmation by amino acid sequencing of purified
proteins. XylA activity was not functionally expressed in E. coli. We do not think that the failure of XylA expression in
E. coli was due to a change in the natural 5' sequence at
the start of xylA. Instead, although we have not yet
examined the production of the XylA polypeptide by using a specific
antibody, we speculate that the XylA protein expressed in E. coli is unstable and becomes inactivated.
The xylose transport activity in T. halophila was
Na+ dependent; this finding is the first report of an
Na+-dependent xylose transporter. The property of
Na+ dependence suggests that the xylose transporter of
T. halophila is a xylose/Na+ symporter; in
contrast, the xylose transporter in E. coli is a
xylose/H+ symporter (11). This Na+
dependence is in good accord with the fact that this bacterium is
halophilic, the usual salt concentration of the medium being above 15%
NaCl. The possibility that this xylose transporter can work as a
xylose/H+ symporter at a low pH (since T. halophila is a lactic acid bacterium) is not excluded.
The amino acid sequence of XylR is interesting for two reasons. (i) It
has a consensus sequence for a hexose phosphate binding site found in
hexose kinases (Fig. 2), suggesting that it has a binding site for such
catabolites. (ii) It has a consensus sequence for a xylose binding
site, since the amino acid sequence is similar to those of other XylR
proteins from various bacteria (Table 1). These characteristics have
been reported for the regulatory XylR proteins of the
catabolite-repressible xyl operons from Bacillus subtilis and B. megaterium (9, 10, 13, 14, 21, 26, 37, 38).
From the results of this study and other studies (9, 10, 13, 14,
17, 20-23, 26, 34, 37, 38), we have devised a working model for
the regulatory network of the xyl operon in T. halophila (Fig. 5). (i) Catabolites
of glucose activate the HPr kinase, and then the phosphorylated form of
HPr(Ser) binds to CcpA, mediating the dimerization of CcpA (12,
34, 37). CcpA with phosphorylated HPr(Ser) and a catabolite
bind to the CRE sequence and repress the expression of the
xyl operon (catabolite repression). (ii) A catabolite
binds to XylR, activating it to bind to the xyl
operator, thus repressing the xyl operon, as reported for
the xyl operon in B. megaterium (antiinducer;
37). (iii) D-Xylose itself binds to
XylR, inactivating it to be released from the xyl operator,
thus inducing the xyl operon. This regulatory model, in
which catabolites doubly repress xyl expression via CcpA
(catabolite repression) and via XylR (antiinducer), is noteworthy because xylose metabolic activity in T. halophila was
strictly repressed in the presence of glucose (1). In
contrast, arabinose metabolic activity was repressed only 70% by the
presence of glucose (catabolite control) in this bacterium (unpublished
observation).
View larger version (26K):
[in this window]
[in a new window]
|
FIG. 5.
Regulatory scheme for gene expression of the
xyl operon in T. halophila. The shaded
arrows indicate the putative directions of transcription. The
mushroom-like marks indicate the rho-independent transcription
termination signals. P's indicate promoters for the xylR
and xylABE operons. T. halophila xylA codes
for a xylose isomerase, xylB codes for a xylulose kinase,
and xylE codes for a xylose transporter; xylR,
transcribed in the opposite direction, codes for a xylose repressor. In
the absence of D-xylose, XylR binds to a xyl
operator (designated O) and represses the transcription of
xylABE [as indicated by ()]. In the presence of glucose,
catabolites (glucose-6-phosphate [Glc-6-P], fructose-6-phosphate, or
fructose-1,6-bisphosphate [F-1,6-P]) activate repressor activity [as
indicated by (+)] and the CcpA-phosphorylated HPr(Ser)
[CcpA-HPr(Ser)P] complex binds to CRE; both repress the transcription
of xylABE [as indicated by ()]. In the presence of
xylose and only in the absence of glucose (or related catabolites),
XylR is inactivated to be released from the xyl operator,
inducing the transcription of xylABE. Xylulo-5-P,
xylulose-5-phosphate. For details, see the Discussion.
|
|
| |
ACKNOWLEDGMENTS |
We are grateful for the personal communication about the amino
acid sequence of xylose isomerase of L. pentosus and the
gene organization of the xyl operon of S. violaceoniger from Rob J. Leer and Peter H. Pouwels at the TNO
Medical Biological Laboratory, Zeist, The Netherlands.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biological Science and Technology, Science University of Tokyo, 2641 Yamazaki, Noda-shi, Chiba 278, Japan. Phone: 81-471-24-1501, ext. 4405. Fax: 81-471-25-1841. E-mail:
yamato{at}yl05hp.tb.noda.sut.ac.jp.
| |
REFERENCES |
| 1.
|
Abe, K.
1991.
Establishment of a soy sauce fermenting Pediococcus halophilus which preferentially utilizes pentoses. Ph.D. thesis
University of Tokyo, Tokyo, Japan.
|
| 2.
|
Abe, K., and K. Uchida.
1989.
Correlation between depression of catabolite control of xylose metabolism and a defect in the phosphotransferase system in Pediococcus halophilus.
J. Bacteriol.
171:1793-1800[Abstract/Free Full Text].
|
| 3.
|
Arai, M.,
K. Abe, and I. Yamato.
1992.
Purification and characterization of the HPr protein of Pediococcus halophilus.
Biochem. Int.
27:275-279[Medline].
|
| 4.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1995.
Current protocols in molecular biology, vol. 1.
John Wiley & Sons, Inc., New York, N.Y.
|
| 5.
|
Bell, A. W.,
S. D. Buckel,
J. M. Groarke,
J. N. Hope,
D. H. Kingley, and M. A. Hermodson.
1986.
The nucleotide sequence of the rbsD, rbsA, and rbsC genes of Escherichia coli.
J. Biol. Chem.
261:7652-7658[Abstract/Free Full Text].
|
| 6.
|
Clayton, R. A.,
O. White,
K. A. Ketchum, and J. C. Venter.
1997.
The first genome from the third domain of life.
Nature
387:459-462[Medline].
|
| 7.
|
Collins, M. D.,
A. M. Williams, and S. Wallbanks.
1990.
The phylogeny of Aerococcus and Pediococcus as determined by 16S rRNA sequence analysis: description of Tetragenococcus gen. nov.
FEMS Microbiol. Lett.
70:255-262.
|
| 8.
|
Cook, G. M.,
J. J. Ye,
J. B. Russell, and M. H. Saier, Jr.
1995.
Properties of two sugar phosphatases from Streptococcus brevis and their potential involvement in inducer expulsion.
J. Bacteriol.
177:7007-7009[Abstract/Free Full Text].
|
| 9.
|
Dahl, M. K.,
J. Degenkolb, and W. Hillen.
1994.
Transcription of the xyl operon is controlled in Bacillus subtilis by tandem overlapping operators spaced by four base-pairs.
J. Mol. Biol.
243:413-424[Medline].
|
| 10.
|
Dahl, M. K.,
D. Schmiedel, and W. Hillen.
1995.
Glucose and glucose-6-phosphate interaction with Xyl repressor protein from Bacillus spp. may contribute to regulation of xylose utilization.
J. Bacteriol.
177:5467-5472[Abstract/Free Full Text].
|
| 11.
|
Davis, E. O., and P. J. F. Henderson.
1987.
The cloning and DNA sequence of the gene xylE for xylose-proton symport in Escherichia coli K12.
J. Biol. Chem.
262:13928-13932[Abstract/Free Full Text].
|
| 12.
|
Deutscher, J.,
E. Kuster,
U. Bergstedt,
V. Charrier, and W. Hillen.
1995.
Protein kinase-dependent HPr/CcpA interaction links glycolytic activity to carbon catabolite repression in Gram-positive bacteria.
Mol. Microbiol.
15:1049-1053[Medline].
|
| 13.
|
Gartner, D.,
M. Geissendorfer, and W. Hillen.
1988.
Expression of the Bacillus subtilis xyl operon is repressed at the level of transcription and is induced by xylose.
J. Bacteriol.
170:3102-3109[Abstract/Free Full Text].
|
| 14.
|
Gartner, D.,
J. Degenkolb,
J. A. E. Ripperger,
R. Allmansberger, and W. Hillen.
1992.
Regulation of the Bacillus subtilis W23 xylose utilization operon: interaction of the Xyl repressor with the xyl operator and the inducer xylose.
Mol. Gen. Genet.
232:415-422[Medline].
|
| 15.
|
Garvie, E. I.
1986.
Genus Pediococcus Claussen, p. 1079.
In
P. H. A. Sneath, N. S. Mair, M. E. Sharpe, and J. G. Holt (ed.), Bergey's manual of systematic bacteriology, vol. 2. Williams & Wilkins, Baltimore, Md.
|
| 16.
|
Ghangas, G. S., and D. B. Wilson.
1984.
Isolation and characterization of the Salmonella typhimurium LT2 xylose regulon.
J. Bacteriol.
157:158-164[Abstract/Free Full Text].
|
| 17.
|
Gosseringer, R.,
E. Kuster,
A. Galinier,
J. Deutscher, and W. Hillen.
1997.
Cooperative and non-cooperative DNA binding modes of catabolite control protein CcpA from Bacillus megaterium result from sensing two different signals.
J. Mol. Biol.
266:665-676[Medline].
|
| 18.
|
Groarke, J. M.,
W. C. Mahoney,
J. N. Hope,
C. E. Furlong,
F. T. Robb,
H. Zalkin, and M. A. Hermodson.
1983.
The amino acid sequence of D-ribose binding protein from Escherichia coli K-12.
J. Biol. Chem.
258:12952-12956[Abstract/Free Full Text].
|
| 19.
|
Hoischen, C.,
J. Levin,
S. Pitaknarongphorn,
J. Reizer, and M. H. Saier, Jr.
1996.
Involvement of the central loop of the lactose permease of Escherichia coli in its allosteric regulation by glucose-specific enzyme IIA of the phosphoenolpyruvate-dependent phosphotransferase system.
J. Bacteriol.
178:6082-6086[Abstract/Free Full Text].
|
| 20.
|
Hueck, C. J.,
A. Kraus,
D. Schmiedel, and W. Hillen.
1995.
Cloning, expression and functional analyses of the catabolite control protein CcpA from Bacillus megaterium.
Mol. Microbiol.
16:855-864[Medline].
|
| 21.
|
Jacob, S.,
R. Allmansberger,
D. Gartner, and W. Hillen.
1991.
Catabolite repression of the operon for xylose utilization from Bacillus subtilis W23 is mediated at the level of transcription and depends on a cis site in the xylA reading frame.
Mol. Gen. Genet.
229:189-196[Medline].
|
| 22.
|
Jones, B. E.,
V. Dossonnet,
E. Kuster,
W. Hillen,
J. Deutscher, and R. E. Klevit.
1997.
Binding of the catabolite repressor protein CcpA to its DNA target is regulated by phosphorylation of its corepressor HPr.
J. Biol. Chem.
272:26530-26535[Abstract/Free Full Text].
|
| 23.
|
Kim, J. H.,
Z. T. Guvener,
J. Y. Cho,
K. Chung, and G. H. Chambliss.
1995.
Specificity of DNA binding activity of the Bacillus subtilis catabolite control protein CcpA.
J. Bacteriol.
177:5129-5134[Abstract/Free Full Text].
|
| 24.
|
Kok, J.
1996.
Inducible gene expression and environmentally regulated genes in lactic acid bacteria.
Antonie Leeuwenhoek
70:129-140.
|
| 25.
|
Kolb, A.,
S. Busby,
H. Buc,
S. Garges, and S. Adhya.
1993.
Transcriptional regulation by cAMP and its receptor protein.
Annu. Rev. Biochem.
62:749-795[Medline].
|
| 26.
|
Kraus, A.,
C. Hueck,
D. Gartner, and W. Hillen.
1994.
Catabolite repression of the Bacillus subtilis xyl operon involves a cis element functional in the context of an unrelated sequence, and glucose exerts additional xylR-dependent repression.
J. Bacteriol.
176:1738-1745[Abstract/Free Full Text].
|
| 27.
|
Kuroda, M.,
S. de Waard,
K. Mizushima,
M. Tsuda,
P. Postma, and T. Tsuchiya.
1996.
Resistance of the melibiose carrier to inhibition by the phosphotransferase system due to substitutions of amino acid residues in the carrier of Salmonella typhimurium.
J. Biol. Chem.
267:18336-18341[Abstract/Free Full Text].
|
| 28.
|
Kyte, J., and R. F. Doolittle.
1982.
A simple method for displaying the hydropathic character of a protein.
J. Mol. Biol.
157:105-132[Medline].
|
| 29.
|
Lawlis, V. B.,
M. S. Dennis,
E. Y. Chen,
D. H. Smith, and D. J. Henner.
1984.
Cloning and sequencing of the xylose isomerase and xylulose kinase genes of Escherichia coli.
Appl. Environ. Microbiol.
47:15-21[Abstract/Free Full Text].
|
| 29a.
| Leer, R. J., and P. H. Pouwels. Personal
communication.
|
| 30.
|
Maiden, M. C. J.,
E. O. Davis,
S. A. Baldwin,
D. C. M. Moore, and P. J. F. Henderson.
1987.
Mammalian and bacterial sugar transport proteins are homologous.
Nature
325:641-643[Medline].
|
| 31.
|
Nishimura, I.,
K. Okada, and Y. Koyama.
1996.
Cloning and expression of pyranose oxidase cDNA from Coriolus versicolor in Escherichia coli.
J. Biotechnol.
52:11-20[Medline].
|
| 32.
|
Poolman, B.,
J. Knol,
B. Mollet,
B. Nieuwenhuis, and G. Sulter.
1995.
Regulation of bacterial sugar-H+ symport by phosphoenolpyruvate-dependent enzyme I/HPr-mediated phosphorylation.
Proc. Natl. Acad. Sci. USA
92:778-782[Abstract/Free Full Text].
|
| 33.
|
Reizer, J.
1989.
Regulation of sugar uptake and efflux in Gram-positive bacteria.
FEMS Microbiol. Rev.
63:149-156.
|
| 34.
|
Saier, M. H., Jr.,
S. Chauvaux,
J. Deutscher,
J. Reizer, and J. J. Ye.
1995.
Protein phosphorylation and regulation of carbon metabolism in Gram-negative versus Gram-positive bacteria.
Trends Biochem. Sci.
20:267-271[Medline].
|
| 35.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 36.
|
Scheler, A., and W. Hillen.
1994.
Regulation of xylose utilization in Bacillus licheniformis: Xyl repressor-xyl-operator interaction studied by DNA modification protection and interference.
Mol. Microbiol.
13:505-512[Medline].
|
| 37.
|
Schmiedel, D., and W. Hillen.
1996.
Contributions of XylR, CcpA and cre to diauxic growth of Bacillus megaterium and to xylose isomerase expression in the presence of glucose and xylose.
Mol. Gen. Genet.
250:259-266[Medline].
|
| 38.
|
Schmiedel, D.,
M. Kintrup,
E. Kuster, and W. Hillen.
1997.
Regulation of expression, genetic organization and substrate specificity of xylose uptake in Bacillus megaterium.
Mol. Microbiol.
23:1053-1062[Medline].
|
| 39.
|
Shamanna, D. K., and K. E. Sanderson.
1979.
Uptake and catabolism of D-xylose in Salmonella typhimurium LT2.
J. Bacteriol.
139:64-70[Abstract/Free Full Text].
|
| 40.
|
Strauch, M. A.
1995.
AbrB modulates expression and catabolite repression of a Bacillus subtilis ribose transport operon.
J. Bacteriol.
177:6727-6731[Abstract/Free Full Text].
|
| 41.
|
Takase, K.,
S. Kakinuma,
I. Yamato,
K. Konishi,
K. Igarashi, and Y. Kakinuma.
1994.
Sequencing and characterization of the ntp gene cluster for vacuolar-type Na+-translocating ATPase of Enterococcus hirae.
J. Biol. Chem.
269:11037-11044[Abstract/Free Full Text].
|
| 42.
|
Yamato, I.,
M. Kotani,
Y. Oka, and Y. Anraku.
1994.
Site-specific alteration of arginine 376, the unique positively charged amino acid residue in the mid-membrane-spanning regions of the proline carrier of Escherichia coli.
J. Biol. Chem.
269:5720-5724[Abstract/Free Full Text].
|
Appl Environ Microbiol, July 1998, p. 2513-2519, Vol. 64, No. 7
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Top
Abstract
Introduction
