Previous Article | Next Article ![]()
Applied and Environmental Microbiology, August 1998, p. 3110-3113, Vol. 64, No. 8
Departments of Plant and Microbial Biology
and Molecular and Cell Biology, University of California, Berkeley,
California 94720-3102
Received 23 April 1998/Accepted 10 June 1998
Phylogenetic analysis of 16S ribosomal DNA (rDNA) clones obtained
by PCR from uncultured bacteria inhabiting a wide range of environments
has increased our knowledge of bacterial diversity. One possible
problem in the assessment of bacterial diversity based on sequence
information is that PCR is exquisitely sensitive to contaminating 16S
rDNA. This raises the possibility that some putative environmental rRNA
sequences in fact correspond to contaminant sequences. To document
potential contaminants, we cloned and sequenced PCR-amplified 16S rDNA
fragments obtained at low levels in the absence of added template DNA.
16S rDNA sequences closely related to the genera Duganella
(formerly Zoogloea), Acinetobacter,
Stenotrophomonas, Escherichia,
Leptothrix, and Herbaspirillum were identified
in contaminant libraries and in clone libraries from diverse, generally low-biomass habitats. The rRNA sequences detected possibly are common
contaminants in reagents used to prepare genomic DNA. Consequently, their detection in processed environmental samples may not reflect environmentally relevant organisms.
Knowledge of microbial diversity has
increased dramatically in recent years, in part as a result of
sequencing of rRNA genes from DNA obtained directly from uncultured
microbiota, often by use of PCR and rRNA-specific primers (2,
21). This approach has been applied to assess the microbial
diversity in a variety of environments, for instance, arctic tundra
(34), marine deep subsurfaces (27),
Yellowstone hot springs (14), peat bogs (26), and
human infections (9, 12, 17). Although the approach has
produced a diverse collection of sequences and expanded our view of
microbial diversity, analysis of microbial 16S ribosomal DNA (rDNA)
sequences has limitations in relating specific rDNA sequences to
organisms in the environment under study and is fraught with potential
artifacts.
One potential artifact in the application of PCR to community analysis
is the possible introduction of contaminating rDNA during experimental
procedures, particularly in steps preceding PCR. In the course of
compiling environmental 16S rDNA sequences, we have noted some highly
similar (>99%) sequences that are obtained from many physically and
chemically distinct environments. The organisms represented by these
sequences may indeed be prevalent in such diverse environments.
However, the difficulty in preparing genomic DNA absolutely free from
contaminating DNA, coupled with the exquisite sensitivity of PCR to
amplify trace target DNA, make contamination a serious issue,
particularly with low-biomass samples (16, 18, 28, 29). We
report here a survey of 16S rDNA sequences that were obtained from
negative extraction controls, that is, DNA extraction and purification
performed without added sample, and the correspondence of these
sequences to some recovered from diverse environmental settings.
We surveyed the 16S rDNA sequences from 96 clones derived from a PCR
product resulting from a control extraction that did not contain an
environmental sample. Less-extensive analyses have been conducted with
independently processed negative controls. The extraction was carried
out in the same manner as with authentic samples containing genomic
DNA, by using lysozyme, proteinase K, sodium dodecyl sulfate, bead
beating, and phenol treatment as described elsewhere (4).
Details were as follows: buffer A consisted of 200 mM Tris HCl (pH
8.0), 200 mM NaCl, and 20 mM EDTA, bead beating (0.5 g of acid-washed
beads) was carried out for 2 min at low speed and 0.5 min at high
speed, and nucleic acids were precipitated from 300 mM NaCl and 3 volumes of 100% ethanol. All solutions were prepared with autoclaved,
filtered (0.2-µm-pore-size filter, Sterile Acrodisc; Gelman Sciences)
ddH2O prior to use. Although some small bacteria
potentially could pass through the 0.2-µm filter pores, a negative
control in the absence of any template, that is, without the negative
extraction control material, resulted in no PCR product after 40 cycles. All DNA extraction procedures and manipulations were performed
in a laminar flow hood to minimize aerial contamination. The sample was
dissolved in 200 µl of water, and 100-µl PCRs were carried out with
1 µl of template (40 cycles of touchdown PCR, consisting of 20 cycles of 1 min at 94°C, 40 s starting at 67°C and decreasing by
1°C/cycle, and 1 min at 72°C, and 20 cycles of 1 min at 94°C, 1 min at 50°C, and 1.5 min plus 1 s/cycle at 72°C). Five units of
Ampli Taq Gold (Perkin-Elmer) was added per 100 µl of
reaction mixture. Bacterium-specific primers were used for the
amplification (27F, AGAGTTTGATCCTGGCTCAG, and 805R,
GACTACCAGGGTATCTAATCC). These primers match most sequences in the domain Bacteria in the primer target region. Three
100-µl reaction products were precipitated with ethanol, and the
entire sample was resolved by agarose gel electrophoresis. Even with these precautions, rDNA-sized PCR products were obtained after extended
rounds of thermal cycling. The rDNA-sized PCR products were eluted from
the gel and cloned, and 96 clones were analyzed by restriction fragment
length polymorphisms (RFLP) by using the enzymes MspI and
HinP1I as detailed by Hugenholtz et al.
(14). Twenty different RFLP types were identified and
sequenced. The 16S rDNA sequences (460 to 780 nucleotides [nt]) were
compared to known sequences by using the gapped BLAST search algorithm (1, 5) and were aligned to close relatives by using the GDE
alignment editor (19). 16S rDNA sequences were placed into a
phylogenetic tree containing more than 7,000 bacterial rDNA sequences
by using the ARB software package (30).
Analysis of clones from the negative extraction control revealed a
diverse collection of contaminant sequences. We have seen similar
sequences in other analyses of contaminant rDNAs. 16S rDNA
sequences essentially identical to the negative-control sequences also
have been encountered by a number of laboratories in clone libraries
from a broad diversity of environments, as summarized in Table
1. Additional sequences from the
negative control, not reported in environmental analyses, are related
to the rDNAs of the following organisms: Micrococcus luteus
(98% identity to MT2), Pseudomonas aeruginosa (99%
identity to MT5), an Afipia sp. (97% identity to MT8),
Variovorax paradoxus (97% identity to MT11), Gemella
haemolysans (100% identity to MT1), Shigella boydii
(99% identity to MT19), and Phyllobacterium myrsinacearum
(99% identity to MT17). A few sequences were <95% identical to
those of known organisms. A compilation of sequences obtained
from negative-control libraries is available from our web site at
http://crab2.berkeley.edu/pacelab/177.htm. This site will be updated as
additional sequences are determined from negative-control libraries.
Submissions are welcomed.
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Specific Ribosomal DNA Sequences from Diverse Environmental
Settings Correlate with Experimental Contaminants

![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References
TABLE 1.
Distribution of contaminant clones with representatives
from environmental studies
Several contaminant clones and numerous environmental clones from
diverse environments are closely related to rDNAs of the genus
Duganella (formerly Zoogloea). Such organisms
(
-proteobacteria) commonly contaminate water sources and are
routinely isolated from wastewater environments (13) and
drinking-water biofilms (15). Their occurrence in materials
used for laboratory experiments is, therefore, not surprising. Figure
1 shows the relationships of some of the
contaminant sequences and environmental groups of sequences to those of
Duganella zoogloeoides and Herbaspirillum seropedicae. The Duganella relatedness group, seen as
two clades with ca. 98.5% identity in rRNA sequences, consists mostly
of environmental rDNA sequences, all nearly identical, from various published studies (6, 8, 9, 20, 22-24, 27, 34). In addition
to the Duganella cluster of sequences, a number of other
prevalent contaminant sequences, listed in Table 1, correspond closely
to sequences reported from diverse environments. Leptothrix spp., for instance, like Duganella spp., are found in slowly
flowing fresh water and in polluted water and activated sludge. It is remarkable that essentially identical rRNA sequences are obtained from
such different environments as deep subsurface groundwaters, a marine
sediment, a Yellowstone hot spring, a guinea pig lung, and a
dentoalveolar abscess (pus around the teeth). All of the extractions of
environmental samples that resulted in clones equivalent to the
contaminant rDNAs are likely to have contained only very low levels of
biomass. Extraction of DNA from low-biomass samples is particularly
sensitive to potentially contaminating DNA during processing because
the contaminating DNA is minimally diluted by sample DNA. The exact
sources of contamination were not determined; however, the
Taq polymerase and amplification buffer are not detectably contaminated, since reactions without added template or negative extraction control material did not produce amplified products. Therefore, the most likely sources of contamination are salts and
buffers, lysozyme, proteinase K, and/or the zirconia/silica beads.
|
In this study, we report that many small-subunit rRNA sequences obtained from no-sample control clone libraries are closely related to sequences recovered in other studies from diverse environmental samples. This correspondence of contaminant and environmental sequences may indicate that some of the environmental sequences are derived as experimental contaminants and have no relevance to the environmental communities. Since any source of contaminant sequences is likely to be idiosyncratic, dependent on the operator, source of reagents, water, etc., researchers examining biodiversity using environmental cloning techniques must be aware of this issue and make every effort to minimize, detect, and analyze potential contamination. Perhaps the most important message from results presented here is that definitive proof for the occurrence of an organism indicated by a cloned rRNA sequence requires explicit identification of that organism in situ. Currently, this is most readily achieved by using 16S rRNA-based fluorescence hybridization techniques (2, 7).
Nucleotide sequence accession numbers. Sequences for the following negative-control clones (with the accession numbers given in parentheses) were deposited in the GenBank database: MT3 (AF058381), MT6 (AF058382), MT9 (AF058375), MT11 (AF058383), MT14 (AF058384), MT18 (AF058385), MT22 (AF058386), CMT35P (AF061574), and CTHB-18, (AF067655). MT2, MT5, and MT8 have accession no. AF058372 to AF058374, respectively. MT12, MT17, and MT19 have accession no. AF058377 to AF058379, respectively.
| |
ACKNOWLEDGMENTS |
|---|
We thank Phil Hugenholtz for comments on the manuscript and Chris Pitulle for stimulating discussions.
This work was supported by grants from the NIH and the U.S. Department of Energy.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Departments of Plant and Microbial Biology and Molecular and Cell Biology, 111 Koshland Hall, University of California, Berkeley, CA 94720-3102. Phone: (510) 643-2571. Fax: (510) 642-4995. E-mail: nrpace{at}nature.berkeley.edu.
Present address: Australian Magnesium Corporation, Toowong,
Queensland, 4066 Australia.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Altschul, S. F.,
T. L. Madden,
A. A. Schäffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402 |
| 2. |
Amann, R. I.,
W. Ludwig, and K. H. Schleifer.
1995.
Phylogenetic identification and in situ detection of individual microbial cells without cultivation.
Microbiol. Rev.
59:143-169 |
| 3. | Bahr, M., J. E. Hobbie, and M. L. Sogin. 1996. Bacterial diversity in an arctic lake: a freshwater SAR11 cluster. Aquat. Microb. Ecol. 11:271-277. |
| 4. |
Barns, S. M.,
C. F. Delwiche,
J. D. Palmer, and N. R. Pace.
1996.
Perspectives on archaeal diversity, thermophily and monophyly from environmental rRNA sequences.
Proc. Natl. Acad. Sci. USA
93:9188-9193 |
| 5. |
Benson, D. A.,
M. S. Boguski,
D. J. Lipman,
J. Ostell, and B. F. F. Ouellette.
1998.
GenBank.
Nucleic Acids Res.
26:1-7 |
| 6. |
Coates, J. D.,
D. J. Ellis,
E. L. Blunt-Harris,
C. V. Gaw,
E. E. Roden, and D. R. Lovley.
1998.
Recovery of humic-reducing bacteria from a diversity of environments.
Appl. Environ. Microbiol.
64:1504-1509 |
| 7. |
DeLong, E. F.,
G. S. Wickham, and N. R. Pace.
1989.
Phylogenetic stains: ribosomal RNA-based probes for the identification of single cells.
Science
243:1360-1363 |
| 8. | Dojka, M. A., P. Hugenholtz, S. K. Haack, and N. R. Pace. Microbial diversity in a hydrocarbon and chlorinated solvent-contaminated aquifer undergoing intrinsic bioremediation. Submitted for publication. |
| 9. | Dymock, D., A. J. Weightman, C. Scully, and W. G. Wade. 1996. Molecular analysis of microflora associated with dentoalveolar abscesses. J. Clin. Microbiol. 34:537-542[Abstract]. |
| 10. | Ekendahl, S., J. Arlinger, F. Ståhl, and K. Pedersen. 1994. Characterization of attached bacterial populations in deep granitic groundwater from the Stripa research mine by 16S rRNA gene sequencing and scanning electron microscopy. Microbiology 140:1575-1583[Abstract]. |
| 11. | Goebel, B. M., and N. R. Pace. 1998. Unpublished data. |
| 12. | Goldenberger, D., A. Künzli, P. Vogt, R. Zbinden, and M. Altwegg. 1997. Molecular diagnosis of bacterial endocarditis by broad-range PCR amplification and direct sequencing. J. Clin. Microbiol. 35:2733-2739[Abstract]. |
| 13. |
Hiraishi, A.,
Y. K. Shin, and J. Sugiyama.
1997.
Proposal to reclassify Zoogloea ramigera IAM 12670 (P. R. Dugan 115) as Duganella zoogloeoides gen. nov., sp. nov.
Int. J. Syst. Bacteriol.
47:1249-1252 |
| 14. |
Hugenholtz, P.,
C. Pitulle,
K. L. Hershberger, and N. R. Pace.
1998.
Novel division level bacterial diversity in a Yellowstone hot spring.
J. Bacteriol.
180:366-376 |
| 15. | Kalmbach, S., W. Manz, and U. Szewzyk. 1997. Isolation of new bacterial species from drinking water biofilms and proof of their in situ dominance with highly specific 16S rRNA probes. Appl. Environ. Microbiol. 63:4164-4170[Abstract]. |
| 16. | Kitchin, P. A., Z. Szotyori, C. Fromholc, and N. Almond. 1990. Avoidance of PCR false positives. Nature 344:201[Medline]. |
| 17. | Krieger, J. N., D. E. Riley, M. C. Roberts, and R. E. Berger. 1996. Prokaryotic DNA sequences in patients with chronic idiopathic prostatitis. J. Clin. Microbiol. 34:3120-3128[Abstract]. |
| 18. | Kwok, S., and R. Higuchi. 1989. Avoiding false positives with PCR. Nature 339:237-238[Medline]. |
| 19. |
Maidak, B. L.,
G. J. Olsen,
N. Larsen,
R. Overbeek,
M. J. McCaughey, and C. R. Woese.
1997.
The RDP (Ribosomal Database Project).
Nucleic Acids Res.
25:109-110 |
| 20. |
Nüsslein, K., and J. M. Tiedje.
1998.
Characterization of the dominant and rare members of a young Hawaiian soil bacterial community with small-subunit ribosomal DNA amplified from DNA fractionated on the basis of guanine and cytosine composition.
Appl. Environ. Microbiol.
64:1283-1289 |
| 21. |
Pace, N. R.
1997.
A molecular view of microbial diversity and the biosphere.
Science
276:734-740 |
| 22. | Pedersen, K. 1996. Investigations of subterranean bacteria in deep crystalline bedrock and their importance for the disposal of nuclear waste. Can. J. Microbiol. 42:382-391. |
| 23. | Pedersen, K., J. Arlinger, S. Ekendahl, and L. Hallbeck. 1996. 16S rRNA gene diversity of attached and unattached bacteria in boreholes along the access tunnel to the Äspö hard rock laboratory, Sweden. FEMS Microbiol. Ecol. 19:249-262. |
| 24. | Pedersen, K., J. Arlinger, L. Hallbeck, and C. Pettersson. 1996. Diversity and distribution of subterranean bacteria in groundwater at Oklo in Gabon, Africa, as determined by 16S rRNA gene sequencing. Mol. Ecol. 5:427-436[Medline]. |
| 25. | Pinhassi, J., U. L. Zweifel, and Å. Hagström. 1997. Dominant marine bacterioplankton species found among colony-forming bacteria. Appl. Environ. Microbiol. 63:3359-3366[Abstract]. |
| 26. | Rheims, H., F. A. Rainey, and E. Stackebrandt. 1996. A molecular approach to search for diversity among bacteria in the environment. J. Ind. Microbiol. 17:159-169. |
| 27. | Rochelle, P. A., B. A. Cragg, J. C. Fry, R. J. Parkes, and A. J. Weightman. 1994. Effect of sample handling on estimation of bacterial diversity in marine sediments by 16S rRNA gene sequence analysis. FEMS Microbiol. Ecol. 15:215-226. |
| 28. | Sarkar, G., and S. S. Sommer. 1990. Shedding light on PCR contamination. Nature 343:27[Medline]. |
| 29. | Schmidt, T. M., B. Pace, and N. R. Pace. 1991. Detection of DNA contamination in Taq polymerase. BioTechniques 11:176-177[Medline]. |
| 30. | Strunk, O., O. Gross, B. Reichel, M. May, S. Hermann, N. Struckmann, B. Nonhoff, M. Lenke, A. Vilbig, T. Ludwig, A. Bode, K. H. Schleifer, and W. Ludwig. ARB: a software environment for sequence data. Submitted for publication. |
| 31. | Tanner, M. A., and N. R. Pace. 1998. Unpublished data. |
| 32. | Tinschert, A., A. Kiener, K. Heinzmann, and A. Tschech. 1997. Isolation of new 6-methylnicotinic-acid-degrading bacteria, one of which catalyses the regioselective hydroxylation of nicotinic acid at position C2. Arch. Microbiol. 168:355-361[Medline]. |
| 33. | Wise, M. G., J. V. McArthur, and L. J. Shimkets. 1997. Bacterial diversity of a Carolina bay as determined by 16S rRNA gene analysis: confirmation of novel taxa. Appl. Environ. Microbiol. 63:1505-1514[Abstract]. |
| 34. | Zhou, J., M. E. Davey, J. B. Figueras, E. Rivkina, D. Gilichinsky, and J. M. Tiedje. 1997. Phylogenetic diversity of a bacterial community determined from Siberian tundra soil DNA. Microbiology 143:3913-3919[Abstract]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | Microbiol. Mol. Biol. Rev. | Eukaryot. Cell | All ASM Journals |
|---|