INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

The maintenance and horizontal transfer of extrachromosomal elements provide one mechanism by which microbial communities can rapidly adapt to changes in environmental conditions. This adaptation can be in the form of plasmid rearrangements and duplications (18, 40), a change in the plasmid copy number (40, 54), or lateral or horizontal movement of plasmids within bacterial populations. An example demonstrating the importance of plasmid-mediated genetic adaptation in natural microbial communities, likely caused by lateral transfer, is the increased frequencies (2- to 10-fold) of catabolic plasmids reported in bacterial isolates obtained from polluted marine and freshwater environments compared to isolates from nonpolluted or less impacted ecosystems (8, 23, 43). Plasmids also play a major role in promoting the widespread distribution of antibiotic resistance genes attributed to the intense and increased use of antibiotics (42).

The ability of plasmids to self-transfer or to be mobilized by transfer-proficient plasmids and the ability to replicate in different bacterial hosts are key factors in the spread of plasmid-encoded genes within microbial communities. Plasmids which are considered to have broad host ranges in nature have the potential to significantly affect the microbial community structure and function due to their ability to replicate and be maintained in members of distantly related genera. Thus, to better understand gene flux in natural systems and hence the potential role of plasmids in promoting horizontal transfer within microbial communities, knowledge of the distribution, diversity, and host ranges of naturally occurring plasmids is necessary.

At present, most indigenous plasmids from marine and freshwater systems have been only partially characterized with respect to host range, replication mechanisms, incompatibility groups, and conjugal abilities. Plasmids containing similar or related replication systems are considered incompatible if they cannot coexist in a host cell (12, 41). This trait has facilitated the grouping of plasmids from gram-negative bacteria, mainly members of the family Enterobacteriaceae, into more than 30 different incompatibility groups (3). While molecularly based plasmid classification or replicon typing by using DNA sequences of replication origins and incompatibility loci of well-characterized plasmids has been useful in classifying plasmids from bacterial isolates of medical importance (9, 10, 14), plasmids from various marine microbial communities, including sediments, biofilms, bulk water, and the marine air-water interface, have been recently shown to contain incompatibility and replication regions unrelated to those currently defined (11, 53).

The present study was undertaken to characterize, at the molecular level, the replication and incompatibility loci of naturally occurring plasmids isolated from gram-negative marine heterotrophs for use as replicon probes to classify and type, at the molecular level, plasmids present in bacterial populations of marine sediments. Replication origins were obtained from plasmids ranging in size from 6 to 30 kb isolated from culturable bacteria of coastal California marine sediments (53). Phylogenetic analysis indicated that the plasmids were initially isolated from bacteria belonging to the  and -3 subclasses of the class Proteobacteria. Although a sequence and hybridization analysis of the replication origins from the marine plasmids confirmed the lack of homology with previously described plasmids, the replication regions contained features commonly found in previously characterized plasmid replication origins. The replication origins of the naturally occurring plasmids appear to have a broad host range, as indicated by their ability to replicate in members of diverse gram-negative marine genera. In addition to molecular characterization of the indigenous plasmids, the persistence of the replicons in marine sediment bacterial populations was determined by PCR amplification of microbial community DNA extracted on different dates and examined for the presence of homologous plasmid replication sequences.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Isolation and identification of plasmid-bearing marine isolates. The bacterial strains and plasmids used in this study are listed in Table 1. DAPI (4',6-diamidino-2-phenylindole) direct bacterial counts were obtained by using 1-g samples of marine sediments serially diluted in artificial seawater by the method of Porter and Feig (43a). Bacteria were isolated from coastal marine sediments by serially diluting sediment samples (1 g) in artificial seawater, spreading the dilutions onto solid media (e.g., YTSS, 0.5× YTSS, and TSS [53]), and incubating the resulting plates for 1 to 14 days at 30°C (53). Colonies were picked from the plates and restreaked at least twice on the same medium to ensure purity (53). The presence of plasmids in the marine bacterial isolates was determined by a modification of the Kieser method (28, 53). Specifically, plasmid presence was determined by centrifuging (6,000 × g, 10 min) 5 to 10 ml of an overnight cell culture grown in the same medium in which the isolate was initially cultured, draining the cell pellet, resuspending it in 500 µl of solution A (2 mg of lysozyme per ml, 0.3 M sucrose, 25 mM Tris [pH 8.0], 25 mM EDTA [pH 8.0], 0.02% bromocresol green), and incubating the preparation at 37°C for 30 min; this was followed by adding 250 µl of solution B (0.3 M NaOH, 2% sodium dodecyl sulfate [SDS]), mixing the preparation by inverting it several times, and incubating it at 55°C for 30 min. Samples were allowed to cool to room temperature before 180 µl of solution C (5 g of phenol, 5 ml of chloroform, 1 ml of distilled water, 5 mg of 8-hydroxyquinoline) was added, and they were quickly vortexed to mix them and centrifuged (8,000 × g, 5 min). The supernatants were carefully removed and immediately loaded onto 0.6 to 0.8% horizontal agarose gels. The gels were electrophoresed at 5 V per cm, stained with ethidium bromide, destained in water, and photographed on a UV transilluminator.

Large-scale isolation of plasmid DNA from marine isolates. A modification of the alkaline lysis method of Birnboim and Doly (5) was used to isolate supercoiled plasmid DNA from gram-negative marine bacteria. Each cell pellet obtained from centrifugation (6,000 × g, 10 min) of 1 liter of an overnight cell culture grown in either TSS or 0.5× YTSS (53) at 30°C was thoroughly drained and resuspended in 50 ml of solution 1 (10 mg of lysozyme per ml, 50 mM Tris-HCl [pH 8.0], 10 mM EDTA, 100 µg of RNaseA per ml); this was followed by addition of 50 ml of solution 2 (200 mM NaOH, 1% SDS), mixing of the preparation by inverting it several times, and incubation for 5 min at room temperature and then by addition of 50 ml of solution 3 (3 M potassium acetate, pH 5.5), mixing of the preparation by inverting it several times, and incubation on ice for 30 min. Samples were centrifuged (20,000 × g, 30 min), each supernatant was extracted with 0.5 volume of phenol-chloroform, the phases were separated by centrifugation (10,000 × g, 10 min), and the aqueous layer was precipitated with 0.8 volume of isopropanol at room temperature and immediately centrifuged (20,000 × g, 30 min). Plasmid DNA was subsequently purified by cesium chloride gradient centrifugation (37).

Cloning and sequencing of plasmid replication origins from marine bacterial isolates. Approximately 1 µg of plasmid DNA was partially digested with restriction endonuclease Sau3AI for 1, 10, and 30 min, and the terminal 5' phosphates were removed with shrimp alkaline phosphatase as recommended by the manufacturer (United States Biochemical, Cleveland, Ohio). The partially digested plasmid DNA was ligated to the Tn903 npt gene isolated as a BamHI fragment from pUC4K (37, 59) with T4 DNA ligase as recommended by the manufacturer (Promega, Madison, Wis.). The ligation mixture was transformed into E. coli DH5 and C2110 and was grown on Lennox L agar (39) (Gibco Scientific, Grand Island, N.Y.) supplemented with 50 µg of kanamycin per ml at 30°C for 18 to 48 h. Plasmid DNA was obtained from 5 ml of an overnight cell culture grown in Lennox L broth at 30°C by alkaline lysis (37) and was digested with PstI restriction endonuclease to identify the transformant(s) containing the smallest replication-proficient fragment. Plasmids pTM41, pTM121, pTM164, and pTM172 were generated by inserting the replication-proficient fragments, isolated as PstI fragments, into the PstI site of pBR325. Plasmids were purified from 500 to 1,000 ml of cell culture grown in Lennox L broth at 30°C by cesium chloride density gradient centrifugation (37). The nucleotide sequences of the cloned replication origins from the marine plasmid-bearing isolates were determined by using the vector primer sequences 5'-ATTGTTGCCGGGAAGCTAGAGTAAGTAGTT-3' and 5'-AATGAAGCCATACCAAACGACGAGCGTGAC-3' and a model ABI 373 automated DNA sequencer (Perkin-Elmer Applied Biosystems). Both strands of repSD41, repSD121, repSD164, and repSD172 were sequenced from pTM41, pTM121, pTM164, and pTM172, respectively. DNA sequences were compiled and analyzed with Oligo version 5.0 (National Biosciences, Inc., Plymouth, Minn.). DNA sequence analysis and alignment were performed by the pairwise correlation method by using Macaw 2.0.5 (National Center for Biotechnology Information, Bethesda, Md.). Different alignments were examined to maximize sequence identity, which was calculated by using GeneDoc 2.1.

Curing of large native plasmid. Electrocompetent cell stocks of Vibrio sp. strain 172 were prepared as recommended by the manufacturer (Invitrogen, San Diego, Calif.). Plasmid pTM172 (1 µg) was introduced into the Vibrio strain by electroporation by using the following conditions: pulse length, 7.5 ms; resistance, 150 ; voltage, 1.8 kV; cuvette gap, 0.1 cm. Electroporated cells were then incubated at 30°C in 1 ml of 0.5× YTSS broth (53) shaken at 200 rpm for 2 h, plated onto 0.5× YTSS plates supplemented with 40 µg of chloramphenicol per ml, and incubated overnight at 30°C. Colonies were restreaked onto fresh selective media, and single colonies were grown at 30°C overnight in selective 0.5× YTSS broth to screen for native plasmid loss by the modified Kieser method (53).

Southern hybridizations. Plasmids pTM41, pTM121, pTM164, and pTM172 were digested with PstI restriction endonuclease, and the DNA fragment containing the replication regions from the plasmids was eluted with QIAquick gel extraction (Qiagen). The isolated DNA fragments which were to be used as probes were labeled by random priming by using [-³²P]dATP (6,000 Ci/mmol; NEN Dupont) and the Boehringer Mannheim (Indianapolis, Ind.) randomly primed DNA labeling system. Following electrophoresis of plasmid DNA on 0.8% LE agarose (FMC, Rockland, Maine), the gels were denatured, neutralized, and blotted onto nylon membranes (Schleicher & Schuell, Inc., Keene, N.H.) essentially as recommended by the manufacturer; however, the DNA was routinely allowed to transfer overnight to ensure complete transfer. Following transfer, the membranes were rinsed in 2× SSPE (1× SSPE is 0.18 M NaCl, 10 mM NaH₂PO₄ [pH 7.7], and 1 mM EDTA) (37), baked for 2 h at 80°C under a vacuum, and stored until hybridization. The membranes were then washed in prewarmed (42°C) 2× SSPE, placed in hybridization bottles (Hybaid Instruments, Holbrook, N.Y.), and prehybridized in 30 ml of hybridization solution consisting of 50% (vol/vol) deionized formamide, 6× SSPE, 5× Denhardt's solution, 1% SDS, and 100 µg of salmon sperm DNA per ml at 37 to 42°C for 4 to 8 h at 7 rpm. Radiolabeled probes were added at a concentration of approximately 2 × 10⁶ cpm per ml, and the preparations were incubated at 37 to 42°C for 16 h at 7 rpm. Unbound probe was removed by washing the membranes twice in 2× SSPE-0.1% SDS for 15 min at 65°C and twice in 1× SSPE-0.1% SDS at 65°C for 30 min in a HybAid oven at 10 rpm. The final wash step was in 0.1× SSPE for 10 min at 65°C, and the membranes were exposed to BioMax X-ray film (Kodak) at 70°C with an intensifying screen. When it was necessary to reprobe membranes with a different environmental plasmid replication probe, bound labeled probe was removed by using the recommendations of the manufacturer (Schleicher & Schuell).

DNA extraction and purification from marine sediments. Total DNA (genomic DNA and plasmid DNA) was extracted from sediment samples (1 to 5 g) by the method of Tsai and Olson (56), with slight modifications. The modifications consisted of two phenol-chloroform extractions rather than one phenol extraction and one phenol-chloroform extraction. The crude DNA extract was purified to remove humic acids and other coextracted contaminants by the method of Tebbe and Vahjen (55) with ion-exchange columns (Qiagen-Tip 500).

PCR amplification. The primers (18- to 21-mers) used for detection of the plasmid replication sequences were based on sequences obtained during this study. The 5'-to-3' sequences of repSD41-1, repSD41-2, repSD164-1, repSD164-2, repSD172-1, and repSD172-2 were AGCAAAACACCCTCTCAG, GTATCAGCGAACTCAACAAA, GCAAGACCAAGCATCACGAAG, CAGCAATCACGCCCCAAT, CCCGTTAAATTGCTAATCAC, and AAGCCTTACAGCGAAAAAG, respectively. Primers were synthesized by Integrated DNA Technologies, Inc. (Coralville, Iowa). Amplification was performed as described by Saiki et. al (47) by using Taq 2000 polymerase (Stratagene, La Jolla, Calif.). Each PCR mixture contained 1× PCR amplification buffer (1.5 mM MgCl₂, 50 mM KCl, 10 mM Tris-HCl [pH 8.8], 0.001% gelatin), deoxynucleoside triphosphates (each at a concentration of 200 µM), 1 µl of a sediment DNA extract (corresponding to the DNA recovered from approximately 5 to 10 mg of sediment), which was used as the DNA template, 2.5 U of Taq polymerase per 100 µl, and 2.5 µg of T4 gene 32 protein (Boehringer Mannheim) per 100 µl. The addition of T4 gene 32 protein, which binds and stabilizes single-stranded DNA, has been shown to improve PCR amplification (55). Amplification of the repSD41 and repSD172 sequences was performed for 35 PCR cycles under the following conditions: denaturation at 95°C for 1 min, primer annealing at 53°C for 1 min, and DNA extension at 72°C for 1 min, with initial incubation at 98°C for 5 min and at 68°C for 5 min. Amplification of the repSD164 sequence was performed for 35 PCR cycles under the following conditions: denaturation at 95°C for 1 min and primer annealing at 70°C for 2 min, with initial incubation at 95°C for 2 min and at 70°C for 2 min. Amplified products were detected on 1.0% agarose gels electrophoresed in TBE buffer, stained with ethidium bromide, and photographed on a UV transilluminator.

Determination of plasmid host range. A modification of the method of Ditta et al. (16) was used to test for the ability of the plasmid origins to replicate in diverse hosts. One milliliter of an overnight cell culture grown in either Luria-Bertani broth containing the appropriate antibiotic or 0.5× YTSS (53) was centrifuged (10,000 × g, 30 s) and resuspended in 0.1 ml of fresh broth. Mating mixtures were prepared by mixing together 1 volume of an overnight liquid culture of the donor strain (E. coli DH5 containing either pFF1, pTM41, pTM121, pTM164, or pTM172), 1 volume of E. coli HB101(pRK2013) (a helper strain), and 5 volumes of the marine bacterial recipient (Table 1). Thirty to thirty-five microliters was spotted onto 0.5× YTSS agar and incubated at 30°C for 2 to 5 days before cells were resuspended and plated. Transconjugants were obtained on 0.5× YTSS containing 40 µg of chloramphenicol per ml and either 75 µg of rifampin per ml to select for the Achromobacter sp. or 200 µg of rifampin per ml to select for Pseudomonas duodoroffii, Pseudomonas nautica, Serratia rubidaea, and Vibrio sp. Putative transconjugants were restreaked several times, and plasmid presence was verified by isolation of plasmid DNA by either the alkaline lysis method of Birnboim and Doly (5) or the modified Kieser method (53). Plasmid integrity was determined by cleavage with PstI. Restriction enzyme-digested DNA was electrophoresed on a 0.7% agarose gel, stained with ethidium bromide, and photographed.

Nucleotide sequence accession numbers. The nucleotide sequences of plasmid replication origins repSD164, repSD41, repSD172, and repSD121 have been deposited in the GenBank database under accession no. AF020624, AF020625, AF020626, and AF03157, respectively. The four 16S rRNA gene sequences obtained in this study have been deposited in the GenBank database under accession no. AF064556, AF064557, AF064558, and AF064559.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

Analysis of plasmid replication origins from marine sediment bacterial isolates. While numerous studies have reported on the incidence and frequency of plasmids in marine water column and sediment bacterial isolates (1, 2, 26, 31, 33, 51, 62), few studies have attempted to classify plasmids from the marine environment by characteristics such as maintenance requirements, host range, incompatibility group, and conjugal proficiency. Using a method to obtain replication-proficient fragments from indigenous plasmids for use as replicon probes, we isolated replication origins from plasmid-bearing marine sediment strains 41, 121, 164, and 172 (Table 1), which belong to the genera Vibrio and Roseobacter and are capable of replicating in E. coli C2110 and DH5. The four replication origins were rescued from plasmids having approximate sizes of 6.0 and 7.0 kb (Fig. 1, lanes 1 through 3) and 30 kb (Fig. 1, lanes 4 and 5).

View larger version (41K): [in this window] [in a new window]   FIG. 1.   Supercoiled plasmid contents of bacterial isolates from coastal marine sediments obtained by ethidium bromide-cesium chloride gradient centrifugation and visualized by ethidium bromide staining of a 0.7% agarose gel. Lane 1, Vibrio sp. isolate 41 (7 kb); lane 2, Vibrio sp. isolate 121 (6 kb); lane 3, Roseobacter sp. isolate 164 (6.5 kb); lane 4, Vibrio sp. isolate 172 (with 0.7-V/cm gel running conditions only one plasmid band was evident); lane 5, Vibrio sp. isolate 172 (20- and 30-kb plasmid bands were visible when the gel running conditions were 0.1 V/cm). Approximate sizes in parentheses were obtained from restriction digests of the plasmids from which functional replication origins were obtained in E. coli. Note that isolates 121, 164, and 172 contain multiple plasmids.

View larger version (18K): [in this window] [in a new window]   FIG. 2.   Schematic diagram of the structural organization of the plasmid replication origins isolated from gram-negative marine sediment bacterial isolates capable of replicating in E. coli, as deduced from the nucleotide sequence. The directions of DnaA boxes are indicated by broad arrows, and the sequences of the plasmid replication origins are similar to the consensus sequence 5'-(T/C)(T/C)(A/T/C)T(A/C)C(A/G)(A/T/C)(A/C)-3' (49). (A) The 2,327-bp fragment containing the repSD41 replication origin obtained from a 7-kb plasmid isolated from marine Vibrio sp. strain 41. ORF, open reading frame that may encode a replication initiation protein. Direct repeats are indicated by arrowheads. The location of the approximately 100-bp AT-rich region is indicated by the cross-hatched box. (B) The 2,140-bp fragment containing the repSD164 replication origin obtained from a 6.5-kb plasmid isolated from marine Roseobacter sp. strain 164 is diagrammed. The open reading frame (ORF) may encode a replication initiation protein. The locations of a region that potentially is able to form a hairpin structure is indicated by the cross-hatched box. Inverted repeats in close proximity to the repSD164 hairpin structure are indicated by thin arrows. nt, nucleotides. (C) The 1,785-bp fragment containing the repSD172 replication origin obtained from a 30-kb plasmid isolated from marine Vibrio sp. strain 172 is diagrammed. Open reading frames 1 and 2 (ORF 1 and ORF 2) may encode proteins involved in plasmid origin replication. The locations of a region that potentially is able to form a hairpin structure is indicated by the cross-hatched box.

View larger version (25K): [in this window] [in a new window]   FIG. 3.   Phylogenetic relationships among plasmid-containing marine bacterial isolates from which plasmid replication fragments were isolated. The tree is unrooted and was constructed with 1,000 bases of aligned 16S rRNA gene sequences by using Bacillus subtilis as the outgroup. The bootstrap values (100 replicates) are indicated above the lines. The bar indicates Jukes-Cantor distances.

View larger version (11K): [in this window] [in a new window]   FIG. 4.   Comparison of the regions of sequence homology in repSD41 and repSD121. Four extended regions with significant levels of similarity (77 to 94%) were aligned on the basis of nucleotide sequence homology as determined by pairwise correlation, and these regions are indicated by solid boxes. The regions of similarity corresponding to base positions 0 to 321 and 29 to 350 had a level of similarity of 94%. The direct repeat (iteron) units of repSD41 and repSD121 are indicated by cross-hatched arrowheads and solid arrowheads, respectively. Base positions 828 to 1373 and 544 to 1089 of repSD41 and repSD121 have a level of similarity of 77%. Analysis of a third region and a fourth region corresponding to base positions 1620 to 1769 and 1869 to 1999 (repSD41) and to base positions 1331 to 1480 and 1561 to 1787 (repSD121) also revealed significant similarity between the repSD41 and repSD121 DNA sequences (levels of similarity, 79 to 81%). ORF, open reading frame.

Host range analysis of plasmid origins from marine isolates. Plasmids capable of autonomous replication in distantly related host backgrounds have important implications for horizontal gene transfer in bacterial communities. While plasmids from nonmarine isolates belonging to incompatibility groups IncN, IncP, IncQ, and IncW have been demonstrated to be capable of replication in a large number of gram-negative bacteria, few plasmids isolated from gram-negative marine bacteria have been shown to have broad-host-range replication capabilities (48). Therefore, we determined the abilities of the various plasmid replicons isolated in this study to replicate in a diverse set of gram-negative marine bacteria belonging to the class Proteobacteria (29, 46). The fact that the four marine plasmid replicons (repSD41, repSD121, repSD164, and repSD172 [Table 3]) can become established in the polA1 E. coli C2110 host indicated that host DNA polymerase I is not required, unlike the ColE1 type family of plasmids, pCU1 (incompatibility group IncN), and gram-positive bacterial plasmid pAM1 (Table 3) (25). All four of the plasmid origins in plasmids pTM41, pTM121, pTM164, and pTM172 could become established after conjugal transfer from an E. coli host and, therefore, are able to replicate in a Vibrio sp. previously isolated from a Georgia salt marsh and in S. rubidaea ATCC 27614 (Table 3). However, the plasmids failed to replicate in the marine host P. nautica (Table 3). Plasmid pFF1 containing the replication origin from the well-characterized broad-host-range plasmid RK2 (IncP), which is stably maintained in a wide range of gram-negative bacteria (50), can replicate in P. nautica and each of the other four marine isolates studied (Table 3). Although the repSD41 and repSD121 replicons appear to be related, they exhibited some differences in host ranges (Achromobacter sp. and P. duodoroffii) (Table 3), suggesting that there are differences in plasmid-host interactions (15). Since each of the four marine plasmid replicons is present as a cointegrate with plasmid pBR325, it was important to demonstrate that pBR325 cannot by itself become established in any of the strains tested (Table 3). In the absence of an environmental replicon (e.g., repSD41, repSD121, repSD164, or repSD172), pBR325 was not maintained in any of the strains tested (Table 3). Restriction enzyme analysis of the plasmid in each marine host after establishment of the plasmid replicons did not reveal any gross rearrangements (e.g., sequence amplification, deletion, or loss) of the established plasmid (data not shown).

Southern hybridization analysis of culturable bacterial populations. To determine the specificity of the four broad-host-range marine plasmid replicons for typing and classifying plasmids from culturable marine bacteria, a Southern blot analysis of E. coli strains containing plasmids belonging to the known broad-host-range incompatibility groups (groups N, P, Q, and W) was conducted. There was a lack of homology between the four incompatibility groups and the DNA probes prepared from repSD41, repSD121, repSD164, and repSD172 (data not shown). While there was no cross-reactivity between the marine replicons repSD41, repSD164, and rep172, there was cross-reactivity between the repSD41 and repSD121 replicons when they were probed with each other (data not shown).

Plasmid replication sequences in microbial community DNA. The bacterial isolation method used in this study resulted in cultivation of 0.01% of the total bacterial population from marine sediments (based on DAPI direct counts) (data not shown) regardless of the sampling date. Using primers based on the sequences obtained for the replication origins of plasmids isolated from culturable plasmid-bearing marine sediment bacteria, we attempted to determine the presence of three plasmid replicons (repSD41, repSD164, and repSD172) in microbial community DNA extracted from coastal marine sediment samples collected on different dates.

View larger version (55K): [in this window] [in a new window]   FIG. 5.   (A) Amplification of indigenous plasmid replication sequences from DNA extracted from marine sediment microbial communities: ethidium bromide-stained 0.8% agarose gel electrophoresis of PCR-amplified DNA obtained with either repSD41-specific primers (lanes 2 to 5), repSD164-specific primers (lanes 6 to 9), or repSD172-specific primers (lanes 10 to 13). Lane 1, 1-kb DNA size standard; lane 2, positive control (cesium chloride-purified plasmid pTM41 DNA); lane 3, total community DNA extracted from 1 g of sediment collected in November 1995; lane 4, total community DNA extracted from 1 g of sediment collected in June 1997; lane 5, negative control (sterilized sediment with no template DNA added); lane 6, positive control (cesium chloride-purified plasmid pTM164 DNA); lane 7, total community DNA extracted from 1 g of sediment collected in August 1995; lane 8, total community DNA extracted from 1 g of sediment collected in November 1995; lane 9, negative control (sterilized sediment with no template DNA added); lane 10, positive control (cesium chloride-purified plasmid pTM172 DNA); lane 11, total community DNA extracted from 1 g of sediment collected in November 1995; lane 12, total community DNA extracted from 1 g of sediment collected in June 1997; lane 13, negative control (sterilized sediment with no template DNA added). (B) Corresponding Southern blot analysis performed with the 1,302-bp repSD41 probe. (C) Corresponding Southern blot analysis performed with the 875-bp repSD172 probe. The band showing homology to the repSD172 probe below the predominant PCR product after 36 to 48 h of exposure to X-ray film represents smaller amplified replication products likely due to differential annealing of the PCR primers to the template DNA.

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

The typical clustering of genes essential for plasmid replication has facilitated isolation and characterization of replicons from plasmids isolated from bacteria of clinical and animal origins. Minimal replicons containing replication and incompatibility loci have been demonstrated to be valuable in molecular typing of plasmids from bacterial isolates of medical importance (9, 10). Replicon probes derived from plasmids found in members of the Enterobacteriaceae have not been suitable, however, for classifying plasmids isolated from either indigenous bacterial populations in coastal marine sediments (53), the marine air-water interface bulk water and biofilm communities (11), or the natural bacterial flora associated with the sugar beet phyllosphere (30). With the exception of recent studies performed with plasmids isolated from bacterial populations associated with terrestrial plant communities (24, 58), little, if any, information is available regarding the replication and incompatibility functions of bacterial plasmids occurring in natural microbial communities.

To date, only a limited number of plasmids from marine bacteria have been characterized at the molecular level (38, 57). Since molecular characterization (replicon typing) of plasmids from marine bacterial populations requires probes specific for a plasmid replication region, we isolated replication regions from several indigenous marine isolates for use as replicon probes. The same probes can be used eventually for assigning plasmids to specific incompatibility groups. Along with the four replicons used in this study, we recently isolated an additional replicon (data not shown) which can be stably propagated in E. coli hosts, indicating that a number of indigenous plasmids from marine bacteria have an extended replication host range. We failed to isolate replicons from six other plasmids, which may indicate either that the plasmids have a limited or narrow host range or that the necessary genetic information for replication is not tightly clustered and, therefore, is not be readily isolated by the method used in this study. The structural features of the repSD164 replicon suggest that pTM164 replicates via a rolling-circle mechanism, a widely dispersed strategy common in plasmids that are less than 10 kb long (25). The presence of features similar to the features of a number of plasmids that contain iterons as essential components of the origin and the presence of an open reading frame that potentially encodes a replication initiation protein suggest that the related replicons repSD41 and repSD121 use the theta mode of replication (25). Of course, much more work must be done to determine what elements in the replicons of plasmids pTM41, pTM121, pTM164, and pTM172 are absolutely essential for replicon activity before a specific replication control mechanism can be ascribed to each of these replicons. Sequence analysis revealed that the replication origins of four plasmids from gram-negative marine bacteria characterized in our study contained structural features and general organization patterns common to known replication origins (15, 25). However, sequence analysis of the replication origins of plasmids from a marine environment failed to reveal homology (e.g., there was no similarity to known rep proteins) to previously characterized replicons derived from clinical sources.

Plasmids that can replicate and be stably maintained in members of distantly related bacterial families are considered to have broad host ranges (13, 22). DNA fragments containing a functional replicon obtained from the indigenous plasmids of marine bacteria were propagated in distantly related members of the Proteobacteria, indicating that all necessary information for replication was contained on the isolated fragments. Early events in the initiation of plasmid replication independent of host factors and versatility in the interactions between plasmid-specific and host-encoded initiation proteins are two strategies thought to contribute to the ability of broad-host-range plasmids to become established in different hosts (25). The extent of plasmid host range has important implications for gene exchange in bacterial populations. Plasmids with broad host ranges are likely to mediate the dissemination of genes, presumably encoding advantageous traits, throughout microbial communities. While we did not determine the transfer abilities of the naturally occurring plasmids characterized in this study, our findings at least indicate that plasmids isolated from microbial communities of coastal marine sediments encode replication origins that have broad-host-range capabilities. Upon transfer, either through conjugation, transformation, or transduction events, such replicons should allow replication to proceed in both similar and unrelated hosts, thereby greatly increasing the potential spread of advantageous plasmid-encoded genes throughout the microbial population. It is interesting that two recent studies have suggested that plasmid-mediated gene exchange may occur infrequently between some indigenous populations of Rhizobium sp. and Bacillus sp. (61, 63).

Previously, Gotz et al. (21) used PCR-based methods to detect broad-host-range plasmids belonging to the classic incompatibility groups (groups IncN, IncP, IncQ, and IncW) in soil and manure slurries. We were able to amplify from total environmental DNA repSD41- and repSD172-specific replication sequences of marine sediment microbial community DNA obtained on sampling dates in November 1995 and June 1997. Although we have recently demonstrated that many plasmids present in culturable marine sediment bacterial populations do not carry readily assayed selective traits (53), it is likely that the metabolic burden of maintaining plasmids requires that some selective advantage be conferred to the host bacterium. Our findings therefore suggest that the repSD41 and repSD172 replicons have an established presence in the marine sediment microbial community, thus presumably conferring some advantageous trait(s) to the host cells. Previously, Lilley et al. (35) demonstrated the long-term persistence of distinct groups of large (>250-kb) self-transmissible plasmids in the natural bacterial populations of sugar beet crops sampled at the same site for 3 consecutive years. However, apart from conferring narrow-spectrum resistance to mercury, there was no obvious selective advantage encoded on these plasmids to account for their continued persistence in the sugar beet microbial community. It is of considerable interest to determine if plasmids in marine bacteria have evolved mechanisms similar to the partitioning and postsegregational killing systems found in a number of plasmids found in bacteria of clinical origin to provide for their stable maintenance (7, 20, 34, 45).

Although efforts in this study focused on characterizing plasmids from a limited number of bacteria from a culturable marine sediment population, the extent of replicon diversity and the potential for broad-host-range replication of plasmids occurring in marine microbial communities are striking. The fact that plasmid replication origins with broad host ranges can be readily isolated from marine bacterial isolates suggests that plasmid-mediated gene exchange between members of diverse bacterial genera is an important mechanism by which marine sediment microbial communities can evolve and adapt to changes or fluctuations in environmental conditions. The continued development of replicon probes specific for plasmids from environmental sources, such as marine sediments, should greatly enhance future studies of plasmid diversity and the distribution and flow of genes in natural microbial communities.