This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tanner, M. A.
Right arrow Articles by Pace, N. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tanner, M. A.
Right arrow Articles by Pace, N. R.
Agricola
Right arrow Articles by Tanner, M. A.
Right arrow Articles by Pace, N. R.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, August 1998, p. 3110-3113, Vol. 64, No. 8
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Specific Ribosomal DNA Sequences from Diverse Environmental Settings Correlate with Experimental Contaminants

Michael A. Tanner, Brett M. Goebel,dagger Michael A. Dojka, and Norman R. Pace*

Departments of Plant and Microbial Biology and Molecular and Cell Biology, University of California, Berkeley, California 94720-3102

Received 23 April 1998/Accepted 10 June 1998

    ABSTRACT
Top
Abstract
Text
References

Phylogenetic analysis of 16S ribosomal DNA (rDNA) clones obtained by PCR from uncultured bacteria inhabiting a wide range of environments has increased our knowledge of bacterial diversity. One possible problem in the assessment of bacterial diversity based on sequence information is that PCR is exquisitely sensitive to contaminating 16S rDNA. This raises the possibility that some putative environmental rRNA sequences in fact correspond to contaminant sequences. To document potential contaminants, we cloned and sequenced PCR-amplified 16S rDNA fragments obtained at low levels in the absence of added template DNA. 16S rDNA sequences closely related to the genera Duganella (formerly Zoogloea), Acinetobacter, Stenotrophomonas, Escherichia, Leptothrix, and Herbaspirillum were identified in contaminant libraries and in clone libraries from diverse, generally low-biomass habitats. The rRNA sequences detected possibly are common contaminants in reagents used to prepare genomic DNA. Consequently, their detection in processed environmental samples may not reflect environmentally relevant organisms.

    TEXT
Top
Abstract
Text
References

Knowledge of microbial diversity has increased dramatically in recent years, in part as a result of sequencing of rRNA genes from DNA obtained directly from uncultured microbiota, often by use of PCR and rRNA-specific primers (2, 21). This approach has been applied to assess the microbial diversity in a variety of environments, for instance, arctic tundra (34), marine deep subsurfaces (27), Yellowstone hot springs (14), peat bogs (26), and human infections (9, 12, 17). Although the approach has produced a diverse collection of sequences and expanded our view of microbial diversity, analysis of microbial 16S ribosomal DNA (rDNA) sequences has limitations in relating specific rDNA sequences to organisms in the environment under study and is fraught with potential artifacts.

One potential artifact in the application of PCR to community analysis is the possible introduction of contaminating rDNA during experimental procedures, particularly in steps preceding PCR. In the course of compiling environmental 16S rDNA sequences, we have noted some highly similar (>99%) sequences that are obtained from many physically and chemically distinct environments. The organisms represented by these sequences may indeed be prevalent in such diverse environments. However, the difficulty in preparing genomic DNA absolutely free from contaminating DNA, coupled with the exquisite sensitivity of PCR to amplify trace target DNA, make contamination a serious issue, particularly with low-biomass samples (16, 18, 28, 29). We report here a survey of 16S rDNA sequences that were obtained from negative extraction controls, that is, DNA extraction and purification performed without added sample, and the correspondence of these sequences to some recovered from diverse environmental settings.

We surveyed the 16S rDNA sequences from 96 clones derived from a PCR product resulting from a control extraction that did not contain an environmental sample. Less-extensive analyses have been conducted with independently processed negative controls. The extraction was carried out in the same manner as with authentic samples containing genomic DNA, by using lysozyme, proteinase K, sodium dodecyl sulfate, bead beating, and phenol treatment as described elsewhere (4). Details were as follows: buffer A consisted of 200 mM Tris HCl (pH 8.0), 200 mM NaCl, and 20 mM EDTA, bead beating (0.5 g of acid-washed beads) was carried out for 2 min at low speed and 0.5 min at high speed, and nucleic acids were precipitated from 300 mM NaCl and 3 volumes of 100% ethanol. All solutions were prepared with autoclaved, filtered (0.2-µm-pore-size filter, Sterile Acrodisc; Gelman Sciences) ddH2O prior to use. Although some small bacteria potentially could pass through the 0.2-µm filter pores, a negative control in the absence of any template, that is, without the negative extraction control material, resulted in no PCR product after 40 cycles. All DNA extraction procedures and manipulations were performed in a laminar flow hood to minimize aerial contamination. The sample was dissolved in 200 µl of water, and 100-µl PCRs were carried out with 1 µl of template (40 cycles of touchdown PCR, consisting of 20 cycles of 1 min at 94°C, 40 s starting at 67°C and decreasing by 1°C/cycle, and 1 min at 72°C, and 20 cycles of 1 min at 94°C, 1 min at 50°C, and 1.5 min plus 1 s/cycle at 72°C). Five units of Ampli Taq Gold (Perkin-Elmer) was added per 100 µl of reaction mixture. Bacterium-specific primers were used for the amplification (27F, AGAGTTTGATCCTGGCTCAG, and 805R, GACTACCAGGGTATCTAATCC). These primers match most sequences in the domain Bacteria in the primer target region. Three 100-µl reaction products were precipitated with ethanol, and the entire sample was resolved by agarose gel electrophoresis. Even with these precautions, rDNA-sized PCR products were obtained after extended rounds of thermal cycling. The rDNA-sized PCR products were eluted from the gel and cloned, and 96 clones were analyzed by restriction fragment length polymorphisms (RFLP) by using the enzymes MspI and HinP1I as detailed by Hugenholtz et al. (14). Twenty different RFLP types were identified and sequenced. The 16S rDNA sequences (460 to 780 nucleotides [nt]) were compared to known sequences by using the gapped BLAST search algorithm (1, 5) and were aligned to close relatives by using the GDE alignment editor (19). 16S rDNA sequences were placed into a phylogenetic tree containing more than 7,000 bacterial rDNA sequences by using the ARB software package (30).

Analysis of clones from the negative extraction control revealed a diverse collection of contaminant sequences. We have seen similar sequences in other analyses of contaminant rDNAs. 16S rDNA sequences essentially identical to the negative-control sequences also have been encountered by a number of laboratories in clone libraries from a broad diversity of environments, as summarized in Table 1. Additional sequences from the negative control, not reported in environmental analyses, are related to the rDNAs of the following organisms: Micrococcus luteus (98% identity to MT2), Pseudomonas aeruginosa (99% identity to MT5), an Afipia sp. (97% identity to MT8), Variovorax paradoxus (97% identity to MT11), Gemella haemolysans (100% identity to MT1), Shigella boydii (99% identity to MT19), and Phyllobacterium myrsinacearum (99% identity to MT17). A few sequences were <95% identical to those of known organisms. A compilation of sequences obtained from negative-control libraries is available from our web site at http://crab2.berkeley.edu/pacelab/177.htm. This site will be updated as additional sequences are determined from negative-control libraries. Submissions are welcomed.

                              
View this table:
[in this window]
[in a new window]
  		TABLE 1.   Distribution of contaminant clones with representatives from environmental studies

Several contaminant clones and numerous environmental clones from diverse environments are closely related to rDNAs of the genus Duganella (formerly Zoogloea). Such organisms (beta -proteobacteria) commonly contaminate water sources and are routinely isolated from wastewater environments (13) and drinking-water biofilms (15). Their occurrence in materials used for laboratory experiments is, therefore, not surprising. Figure 1 shows the relationships of some of the contaminant sequences and environmental groups of sequences to those of Duganella zoogloeoides and Herbaspirillum seropedicae. The Duganella relatedness group, seen as two clades with ca. 98.5% identity in rRNA sequences, consists mostly of environmental rDNA sequences, all nearly identical, from various published studies (6, 8, 9, 20, 22-24, 27, 34). In addition to the Duganella cluster of sequences, a number of other prevalent contaminant sequences, listed in Table 1, correspond closely to sequences reported from diverse environments. Leptothrix spp., for instance, like Duganella spp., are found in slowly flowing fresh water and in polluted water and activated sludge. It is remarkable that essentially identical rRNA sequences are obtained from such different environments as deep subsurface groundwaters, a marine sediment, a Yellowstone hot spring, a guinea pig lung, and a dentoalveolar abscess (pus around the teeth). All of the extractions of environmental samples that resulted in clones equivalent to the contaminant rDNAs are likely to have contained only very low levels of biomass. Extraction of DNA from low-biomass samples is particularly sensitive to potentially contaminating DNA during processing because the contaminating DNA is minimally diluted by sample DNA. The exact sources of contamination were not determined; however, the Taq polymerase and amplification buffer are not detectably contaminated, since reactions without added template or negative extraction control material did not produce amplified products. Therefore, the most likely sources of contamination are salts and buffers, lysozyme, proteinase K, and/or the zirconia/silica beads.


View larger version (27K):
[in this window]
[in a new window]
  		FIG. 1.   Evolutionary-distance dendrogram showing the relative positions of environmental 16S rDNA clone and strain sequences to the genera Duganella and Herbaspirillum. Bar indicates nucleotide substitution rate. The sequence length in nucleotides follows the clone or strain designation. References for clones are given in Table 1. Clones are boldfaced; the cultivated strains marine isolate BAL15 (25), arctic isolate arc21 (3), and strain Mena 23/3-3c (32) are shown in lightface. Sequences for described bacterial species (italics) were obtained from GenBank (5). The rDNA sequence from Rhodocyclus purpureus was used as an outgroup. The resolution of the tree shown here is limited by the quality of the sequence data and the short lengths (fewer than 500 nt) of many sequences. Short sequences (<500 nt) were inserted into the tree by using the parsimony insertion tool of the ARB software program (30). The contaminant clone CTHB-18 was identified in a separate negative-control extraction independently from that for the MT clone library.

In this study, we report that many small-subunit rRNA sequences obtained from no-sample control clone libraries are closely related to sequences recovered in other studies from diverse environmental samples. This correspondence of contaminant and environmental sequences may indicate that some of the environmental sequences are derived as experimental contaminants and have no relevance to the environmental communities. Since any source of contaminant sequences is likely to be idiosyncratic, dependent on the operator, source of reagents, water, etc., researchers examining biodiversity using environmental cloning techniques must be aware of this issue and make every effort to minimize, detect, and analyze potential contamination. Perhaps the most important message from results presented here is that definitive proof for the occurrence of an organism indicated by a cloned rRNA sequence requires explicit identification of that organism in situ. Currently, this is most readily achieved by using 16S rRNA-based fluorescence hybridization techniques (2, 7).

Nucleotide sequence accession numbers. Sequences for the following negative-control clones (with the accession numbers given in parentheses) were deposited in the GenBank database: MT3 (AF058381), MT6 (AF058382), MT9 (AF058375), MT11 (AF058383), MT14 (AF058384), MT18 (AF058385), MT22 (AF058386), CMT35P (AF061574), and CTHB-18, (AF067655). MT2, MT5, and MT8 have accession no. AF058372 to AF058374, respectively. MT12, MT17, and MT19 have accession no. AF058377 to AF058379, respectively.

    ACKNOWLEDGMENTS

We thank Phil Hugenholtz for comments on the manuscript and Chris Pitulle for stimulating discussions.

This work was supported by grants from the NIH and the U.S. Department of Energy.

    FOOTNOTES

* Corresponding author. Mailing address: Departments of Plant and Microbial Biology and Molecular and Cell Biology, 111 Koshland Hall, University of California, Berkeley, CA 94720-3102. Phone: (510) 643-2571. Fax: (510) 642-4995. E-mail: nrpace{at}nature.berkeley.edu.

dagger Present address: Australian Magnesium Corporation, Toowong, Queensland, 4066 Australia.

    REFERENCES
Top
Abstract
Text
References

1. Altschul, S. F., T. L. Madden, A. A. Schäffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402[Abstract/Free Full Text].
2. Amann, R. I., W. Ludwig, and K. H. Schleifer. 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59:143-169[Abstract/Free Full Text].
3. Bahr, M., J. E. Hobbie, and M. L. Sogin. 1996. Bacterial diversity in an arctic lake: a freshwater SAR11 cluster. Aquat. Microb. Ecol. 11:271-277.
4. Barns, S. M., C. F. Delwiche, J. D. Palmer, and N. R. Pace. 1996. Perspectives on archaeal diversity, thermophily and monophyly from environmental rRNA sequences. Proc. Natl. Acad. Sci. USA 93:9188-9193[Abstract/Free Full Text].
5. Benson, D. A., M. S. Boguski, D. J. Lipman, J. Ostell, and B. F. F. Ouellette. 1998. GenBank. Nucleic Acids Res. 26:1-7[Abstract/Free Full Text].
6. Coates, J. D., D. J. Ellis, E. L. Blunt-Harris, C. V. Gaw, E. E. Roden, and D. R. Lovley. 1998. Recovery of humic-reducing bacteria from a diversity of environments. Appl. Environ. Microbiol. 64:1504-1509[Abstract/Free Full Text].
7. DeLong, E. F., G. S. Wickham, and N. R. Pace. 1989. Phylogenetic stains: ribosomal RNA-based probes for the identification of single cells. Science 243:1360-1363[Abstract/Free Full Text].
8. Dojka, M. A., P. Hugenholtz, S. K. Haack, and N. R. Pace. Microbial diversity in a hydrocarbon and chlorinated solvent-contaminated aquifer undergoing intrinsic bioremediation. Submitted for publication.
9. Dymock, D., A. J. Weightman, C. Scully, and W. G. Wade. 1996. Molecular analysis of microflora associated with dentoalveolar abscesses. J. Clin. Microbiol. 34:537-542[Abstract].
10. Ekendahl, S., J. Arlinger, F. Ståhl, and K. Pedersen. 1994. Characterization of attached bacterial populations in deep granitic groundwater from the Stripa research mine by 16S rRNA gene sequencing and scanning electron microscopy. Microbiology 140:1575-1583[Abstract/Free Full Text].
11. Goebel, B. M., and N. R. Pace. 1998. Unpublished data.
12. Goldenberger, D., A. Künzli, P. Vogt, R. Zbinden, and M. Altwegg. 1997. Molecular diagnosis of bacterial endocarditis by broad-range PCR amplification and direct sequencing. J. Clin. Microbiol. 35:2733-2739[Abstract].
13. Hiraishi, A., Y. K. Shin, and J. Sugiyama. 1997. Proposal to reclassify Zoogloea ramigera IAM 12670 (P. R. Dugan 115) as Duganella zoogloeoides gen. nov., sp. nov. Int. J. Syst. Bacteriol. 47:1249-1252[Abstract/Free Full Text].
14. Hugenholtz, P., C. Pitulle, K. L. Hershberger, and N. R. Pace. 1998. Novel division level bacterial diversity in a Yellowstone hot spring. J. Bacteriol. 180:366-376[Abstract/Free Full Text].
15. Kalmbach, S., W. Manz, and U. Szewzyk. 1997. Isolation of new bacterial species from drinking water biofilms and proof of their in situ dominance with highly specific 16S rRNA probes. Appl. Environ. Microbiol. 63:4164-4170[Abstract].
16. Kitchin, P. A., Z. Szotyori, C. Fromholc, and N. Almond. 1990. Avoidance of PCR false positives. Nature 344:201[Medline].
17. Krieger, J. N., D. E. Riley, M. C. Roberts, and R. E. Berger. 1996. Prokaryotic DNA sequences in patients with chronic idiopathic prostatitis. J. Clin. Microbiol. 34:3120-3128[Abstract].
18. Kwok, S., and R. Higuchi. 1989. Avoiding false positives with PCR. Nature 339:237-238[Medline].
19. Maidak, B. L., G. J. Olsen, N. Larsen, R. Overbeek, M. J. McCaughey, and C. R. Woese. 1997. The RDP (Ribosomal Database Project). Nucleic Acids Res. 25:109-110[Abstract/Free Full Text].
20. Nüsslein, K., and J. M. Tiedje. 1998. Characterization of the dominant and rare members of a young Hawaiian soil bacterial community with small-subunit ribosomal DNA amplified from DNA fractionated on the basis of guanine and cytosine composition. Appl. Environ. Microbiol. 64:1283-1289[Abstract/Free Full Text].
21. Pace, N. R. 1997. A molecular view of microbial diversity and the biosphere. Science 276:734-740[Abstract/Free Full Text].
22. Pedersen, K. 1996. Investigations of subterranean bacteria in deep crystalline bedrock and their importance for the disposal of nuclear waste. Can. J. Microbiol. 42:382-391.
23. Pedersen, K., J. Arlinger, S. Ekendahl, and L. Hallbeck. 1996. 16S rRNA gene diversity of attached and unattached bacteria in boreholes along the access tunnel to the Äspö hard rock laboratory, Sweden. FEMS Microbiol. Ecol. 19:249-262.
24. Pedersen, K., J. Arlinger, L. Hallbeck, and C. Pettersson. 1996. Diversity and distribution of subterranean bacteria in groundwater at Oklo in Gabon, Africa, as determined by 16S rRNA gene sequencing. Mol. Ecol. 5:427-436[Medline].
25. Pinhassi, J., U. L. Zweifel, and Å. Hagström. 1997. Dominant marine bacterioplankton species found among colony-forming bacteria. Appl. Environ. Microbiol. 63:3359-3366[Abstract].
26. Rheims, H., F. A. Rainey, and E. Stackebrandt. 1996. A molecular approach to search for diversity among bacteria in the environment. J. Ind. Microbiol. 17:159-169.
27. Rochelle, P. A., B. A. Cragg, J. C. Fry, R. J. Parkes, and A. J. Weightman. 1994. Effect of sample handling on estimation of bacterial diversity in marine sediments by 16S rRNA gene sequence analysis. FEMS Microbiol. Ecol. 15:215-226.
28. Sarkar, G., and S. S. Sommer. 1990. Shedding light on PCR contamination. Nature 343:27[Medline].
29. Schmidt, T. M., B. Pace, and N. R. Pace. 1991. Detection of DNA contamination in Taq polymerase. BioTechniques 11:176-177[Medline].
30. Strunk, O., O. Gross, B. Reichel, M. May, S. Hermann, N. Struckmann, B. Nonhoff, M. Lenke, A. Vilbig, T. Ludwig, A. Bode, K. H. Schleifer, and W. Ludwig. ARB: a software environment for sequence data. Submitted for publication.
31. Tanner, M. A., and N. R. Pace. 1998. Unpublished data.
32. Tinschert, A., A. Kiener, K. Heinzmann, and A. Tschech. 1997. Isolation of new 6-methylnicotinic-acid-degrading bacteria, one of which catalyses the regioselective hydroxylation of nicotinic acid at position C2. Arch. Microbiol. 168:355-361[Medline].
33. Wise, M. G., J. V. McArthur, and L. J. Shimkets. 1997. Bacterial diversity of a Carolina bay as determined by 16S rRNA gene analysis: confirmation of novel taxa. Appl. Environ. Microbiol. 63:1505-1514[Abstract].
34. Zhou, J., M. E. Davey, J. B. Figueras, E. Rivkina, D. Gilichinsky, and J. M. Tiedje. 1997. Phylogenetic diversity of a bacterial community determined from Siberian tundra soil DNA. Microbiology 143:3913-3919[Abstract/Free Full Text].

Applied and Environmental Microbiology, August 1998, p. 3110-3113, Vol. 64, No. 8
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:

  • Zouache, K., Voronin, D., Tran-Van, V., Mavingui, P. (2009). Composition of Bacterial Communities Associated with Natural and Laboratory Populations of Asobara tabida Infected with Wolbachia. Appl. Environ. Microbiol. 75: 3755-3764 [Abstract] [Full Text]  
  • Hooper, S. J., Crean, S.-J., Fardy, M. J., Lewis, M. A. O., Spratt, D. A., Wade, W. G., Wilson, M. J. (2007). A molecular analysis of the bacteria present within oral squamous cell carcinoma. J Med Microbiol 56: 1651-1659 [Abstract] [Full Text]  
  • Perreault, N. N., Andersen, D. T., Pollard, W. H., Greer, C. W., Whyte, L. G. (2007). Characterization of the Prokaryotic Diversity in Cold Saline Perennial Springs of the Canadian High Arctic. Appl. Environ. Microbiol. 73: 1532-1543 [Abstract] [Full Text]  
  • Janssen, P. H. (2006). Identifying the Dominant Soil Bacterial Taxa in Libraries of 16S rRNA and 16S rRNA Genes.. Appl. Environ. Microbiol. 72: 1719-1728 [Full Text]  
  • Alexeeva, I., Elliott, E. J., Rollins, S., Gasparich, G. E., Lazar, J., Rohwer, R. G. (2006). Absence of Spiroplasma or Other Bacterial 16S rRNA Genes in Brain Tissue of Hamsters with Scrapie. J. Clin. Microbiol. 44: 91-97 [Abstract] [Full Text]  
  • Beumer, A., Robinson, J. B. (2005). A Broad-Host-Range, Generalized Transducing Phage (SN-T) Acquires 16S rRNA Genes from Different Genera of Bacteria. Appl. Environ. Microbiol. 71: 8301-8304 [Abstract] [Full Text]  
  • Sekar, R., Fuchs, B. M., Amann, R., Pernthaler, J. (2004). Flow Sorting of Marine Bacterioplankton after Fluorescence In Situ Hybridization. Appl. Environ. Microbiol. 70: 6210-6219 [Abstract] [Full Text]  
  • Takai, K., Oida, H., Suzuki, Y., Hirayama, H., Nakagawa, S., Nunoura, T., Inagaki, F., Nealson, K. H., Horikoshi, K. (2004). Spatial Distribution of Marine Crenarchaeota Group I in the Vicinity of Deep-Sea Hydrothermal Systems. Appl. Environ. Microbiol. 70: 2404-2413 [Abstract] [Full Text]  
  • de la Torre, J. R., Goebel, B. M., Friedmann, E. I., Pace, N. R. (2003). Microbial Diversity of Cryptoendolithic Communities from the McMurdo Dry Valleys, Antarctica. Appl. Environ. Microbiol. 69: 3858-3867 [Abstract] [Full Text]  
  • Drancourt, M., Jacomo, V., Lepidi, H., Lechevallier, E., Grisoni, V., Coulange, C., Ragni, E., Alasia, C., Dussol, B., Berland, Y., Raoult, D. (2003). Attempted Isolation of Nanobacterium sp. Microorganisms from Upper Urinary Tract Stones. J. Clin. Microbiol. 41: 368-372 [Abstract] [Full Text]  
  • Manefield, M., Whiteley, A. S., Griffiths, R. I., Bailey, M. J. (2002). RNA Stable Isotope Probing, a Novel Means of Linking Microbial Community Function to Phylogeny. Appl. Environ. Microbiol. 68: 5367-5373 [Abstract] [Full Text]  
  • Rantakokko-Jalava, K., Jalava, J. (2002). Optimal DNA Isolation Method for Detection of Bacteria in Clinical Specimens by Broad-Range PCR. J. Clin. Microbiol. 40: 4211-4217 [Abstract] [Full Text]  
  • Munson, M.A., Pitt-Ford, T., Chong, B., Weightman, A., Wade, W.G. (2002). Molecular and Cultural Analysis of the Microflora Associated with Endodontic Infections. JDR 81: 761-766 [Abstract] [Full Text]  
  • Siciliano, S. D., Germida, J. J., Banks, K., Greer, C. W. (2002). Changes in Microbial Community Composition and Function during a Polyaromatic Hydrocarbon Phytoremediation Field Trial. Appl. Environ. Microbiol. 69: 483-489 [Abstract] [Full Text]  
  • Takai, K., Komatsu, T., Inagaki, F., Horikoshi, K. (2001). Distribution of Archaea in a Black Smoker Chimney Structure. Appl. Environ. Microbiol. 67: 3618-3629 [Abstract] [Full Text]  
  • Nikkari, S., McLaughlin, I. J., Bi, W., Dodge, D. E., Relman, D. A. (2001). Does Blood of Healthy Subjects Contain Bacterial Ribosomal DNA?. J. Clin. Microbiol. 39: 1956-1959 [Abstract] [Full Text]  
  • Jalava, J, Skurnik, M, Toivanen, A, Toivanen, P, Eerola, E (2001). Bacterial PCR in the diagnosis of joint infection. Ann Rheum Dis 60: 287-289 [Abstract] [Full Text]  
  • Glöckner, F. O., Zaichikov, E., Belkova, N., Denissova, L., Pernthaler, J., Pernthaler, A., Amann, R. (2000). Comparative 16S rRNA Analysis of Lake Bacterioplankton Reveals Globally Distributed Phylogenetic Clusters Including an Abundant Group of Actinobacteria. Appl. Environ. Microbiol. 66: 5053-5065 [Abstract] [Full Text]  
  • Cisar, J. O., Xu, D.-Q., Thompson, J., Swaim, W., Hu, L., Kopecko, D. J. (2000). An alternative interpretation of nanobacteria-induced biomineralization. Proc. Natl. Acad. Sci. USA 97: 11511-11515 [Abstract] [Full Text]  
  • ben Omar, N., Ampe, F. (2000). Microbial Community Dynamics during Production of the Mexican Fermented Maize Dough Pozol. Appl. Environ. Microbiol. 66: 3664-3673 [Abstract] [Full Text]  
  • Tanner, M. A., Everett, C. L., Youvan, D. C. (2000). Molecular Phylogenetic Evidence for Noninvasive Zoonotic Transmission of Staphylococcus intermedius from a Canine Pet to a Human. J. Clin. Microbiol. 38: 1628-1631 [Abstract] [Full Text]  
  • Rantakokko-Jalava, K., Nikkari, S., Jalava, J., Eerola, E., Skurnik, M., Meurman, O., Ruuskanen, O., Alanen, A., Kotilainen, E., Toivanen, P., Kotilainen, P. (2000). Direct Amplification of rRNA Genes in Diagnosis of Bacterial Infections. J. Clin. Microbiol. 38: 32-39 [Abstract] [Full Text]  
  • Ampe, F., ben Omar, N., Moizan, C., Wacher, C., Guyot, J.-P. (1999). Polyphasic Study of the Spatial Distribution of Microorganisms in Mexican Pozol, a Fermented Maize Dough, Demonstrates the Need for Cultivation-Independent Methods To Investigate Traditional Fermentations. Appl. Environ. Microbiol. 65: 5464-5473 [Abstract] [Full Text]  
  • Takai, K., Horikoshi, K. (1999). Molecular Phylogenetic Analysis of Archaeal Intron-Containing Genes Coding for rRNA Obtained from a Deep-Subsurface Geothermal Water Pool. Appl. Environ. Microbiol. 65: 5586-5589 [Abstract] [Full Text]  
  • Friedrich, U., Naismith, M. M., Altendorf, K., Lipski, A. (1999). Community Analysis of Biofilters Using Fluorescence In Situ Hybridization Including a New Probe for the Xanthomonas Branch of the Class Proteobacteria. Appl. Environ. Microbiol. 65: 3547-3554 [Abstract] [Full Text]  
  • Takai, K., Horikoshi, K. (1999). Genetic Diversity of Archaea in Deep-Sea Hydrothermal Vent Environments. Genetics 152: 1285-1297 [Abstract] [Full Text]  
  • Crump, B. C., Armbrust, E. V., Baross, J. A. (1999). Phylogenetic Analysis of Particle-Attached and Free-Living Bacterial Communities in the Columbia River, Its Estuary, and the Adjacent Coastal Ocean. Appl. Environ. Microbiol. 65: 3192-3204 [Abstract] [Full Text]  
  • Tanner, M. A., Shoskes, D., Shahed, A., Pace, N. R. (1999). Prevalence of Corynebacterial 16S rRNA Sequences in Patients with Bacterial and "Nonbacterial" Prostatitis. J. Clin. Microbiol. 37: 1863-1870 [Abstract] [Full Text]  
  • Kricka, L. J. (1999). Nucleic Acid Detection Technologies — Labels, Strategies, and Formats. Clin. Chem. 45: 453-458 [Abstract] [Full Text]  
  • Dojka, M. A., Hugenholtz, P., Haack, S. K., Pace, N. R. (1998). Microbial Diversity in a Hydrocarbon- and Chlorinated-Solvent-Contaminated Aquifer Undergoing Intrinsic Bioremediation. Appl. Environ. Microbiol. 64: 3869-3877 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tanner, M. A.
Right arrow Articles by Pace, N. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tanner, M. A.
Right arrow Articles by Pace, N. R.
Agricola
Right arrow Articles by Tanner, M. A.
Right arrow Articles by Pace, N. R.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»