Previous Article | Next Article 
Applied and Environmental Microbiology, August 1998, p. 3118-3122, Vol. 64, No. 8
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Reverse Transcriptase PCR Detection of Astrovirus, Hepatitis A
Virus, and Poliovirus in Experimentally Contaminated Mussels:
Comparison of Several Extraction and Concentration
Methods
Ousmane
Traore,1,*
Charlotte
Arnal,2
Berengere
Mignotte,3
Armand
Maul,4
Henri
Laveran,1
Sylviane
Billaudel,2 and
Louis
Schwartzbrod3
Service d'Hygiène, Faculté de
Médecine, 63000 Clermont Fd Cedex,1
Laboratoire de Virologie, Institut de Biologie, Centre
Hospitalier Universitaire, 44035 Nantes Cedex
01,2
Laboratoire de Virologie, UMR
7564 CNRS, Faculté de Pharmacie, Université Henri
Poincaré Nancy, 54001 Nancy Cedex,3
and
Département Statistique et Traitement des
Données, Université de Metz, 57045 Metz
Cedex,4 France
Received 26 February 1998/Accepted 20 May 1998
 |
ABSTRACT |
Four methods of extraction and three methods of concentration of
three enteric viruses from mussels were comparatively evaluated by
reverse transcriptase PCR (RT-PCR). Shellfish were experimentally contaminated by immersion in seawater seeded with astrovirus, hepatitis
A virus, or poliovirus. Sixty-gram samples of mussel tissues were
processed by using borate buffer, glycine solution, saline beef, and
saline beef-Freon extraction methods. The viruses were concentrated by
precipitation with polyethylene glycol 6000 (PEG 6000) or PEG 8000 or
by organic flocculation. RT-PCR was performed with RNA extracts from
crude shellfish extracts and concentrates with and without Sephadex
LH20 filtration. The glycine solution and borate buffer extraction
methods resulted in significantly more RT-PCR-positive samples than the
saline beef extraction method. We assessed the efficiency of 20 combinations of extraction and concentration methods. The borate
buffer-organic flocculation, borate buffer-PEG 6000, and glycine
solution-PEG 6000 combinations gave RT-PCR-positive results for all 27 samples analyzed for the three viruses. Detoxification of the samples
by Sephadex LH20 filtration significantly decreased the efficiency of
RT-PCR virus detection.
 |
TEXT |
Enteric virus contamination of
shellfish harvested for human consumption is a public health concern.
Outbreaks of gastroenteritis have occurred among consumers of raw or
undercooked shellfish harvested from fecally polluted waters (9,
10, 13, 18, 21-23). Detection of enteric viruses in shellfish
involves viral extraction from the shellfish tissues and viral
concentration. Detection by cell culturing is slow and expensive, and
most of the epidemiologically important enteric viruses are either
difficult to cultivate or noncultivatable. PCR offers the best
alternative for developing sensitive and specific tests for detection
of enteric viruses in shellfish (3, 7, 9, 12, 17), but in
environmental samples interference by PCR inhibitors may occur
(3). Concentration and purification of virions from
shellfish rely on physicochemical procedures (1, 6, 15, 17, 20,
26). Some methods have been tested to evaluate their efficiency
for removing amplification-inhibiting agents from shellfish (3, 7,
14, 17). However, a single, simple method that is efficient for
multiple viruses is still needed. The aim of this study was to compare
four viral extraction methods, the borate buffer (6),
glycine solution (20, 26), saline beef (1), and
saline beef-Freon (1) extraction methods, and three virus
concentration methods, the polyethylene glycol 6000 (PEG 6000)
(20) and PEG 8000 (1) precipitation and organic flocculation (OF) (15) methods. In addition to
astrovirus and hepatitis A virus (HAV), two clinically important
enteropathogens, we studied poliovirus because it has been used
to evaluate most of the methods included in this study. The viruses
were detected by reverse transcriptase PCR (RT-PCR) in mussels
contaminated under simulated natural conditions. A method for
detoxification of mussel extracts (Sephadex LH20 gel filtration) was
also tested to determine its ability to remove PCR inhibitors.
Astrovirus reference strain HAstV1 was kindly provided by Stephan
Monroe, Centers for Disease Control and Prevention (Atlanta, Ga.). HAV
strain CF 53 was supplied by J. M. Crance (Centre de Recherche du
Service de Santé des Armées, La Tronche, France). Poliovirus type 1 strain LSc 2 ab was propagated in Buffalo green monkey kidney cells. The mussels (Mytilus edulis) used in
the experiments came from a sea farm on the French Atlantic coast. Before use, they were stored in a 280-liter seawater basin at 16°C
for at least 4 days. They were contaminated by immersion in seawater
(Reef Crystal; Aquarium System, Sarrebourg, France) for 1 h in
10-liter tanks experimentally seeded with astrovirus (final
concentration, 3 × 104 PFU/ml), HAV (final
concentration, 9 × 103 50% tissue culture
infective doses/ml), or poliovirus (final concentration, 3.2 × 103 most probable number of cytopathogenic units
[MPNCU]/ml). The mussels were then rinsed in
deionized water, shucked, and drained of excess fluid, and their
tissues were stored in 60-g aliquots at
20°C before further
processing (11).
Four extraction methods (the borate buffer, glycine solution, saline
beef, and saline beef-Freon extraction methods) were performed as a
first step. Each mussel extract was then processed with two or three
concentration methods (the OF, PEG 6000, and PEG 8000 methods)
depending on the extraction method. One-half of each final concentrate
was directly analyzed by RT-PCR, and the other half was detoxified by
Sephadex LH20 gel filtration before RT-PCR analysis. This protocol is
outlined in Fig. 1.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 1.
Procedures used for extraction and concentration of
viruses from mussel samples. Detoxified samples were filtered through a
Sephadex LH20 gel.
|
|
Virus extraction.
The borate extraction method was performed
as described by Boher and Schwartzbrod (6). Briefly, the
mussel tissues were ground in a Waring blender at 10,000 rpm for 3 min
and mixed with 100 ml of 1 M borate-3% beef extract buffer (pH 9).
The suspension was homogenized with an Ultraturrax homogenizer at 9,500 rpm for 1 min and stirred magnetically for 15 min. The suspension was then sonicated for 1 min at 100 W and finally was clarified by centrifugation at 10,000 × g for 90 min at 4°C.
For glycine extraction (20, 26), mussel tissues were
homogenized with an Ultraturrax homogenizer at 9,500 rpm for 3 min in
50 ml of 0.05 M glycine-0.15 M NaCl buffer (pH 9). The suspension was
stirred magnetically for 15 min and then centrifuged at 5,000 × g at 4°C for 10 min. The saline beef extraction method was
performed by using a described previously procedure (1). The
mussels were crushed in 50 ml of a 0.3 M NaCl solution with an
Ultraturrax homogenizer at 9,500 rpm for 1 min. Then 350 ml of an
eluting solution containing 0.3 M NaCl and 7% beef extract (pH 7.5)
was added. The mixture was homogenized again with the Ultraturrax homogenizer at 9,500 rpm for 1 min and centrifuged at 5,000 × g for 20 min at 4°C.
For saline beef-Freon extraction, mussels were processed as described
above for the other extraction methods, and then 100
ml was
reextracted by mixing it with an Ultraturrax homogenizer
at 9,500 rpm for 1 min with an equal volume of Freon
(1,1,2-trichlorotrifluorethane;
Sigma Chemical Co., St. Louis, Mo.) and
centrifuging it at 5,000
×
g for 20 min at 4°C. The
pH of the supernatant was adjusted
to 7.2. In all four extraction
procedures the supernatants were
the viral extracts.
Virus concentration from mussel extracts.
Viral concentration
by OF of the mussel extract was accomplished by lowering the pH to 3.5 with stirring for 30 min. The pellet obtained after centrifugation at
3,000 × g for 10 min was resuspended in 12 ml of 0.15 M Na2HPO4 (pH 9). The suspension was clarified by centrifugation at 1,500 × g for 20 min at 4°C,
and the pH was adjusted to 7.2 (15).
For PEG 6000 precipitation, we used a simplified version of a
previously described method (
20). The pH of the extract was
adjusted to 7.3, and the extract was supplemented with 10% (final
concentration) PEG 6000 and incubated overnight at 4°C. The
precipitated
viruses were recovered by centrifugation at 10,000 ×
g for 90
min at 4°C. The pellet was resuspended in 12 ml
of Na
2HPO
4 (pH
9) with vigorous magnetic
stirring. The suspension was clarified
by centrifugation at 1,500 ×
g for 20 min at 4°C, and the pH was
adjusted to 7.2. For PEG 8000 precipitation, the mussel extract
was supplemented with
12% (final concentration) PEG 8000 and incubated
overnight at 4°C.
The precipitated viruses were recovered by centrifugation
at 6,200 ×
g for 20 min at 4°C and were resuspended in 12 ml of
Na
2HPO
4 (pH 9). The suspension was clarified by
centrifugation
at 1,500 ×
g for 20 min at 4°C, and
the pH was adjusted to 7.2
(
1). One-half of each concentrate
(6 ml) was detoxified by
a previously described method based on
filtration through a Sephadex
LH20 gel (Pharmacia Biotech)
(
5).
PCR procedures.
Total RNA extraction was performed by
using 200-µl portions of mussel concentrates or extracts and
an RNA-PLUS purification kit (Bioprobe Systems, Montreuil,
France) according to the manufacturer's instructions. The RNA
pellet was resuspended in 25 µl of diethyl pyrocarbonate-treated water for astrovirus and in 150 µl of
diethyl pyrocarbonate-treated water for HAV and poliovirus. Total RNA extraction was performed by using undiluted samples and samples diluted
10-fold with sterile water.
PCR primers.
Primers MON 340 (5' CGTCATTATTTGTTGTCATACT
3') and MON 348 (5' ACATGTGCTGCTGTTACTATG 3'), which
were used for the astrovirus RT-PCR, are located in open reading frame
1A and yield a 289-bp amplicon (4). The following
primers used for the poliovirus RT seminested PCR were from the 5'
noncoding region: primer 2 (5' CAAGCACTTCTGTTTCCCCGG 3'),
primer 3 (5' ATTGTCACCATAAGCCA 3'), and primer F2
(5' CTTGCGCGTTACGAC 3') (19). The resulting fragment was 366 bp long. The HAV RT-PCR primers were derived from an
HAV conserved DNA sequence coding for capsid proteins VP1 and
VP3. The 39-nucleotide primers, primer D
(5' GTTTTGCTCCTCTTTATCATGCTATGGATGTTACTACAC 3') and primer E (5' GGAAATGTCTCAGGTACTTTCTTTGCTAAAACTGGATCC 3'),
yield a 248-bp amplicon (2).
RT-PCR analysis of viral RNA in mussel extracts and
concentrates.
For astrovirus, 5 µl of RNA solution was added to
20 µl of an RT mixture containing 10 U of avian myeloblastosis virus
RT (Promega, Madison, Wis.), 5 µl of 5× enzyme buffer (Promega), 2 µl (each) of four 10 mM deoxynucleoside triphosphate stock
solutions (Boehringer Mannheim, Indianapolis, Ind.), and 25 pmol of RT
primer MON 348, and the mixture was incubated for 1 h at 42°C.
The PCR was performed by using 5 µl of cDNA along with 0.5 U of
Taq DNA polymerase (Appligene, Illkirch, France) and 25 pmol
of each primer in a final volume of 50 µl. Denaturation was performed
for 3 min at 94°C, and this was followed by 30 cycles of
amplification consisting of denaturation for 30 s at 94°C,
annealing for 20 s at 50°C, and extension for 30 s at
72°C. A final extension step was performed for 5 min at 72°C.
The poliovirus RT reaction was performed with oligo(dT)
15
(Promega) in a 20-µl reaction mixture containing 10 U of avian
myeloblastosis
virus RT (Promega). The PCR was carried out with 2.5 U
of
Taq polymerase (Perkin-Elmer) and primers 2 and 3 (each
at a concentration
of 0.1 µM) in a 100-µl reaction mixture. The
seminested PCR was
performed with 2.5 U of
Taq polymerase
(Perkin-Elmer) and primers
2 and F2 (each at a concentration of 0.1 µM) in a 100-µl reaction
mixture. Amplifications (PCR and
seminested PCR) were performed
for 30 cycles consisting of denaturation
for 30 s at 94°C, primer
annealing for 45 s at 50°C, and
elongation for 1 min at 72°C.
For HAV, 2-µl RNA extracts were reverse transcribed for 1 h at
37°C by using 100 U of Moloney murine leukemia virus RT (Gibco
BRL)
and 1 µM primer E. The PCR was then carried out in a 25-µl
mixture
containing 2.5 µl of cDNA, 0.5 µM primer D, 0.5 µM primer
E, each
deoxynucleoside triphosphate at a concentration of 200
µM, and 0.625 U of
Taq DNA polymerase (Gibco BRL). Denaturation
was
performed for 7 min at 94°C, and this was followed by 35 cycles
of
amplification consisting of denaturation for 30 s at 94°C,
annealing for 90 s at 62°C, and extension for 90 s at
62°C. A
final extension step was performed for 5 min at 72°C.
Poliovirus and astrovirus amplified products were analyzed by
electrophoresis on 2% agarose gels, and HAV amplified products
were
analyzed by electrophoresis on a 9% polyacrylamide gel. Amplified
products were visualized by UV illumination after the gels were
stained
with ethidium bromide. Differences in percentages of positive
results
were analyzed by the chi-square or Fisher's exact test.
Three distinct mussel contamination experiments were performed with the
same viral suspensions for each virus. The shellfish
were contaminated
by natural means (uptake from water) because
direct injection of virus
into shellfish homogenates has little
resemblance to natural
conditions, under which virus extraction
is probably more difficult.
A total of 214 samples were analyzed; the samples included 71 samples
analyzed for astrovirus RNA (11 extraction experiments
and 60 extraction-concentration experiments), 72 samples analyzed
for HAV RNA
(12 extraction experiments and 60 extraction-concentration
experiments), and 71 samples analyzed for poliovirus RNA (12 extraction
experiments and 59 extraction-concentration experiments). Each
RT-PCR
experiment was performed more than once. When only extracts
were
compared (Table
1), no significant
differences were observed
among the four extraction methods either with
undiluted samples
(
P = 0.3) or with 10-fold-diluted
samples (
P = 0.61). Table
2 shows the results of the extraction
experiments as evaluated by
RT-PCR detection of enteric viruses
in mussel concentrates. Table
3 combines
the data in Tables
1 and
2 and compares the efficiencies
of the
four extraction methods. The extraction methods could be
arranged in
the following decreasing order of efficiency: borate
buffer, glycine
solution, saline beef-Freon, and saline beef.
A comparison by the
chi-square test of the overall results in
Table
3 showed that both the
borate buffer and glycine solution
extraction methods were
significantly more effective than the
other two methods since glycine
was significantly more effective
than saline beef (
P < 0.0001) and saline beef-Freon (
P = 0.01).
In a previous
study, in which a cell culture was used to detect
viruses, extraction
was more efficient with beef extract than
with 0.05 M glycine
(
8). In our study, the saline beef extraction
method
resulted in detection of only 14% (3 of 21) of the astrovirus
RNA-positive samples and 19% (4 of 21) of the HAV RNA-positive
samples, which highlights the fact that beef extract interferes
with
molecular detection methods (
25).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Efficiency of extraction methods as evaluated by
RT-PCR detection of enteric viruses in concentrates prepared from
mussel extracts
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Efficiency of extraction methods as evaluated by
RT-PCR detection of enteric viruses in mussel extracts and in
concentrates prepared from mussel extracts
|
|
A comparison of the concentration results, including the
results obtained for all crude and detoxified undiluted concentrates,
showed that astrovirus, HAV, and poliovirus RNAs were detected
in 9 of
24 (37.5%), 15 of 24 (62.5%), and 17 of 23 (74%), respectively,
OF
concentrates, in 12 of 24 (50%), 16 of 24 (67%), and 19 of
24 (79%),
respectively, PEG 6000 concentrates, and in 6 of 12
(50%), 4 of 12 (33%), and 11 of 12 (92%), respectively, PEG 8000
concentrates. For
the three viruses, the percentages of positive
samples were not
significantly different when PEG 6000 and OF
undiluted concentrates
were compared (for astrovirus,
P = 0.38;
for HAV,
P = 0.76; for poliovirus,
P = 0.67) or
when PEG 6000
and OF 10-fold-diluted concentrates were compared (for
astrovirus,
P = 0.56; for HAV,
P = 0.77; for poliovirus,
P = 0.16). PEG 8000
concentrate results were not included in this comparison because
PEG
8000 concentration was not performed after borate buffer and
glycine
solution extractions, which were the most efficient extraction
methods.
The efficiencies of the 20 combinations of extraction and
concentration methods used for astrovirus, HAV, and
poliovirus RT-PCR
detection are shown in Table
4. All of the concentrates obtained
with the borate buffer-OF, borate buffer-PEG 6000, glycine
solution-PEG
6000, and saline beef-Freon-PEG 8000 combinations
gave positive
RT-PCR results consistently for the three viruses when
undiluted
preparations were analyzed. When 10-fold-diluted concentrates
were analyzed, the borate buffer-OF method gave the highest detection
rate. The saline beef extraction method yielded very low RT-PCR
detection rates whatever concentration procedure was used. For
the
latter method, a further purifying step in which Freon was
used to
remove inhibitors improved PCR detection of both astrovirus
(
P = 0.0009) and HAV (
P = 0.01).
View this table:
[in this window]
[in a new window]
|
TABLE 4.
Efficiency of viral extraction-concentration combinations
as evaluated by RT-PCR detection of astrovirus, HAV, and poliovirus
in mussel samples
|
|
PEG 6000 precipitation and OF are the methods used most widely to
concentrate enteric viruses from shellfish (
20). Lees
et al.
reported good poliovirus recovery and substantial reductions
in RT-PCR
inhibitors when PEG 6000 was used (
16). In our study,
addition of a concentration step following viral extraction
further
improved, albeit not significantly, the viral RNA
detection rates
for the borate buffer and glycine solution
extraction methods
but not for the saline beef and saline beef-Freon
extraction methods.
No significant difference in viral RNA detection
was observed
when the PEG 6000 precipitation and OF concentration
methods were
compared. Recently, Jaykus et al. proposed a method
based on double
precipitation with PEG and Pro-cipitate that results in
small-volume
concentrates suitable for sensitive detection by viral
infectivity
and RT-PCR amplification methods (
14). However,
this technique
is time-consuming, and our goal was to compare
techniques used
for RT-PCR detection only.
Shellfish virological analysis is often hampered by the toxicity of
shellfish concentrates for cell cultures. It has been
proposed that a
detoxification technique based on Sephadex LH20
gel filtration
can reduce this cytotoxicity (
5). Our results
showed
that this procedure is not suitable before RT-PCR detection
of
the three viruses used in this study. Other procedures, such
as
processing hepatopancreatic tissue rather than whole shellfish
tissue,
may overcome the inhibitory effects on RT-PCR (
24).
Using
RT-PCR, we detected astrovirus, HAV, and poliovirus RNAs
in 18 of 30 (60%), 20 of 30 (67%), and 26 of 30 (87%), respectively,
undiluted
crude concentrates, compared with 9 of 30 (30%), 15
of 30 (50%), and
21 of 29 (72%), respectively, undiluted Sephadex
LH20-detoxified
concentrates. The percentage of positive samples
was significantly
higher for crude concentrates than for detoxified
concentrates
(
P = 0.004), probably because of viral losses
subsequent
to viral adsorption onto the Sephadex gel during the
detoxification
step.
In conclusion, the borate buffer-PEG 6000, borate buffer-OF, and
glycine solution-PEG 6000 precipitation combinations were
the most
efficient combinations for detecting astrovirus, HAV,
and poliovirus in
both undiluted samples and 10-fold-diluted samples.
Conversely, most of
the combinations that included saline beef
extraction were unable
to detect any HAV or astrovirus RNA-positive
samples. The three
efficient procedures described here will soon
be evaluated in our
laboratories for detection of astrovirus,
HAV, poliovirus, and other
important enteric viruses, such as
small round structured viruses, in
naturally polluted shellfish,
which may have high inhibitory potential
and low levels of viral
contamination.
 |
ACKNOWLEDGMENTS |
This work was supported by contract R96/08 TB 2/06 from the
Ministère de l'Agriculture, de la Pêche et de
l'Alimentation.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Service
d'Hygiène, Faculté de Médecine, 28 place Henri
Dunant, 63000 Clermont Fd Cedex, France. Phone: (33)4 73 60 80 07. Fax:
(33) 4 73 26 54 32. E-mail:
Ousmane.Traore{at}u-clermont1.fr.
 |
REFERENCES |
| 1.
|
Alouini, S., and M. D. Sobsey.
1995.
Evaluation of an extraction-precipitation method for recovering hepatitis A virus and poliovirus from hardshell clams (Mercenaria mercenaria).
Water Sci. Technol.
5:465-469.
|
| 2.
|
Arnal, C.,
V. Ferré-Aubineau,
B. Besse, and S. Billaudel.
1998.
Simplified RT-PCR procedure with detection by microplate hybridization for routine screening of hepatitis A virus.
Can. J. Microbiol.
44:298-302[Medline].
|
| 3.
|
Atmar, R. L.,
T. G. Metcalf,
F. H. Neill, and M. K. Estes.
1993.
Detection of enteric viruses in oysters by using the polymerase chain reaction.
Appl. Environ. Microbiol.
59:631-635[Abstract/Free Full Text].
|
| 4.
|
Belliot, G.,
H. Laveran, and S. S. Monroe.
1997.
Detection and genetic differentiation of human astroviruses: phylogenetic grouping varies by coding region.
Arch. Virol.
142:1323-1334[Medline].
|
| 5.
|
Beril, C.,
S. Boher, and L. Schwartzbrod.
1991.
Detoxification by Sephadex LH20 of seafood concentrates for rotavirus assay.
Water Sci. Technol.
24:417-421.
|
| 6.
|
Boher, S., and L. Schwartzbrod.
1993.
Study of viral purification of oysters.
Water Sci. Technol.
27:55-60.
|
| 7.
|
Chung, H.,
L. A. Jaykus, and M. D. Sobsey.
1996.
Detection of human enteric viruses in oysters by in vivo and in vitro amplification of nucleic acids.
Appl. Environ. Microbiol.
62:3772-3778[Abstract].
|
| 8.
|
Croci, L.,
D. De Medici,
M. Divizia,
R. Gabrieli,
L. Toti, and A. Pana.
1993.
Recovery of poliovirus type 1 from experimentally contaminated shellfish: evaluation of different methods.
Water Sci. Technol.
27:45-48.
|
| 9.
|
Desenclos, J. C.,
K. C. Klontz,
M. H. Wilder,
O. V. Nainan,
H. S. Margolis, and R. A. Gunn.
1991.
A multistate outbreak of hepatitis A caused by the consumption of raw oysters.
Am. J. Public Health
81:1268-1272[Abstract/Free Full Text].
|
| 10.
|
Dowell, S. F.,
C. Groves,
K. B. Kirkland,
H. G. Circirello,
T. Ando,
Q. Jin,
J. R. Gentsch,
S. S. Monroe,
C. D. Humphrey,
C. Slemp,
D. M. Dwyer,
R. A. Meriwether, and R. I. Glass.
1995.
A multistate outbreak of oyster-associated gastroenteritis: implications for interstate tracing of contaminated shellfish.
J. Infect. Dis.
171:1497-1503[Medline].
|
| 11.
|
Gaillot, D.,
D. Terver,
C. Finance, and L. Schwartzbrod.
1988.
Improved method for contamination of mussels by poliovirus.
Int. J. Food Microbiol.
6:333-339[Medline].
|
| 12.
|
Häfliger, D.,
M. Gilgen,
J. Lüthy, and P. Hübner.
1997.
Seminested RT-PCR systems for small round structured viruses and detection of enteric viruses in seafood.
Int. J. Food Microbiol.
37:27-36[Medline].
|
| 13.
|
Halliday, M. L.,
L. Y. Kang,
T. K. Zhou,
M. D. Hu,
Q. C. Pan,
T. Y. Fu,
Y. S. Huang, and S. L. Hu.
1991.
An epidemic of hepatitis A virus attributable to the ingestion of raw clams in Shangai, China.
J. Infect. Dis.
164:852-859[Medline].
|
| 14.
|
Jaykus, L. A.,
R. De Leon, and M. D. Sobsey.
1996.
A virion concentration method for detection of human enteric viruses in oysters by PCR and oligoprobe hybridization.
Appl. Environ. Microbiol.
62:2074-2080[Abstract].
|
| 15.
|
Katzenelson, E.,
B. Fattal, and T. Hostovesky.
1976.
Organic flocculation: an efficient second step concentration method for the detection of virus from water.
Appl. Environ. Microbiol.
32:638-639[Abstract/Free Full Text].
|
| 16.
|
Lees, D. N.,
K. Henshilwood, and S. Butcher.
1995.
Development of a PCR based method for the detection of enteroviruses and hepatitis A virus in molluscan shellfish and its application to polluted field samples.
Water Sci. Technol.
31:457-464.
|
| 17.
|
Lees, D. N.,
K. Henshilwood, and W. J. Doré.
1994.
Development of a method for detection of enteroviruses in shellfish by PCR with poliovirus as a model.
Appl. Environ. Microbiol.
60:2999-3005[Abstract/Free Full Text].
|
| 18.
|
Le Guyader, F.,
F. H. Neill,
M. K. Estes,
S. S. Monroe,
T. Ando, and R. L. Atmar.
1996.
Detection and analysis of a small round-structured virus strain in oysters implicated in an outbreak of acute gastroenteritis.
Appl. Environ. Microbiol.
62:4268-4272[Abstract].
|
| 19.
|
Leparc, I.,
F. Fuchs,
H. Kopecka, and M. Aymard.
1993.
Use of the polymerase chain reaction with a murine model of picornavirus-induced myocarditis.
J. Clin. Microbiol.
31:2890-2894[Abstract/Free Full Text].
|
| 20.
|
Lewis, G. D., and T. G. Metcalf.
1988.
Polyethylene glycol precipitation for recovery of pathogenic viruses, including hepatitis A virus and human rotavirus, from oysters, water, and sediment samples.
Appl. Environ. Microbiol.
54:1983-1988[Abstract/Free Full Text].
|
| 21.
|
McDonnell, S.,
K. B. Kirkland,
W. G. Hlady,
C. Aristeguieta,
R. S. Hopkins,
S. S. Monroe, and R. I. Glass.
1997.
Failure of cooking to prevent shellfish-associated viral gastroenteritis.
Arch. Intern. Med.
157:111-116[Abstract/Free Full Text].
|
| 22.
|
Pinto, R. M.,
F. X. Abad,
R. Gajardo, and A. Bosh.
1996.
Detection of infectious astroviruses in water.
Appl. Environ. Microbiol.
62:1811-1813[Abstract].
|
| 23.
|
Pontefract, R. D.,
F. R. Bishai,
J. Hockin,
G. Bergeron, and R. Parent.
1993.
Norwalk-like viruses associated with a gastroenteritis outbreak following oyster consumption.
J. Food Prot.
56:604-607.
|
| 24.
|
Romalde, J. L.,
M. K. Estes,
G. Szucs,
R. L. Altmar,
C. M. Woodley, and T. G. Metcalf.
1994.
In situ detection of hepatitis A virus in cell cultures and shellfish tissues.
Appl. Environ. Microbiol.
60:1921-1926[Abstract/Free Full Text].
|
| 25.
|
Schwab, K. J.,
R. De Leon, and M. D. Sobsey.
1995.
Concentration and purification of beef extract mock eluates from water samples for the detection of enteroviruses, hepatitis A virus, and Norwalk virus by reverse transcription PCR.
Appl. Environ. Microbiol.
61:531-537[Abstract].
|
| 26.
|
Sobsey, M. D.,
R. J. Carrick, and H. R. Jensen.
1978.
Improved methods for detecting enteric viruses in oysters.
Appl. Environ. Microbiol.
36:121-128[Abstract/Free Full Text].
|
Applied and Environmental Microbiology, August 1998, p. 3118-3122, Vol. 64, No. 8
0099-2240/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Jones, T. H., Johns, M. W.
(2009). Improved Detection of F-Specific RNA Coliphages in Fecal Material by Extraction and Polyethylene Glycol Precipitation. Appl. Environ. Microbiol.
75: 6142-6146
[Abstract]
[Full Text]
-
Myrmel, M., Berg, E. M. M., Rimstad, E., Grinde, B.
(2004). Detection of Enteric Viruses in Shellfish from the Norwegian Coast. Appl. Environ. Microbiol.
70: 2678-2684
[Abstract]
[Full Text]
-
Griffin, D. W., Donaldson, K. A., Paul, J. H., Rose, J. B.
(2003). Pathogenic Human Viruses in Coastal Waters. Clin. Microbiol. Rev.
16: 129-143
[Abstract]
[Full Text]
-
Shieh, Y.-S. C., Calci, K. R., Baric, R. S.
(1999). A Method To Detect Low Levels of Enteric Viruses in Contaminated Oysters. Appl. Environ. Microbiol.
65: 4709-4714
[Abstract]
[Full Text]
-
Arnal, C., Ferre-Aubineau, V., Mignotte, B., Imbert-Marcille, B. M., Billaudel, S.
(1999). Quantification of Hepatitis A Virus in Shellfish by Competitive Reverse Transcription-PCR with Coextraction of Standard RNA. Appl. Environ. Microbiol.
65: 322-326
[Abstract]
[Full Text]