Departamento de Genética, Facultad de
Biología, Universidad de Sevilla, E-41080 Seville, Spain
 |
INTRODUCTION |
Threonine is an essential amino acid
that is often limiting in animal feed and human food (14).
On the other hand, this amino acid is a precursor of a number of
commonly used flavoring agents (31). Threonine has been
successfully marketed as a feed additive, with a worldwide demand of
more than 10,000 tons per year. The industrial production of this amino
acid is carried out mainly by fermentation through the use of
overproducing bacterial strains, which yield up to 80 g of
threonine per liter (for a review, see reference
17).
The yeast Saccharomyces cerevisiae plays an important role
in the food industry in the production of bread, beer, and wine, etc.,
being considered a GRAS (generally recognized as safe)
microorganism. This fact together with its high nutritional
value (high protein and vitamin contents) has favored the
increasing consumption of yeasts as natural supplements or as
flavor enhancers in conventional ready-to-serve food. In this context,
the obtaining of yeast strains able to overproduce threonine might be
of great interest to the food industry, since this amino acid-enriched
biomass could be directly added to food.
Threonine-overproducing mutants of S. cerevisiae that
accumulate up to 40 times more threonine than the wild-type strain have been previously isolated (1, 5, 20, 24, 28). In all cases
studied, the overproduction is linked to a mutant HOM3
allele that causes expression of a feedback-insensitive aspartate
kinase, the key enzyme in the regulation of the threonine biosynthetic pathway (Fig. 1). Three of these alleles
have been cloned in our laboratory, and the analysis of their DNA
sequences shows that in each case a different point mutation is
responsible for the feedback-insensitive phenotype (references
1 and 21 and unpublished results). The amplification of two of these mutant alleles, namely, HOM3-R2 and HOM3-R6, resulted in a 2.5-fold
increase in threonine accumulation with respect to that of the mutant
strain (7). However, this overproduction seems to have a
deleterious effect on the growth of the strain, probably due to
interference with the general cell metabolism.
View larger version (21K):
[in this window]
[in a new window]
|
FIG. 1.
Biosynthesis of aspartate-derived amino acids and its
regulation. AK, aspartate kinase; HK, homoserine kinase; C S/TD,
catabolic serine/threonine deaminase; A TD, anabolic threonine
deaminase;  -kb, -ketobutyrate.
|
|
The aim of this work has been the construction of yeast strains able to
overproduce threonine in a controlled way so that threonine
accumulation neither impairs other physiological processes nor
interferes with the fermentative growth of the industrial strains to
which the results of this study can be applied. With that
objective, we have placed the HOM3-R2 mutant allele under the control of four distinctive regulatable yeast promoters: two inducible by nutritional factors (presence of either galactose or
serine and threonine in the medium) and two others induced by distinct
physiological conditions (high temperature or stationary phase). We
have analyzed the amino acid contents of strains bearing the different
constructs under both repression and induction conditions.
| |
MATERIALS AND METHODS |
Strains, plasmids, media, and growth conditions.
S.
cerevisiae strains and plasmids used in this work are listed in
Table 1. Escherichia coli
DH5 (10) was used as the host for plasmid maintenance and
recovery; BMH71-18 mutS (16) was used to recover
the mutant plasmids after site-directed mutagenesis.
Standard media for S. cerevisiae (YPD and SD) have been
previously described (29). When indicated, SD medium was
buffered with NaOH and succinate (pH 5.8) (23). Appropriate
supplements were added at standard concentrations (29),
except for tryptophan, which was used at a fourfold-higher
concentration when indicated. SGal medium is similar to SD but contains
2% galactose as the sole carbon source instead of glucose. Unless
otherwise indicated, yeast cells were grown at 30°C with shaking at
200 rpm. E. coli was grown in Luria-Bertani medium
(27) at 37°C. When appropriate, ampicillin (100 µg/ml)
was added.
DNA techniques.
Standard protocols (27) were used
for construction, purification, and analysis of plasmid DNA. Enzymes
were purchased from Boehringer GmbH (Mannheim, Germany) and used
according to the manufacturer's instructions. Yeast cells were
transformed after lithium acetate treatment as previously described
(9).
RNA isolation and analysis.
Yeast RNA preparation was
carried out by the hot-phenol extraction method as previously described
(15). Northern analysis was performed after size
fractionation of 10 µg of RNA and transfer onto nylon filters (Micron
Separations Inc., Westborough, Mass.) by conventional procedures
(27). A 0.95-kb StyI internal fragment of the
HOM3 gene was radiolabeled with [-32P]dCTP
by random oligonucleotide-primed synthesis (8) and used as a
probe. Radioactive signals were quantified with a betascope (Instantimager; Packard, Meriden, Conn.). Total rRNA was quantified from methylene blue-stained filters by using the program Bio Image Intelligent Quantifier and used as a loading control.
Amino acid determination.
Intracellular and extracellular
amino acids were analyzed as ortho-phthaldialdehyde
derivatives by reverse-phase high-pressure liquid chromatography as
previously described (7).
Site-directed mutagenesis.
In vitro oligonucleotide-directed
mutagenesis was carried out by using the Altered Sites system (Promega
Corporation, Falkenberg, Sweden) according to the manufacturer's
instructions. The mutagenic oligonucleotide 
HIND (5'
CCAGAAGAAGCCTCTGAATTAACA 3') was used to alter the
HindIII site present in the HOM3 open reading
frame. The HOM3 gene-bearing phagemid pYH3 was used as the
template. The system employs a phagemid vector and is based on the use
of a second mutagenic oligonucleotide (Amp Repair) which restores ampicillin resistance to the newly synthesized DNA strand during the
mutagenesis reaction. A repair-minus strain (BMH71-18 mutS) is transformed, and ampicillin resistance is selected. A second round
of transformation in DH5 ensures proper segregation of mutant and
wild-type plasmids.
| |
RESULTS |
Expression of HOM3-R2 from the GAL1
promoter.
The GAL1 gene encodes galactokinase, an
enzyme involved in galactose fermentation. The regulation of the
GAL1 promoter is well known, and its expression under
inducing conditions, i.e., the presence of galactose and absence of
glucose, is up to 1,000-fold higher than that under repressive
conditions (12). Thus, it is an efficient but
physiologically complex system that could serve to evaluate the
usefulness of other similarly controlled promoters.
Strain XMP10-7B was transformed with the episomic plasmid pEGAL-R2 and
with pEGAL-H3 as a control (Table 1). Plasmid stability in SGal- and
SD-grown cultures was 80 and 100%, respectively. The intracellular
threonine pool and the threonine excreted to the medium were monitored
in the different cultures. As expected, the HOM3-R2 allele
conferred threonine and homoserine overproduction (Table
2). In the case of the wild-type
HOM3 allele, the SD- and SGal-grown cultures accumulated
less than 35 and 85 nmol of threonine/mg (dry weight), respectively.
Consistent with previous results, the threonine-overproducing strains
reached lower final cell densities than the strains bearing the
wild-type allele (optical density at 600 nm [OD660] = 3.7 versus 4.3 in SD and 1.7 versus 2.2 in SGal after 38 h of
incubation). The maximum growth rates of the strains in each
medium were nevertheless similar (0.26 ± 0.03 h
1 in
SD and 0.18 ± 0.01 h1 in SGal).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Amino acid production under repression (SD) and
induction (SGal) conditions by XMP10-7B transformed with pEGAL-R2
|
|
The results presented so far indicate that under repressive conditions
(SD), the amino acid accumulation by cells bearing PGAL1::HOM3 constructions is
relatively high. Moreover, under induction conditions (SGal), the
cultures accumulate only four times more threonine than the repressed
cultures. In order to achieve a better regulation of threonine
accumulation, we considered it convenient to reduce the copy number of
the construction to 1 to 2 per cell.
For that purpose, centromeric plasmids containing
PGAL1::HOM3 fusions (pCGAL-H3 and
pCGAL-R2 [Table 1]) were constructed. Strain XMP10-7B transformed
with pCGAL plasmids was unable to grow in the absence of homoserine
even on carbon sources different from glucose if galactose was not
present in the medium. In order to avoid the addition of this amino
acid to the culture medium, which would interfere with the
quantification of this and other related amino acids, we decided to use
the Hom3+ strain GRF167, which is genetically related to
XMP10-7B. To avoid glucose repression, medium containing raffinose as
the sole carbon source (SR) was used in further experiments. In this
medium, both transformants had a maximum growth rate of 0.13 h1 and reached an OD660 of up to 3.5. Table
3 summarizes the results obtained from
the estimation of the amino acid production by GRF167 transformed with
pCGAL-R2 under noninducing conditions (SR) and after induction at
mid-log growth phase (OD660 ~ 1 to 1.5) by the addition
of galactose at a final concentration of 0.2% (SR plus Gal). In this
case, both a very low basal threonine content and a high accumulation
after induction were obtained. When a similar experiment was carried
out with pCGAL-H3 as a control, the maximum amounts of threonine and
homoserine accumulated by induced cultures were 16 and 2 nmol/mg (dry
weight), respectively.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Amino acid production in uninduced (SR) and induced (SR
plus Gal) cultures of GRF167 transformed with pCGAL-R2
|
|
Expression of HOM3-R2 from the CHA1
promoter.
The CHA1 gene encodes the catabolic
serine/threonine deaminase, one of the two enzymes catalyzing the first
step in threonine degradation (Fig. 1) and also involved in serine
catabolism (24a). Its transcription is induced by serine
and/or threonine (23). HOM3-R2 expression from
this promoter can be triggered by the addition of serine to the medium,
and once a certain amount of threonine has been accumulated, threonine
itself would induce its own overproduction.
The transcriptional fusions with this promoter were constructed in a
centromeric vector (pCHA plasmids [Table 1]). As in the previous
case, to avoid the addition of homoserine to the growth medium, a
Hom3+ strain (SG15) was used as the recipient of the
plasmid. In order to assess the influence of the CHA1 activity, which
is also inducible by serine, on threonine accumulation, a
Cha1 strain (SG183) isogenic to SG15 was also used. Both
strains were transformed with the pCHA plasmids; the transformants were
grown in minimal medium (SD plus Trp), and threonine production was monitored. The results (Table 4) show
that the intracellular threonine concentrations in 14-h cultures
(OD660 ~ 0.7) of the Cha1+ and
Cha1 strains transformed with pCHA-R2 were similar.
However, in 38-h cultures (OD660 ~ 1) the threonine
concentration in the Cha1 strain was twofold higher than
that in the Cha1+ strain, probably because of the absence
of threonine deaminase activity in the former.
View this table:
[in this window]
[in a new window]
|
TABLE 4.
Amino acid production under repression and induction
conditions by SG15 and SG183 transformed with pCHA-R2
|
|
Surprisingly, when the transformants were grown in the presence
of 1 g of serine per liter, the Cha1+ strain initially
accumulated three times more threonine than the
Cha1 strain, and this amount was constant
throughout the experiment (Table 4). This effect might be related to
the fact that under these conditions, the Cha1 strain
also accumulates a large amount of serine (~300 nmol/mg [dry
weight], versus 60 in the Cha1+ strain). A possible
explanation might be that serine inhibits homoserine dehydrogenase, as
occurs in E. coli (9a), although with a high
inhibition constant. Another possibility is that serine might have an
effect of trans stimulation on an eventual amino acid
carrier that mediates serine uptake down a concentration gradient, and
as a consequence, threonine export could take place. The behavior of
the Cha1 strain was similar to that without serine,
except that now threonine was accumulated and excreted to the medium to
the same extent. The same experiments carried out with the wild-type
HOM3 allele under control of the CHA1 promoter
revealed that serine has no effect on threonine accumulation, which was
at most 10 nmol/mg (dry weight) (data not shown).
In another set of experiments, different concentrations of serine were
added to 14-h cultures and threonine accumulation was periodically
monitored. As shown also in Table 4, in the pCHA-R2-bearing Cha1+ strain, a slight increase in threonine accumulation
was observed only at 24 h after serine addition (t = 38 h) and irrespective of the amount of serine added. However, in
the Cha1 strain the increase was much higher and was
dependent on the concentration of serine, although not proportionally.
An improvement in the culture medium was achieved by buffering the SD
medium (pH 5.8) and adding four times more tryptophan than usual. Under
these conditions, threonine production at the early states of growth
was similar to that described above (data not shown), but as the
duration of growth increased more threonine was accumulated, reaching
in the case of the Cha1 strain, to which 0.1 g
of serine per liter had been added, 320 nmol of threonine/mg (dry
weight) at an OD660 of ~5.
Expression of HOM3-R2 from the CYC1-HSE2
promoter.
CYC1-HSE2 is a hybrid promoter inducible by heat
shock (30). It is based on the promoter of the
CYC1 gene, which encodes iso-1-cytochrome c, but
the upstream activation sequence required for heme and glucose
regulation has been replaced by the HSE2 (for heat shock element)
region of SSA1, a gene from the Hsp70 family. Thus, in this
construct, HOM3-R2 expression could be induced by shifting
the culture incubation temperature from 22 to 37°C.
Transcriptional fusions of the HOM3 and HOM3-R2
alleles with the CYC1-HSE2 promoter were constructed and
placed in episomic plasmids, generating pEHSE-H3 and pEHSE-R2,
respectively (Table 1). Strain XMP10-7B transformed with either of
these plasmids was grown in selective minimal medium at 22°C to an
OD660 of ~0.7, and the threonine content was measured. In
both cases, the amount of accumulated threonine was quite high (~25
and ~75 nmol/mg [dry weight] in the cases of the wild-type and the
mutant alleles, respectively), probably due to the high copy number of
the plasmid and despite the fact that only 75% of the cells of both
cultures retained the plasmids. Moreover, similar amounts of threonine were found when the incubation temperature was shifted to 37°C (data
not shown).
On the basis of these results, these constructions were
placed in the centromeric vector Ycp50, resulting in plasmids pCHSE-H3 and -R2 (Table 1). In order to quantify the amino acid production, the
XMP10-7B transformants with these plasmids were grown in selective minimal medium at 22°C. When the cultures reached an
OD660 of ~1, a portion of each was shifted to 37°C, and
threonine and homoserine were periodically measured. In the case of the
wild-type allele, the heat shock had no appreciable effect on threonine
and homoserine accumulations, which were at most 10 and 1 nmol/mg (dry
weight), respectively. Conversely, the results with pCHSE-R2 (Table
5) show that the longer the incubation
was maintained at this temperature, the more amino acid was produced.
However, a good proportion of the produced amino acid was excreted to
the medium.
View this table:
[in this window]
[in a new window]
|
TABLE 5.
Amino acid production in uninduced (22°C) and induced
(transferred to 37°C) cultures of XMP10-7B transformed
with pCHSE-R2
|
|
To reduce the effect of excretion, which had been previously reported
to be favored at 37°C (24), a similar experiment in which
the heat shock lasted for only 30 min was carried out. For this and the
subsequent experiments, strain HT2, which was derived from strain SG15
by disruption of the HOM3 gene, was used. Cultures of HT2
transformants in buffered SD medium reached a maximum OD660 of ~8. When the cultures grown at 22°C reached an OD660
of ~1, they were split into two: one portion was subjected to a
30-min heat shock, and the other was kept at 22°C; amino acids in
both portions were periodically measured. The threonine and homoserine accumulations are shown in Fig. 2; the
amounts of these amino acids excreted to the medium were negligible.
The results show that a progressive increase in the threonine and
homoserine contents in low-temperature-grown cultures occurred,
reaching a maximum at the end of the exponential growth phase.
No significant threonine production was attained when the
pCHSE-H3 plasmid was used. Another heat shock was applied to a
sample of the cultures grown at 22°C when they reached an
OD660 of ~5. This resulted in slightly increased amino
acid accumulation for the pCHSE-R2-bearing cells (data not shown).
View larger version (21K):
[in this window]
[in a new window]
|
FIG. 2.
Threonine and homoserine accumulation in strain HT2
transformed with plasmid pCHSE-H3 (circles) or pCHSE-R2 (triangles),
grown at 22°C (closed symbols) and after a 30-min heat shock at an
OD660 of ~1 (open symbols). Growth of HT2(pCHSE-R2) is
also shown (squares). The results are means from two independent
experiments, and the coefficients of variation were lower than 20%.
wt, weight.
|
|
In order to prove that these effects were indeed due to
transcriptional induction of the HOM3-R2 allele from
the CYC1-HSE2 promoter, a Northern analysis with
samples taken at different times after the shift to 37°C and from
nonshocked cultures was carried out. As shown in Table
6, a maximum HOM3-R2
transcript level was reached shortly after the temperature shift,
followed by a progressive decrease during the next 90 min. In fact, an additional experiment (data not shown) revealed that a 5-min heat shock
resulted in threonine production similar to that described above.
Similar transcription levels were obtained in the case of the wild-type
HOM3 allele fused to the CYC1-HSE2 promoter
(Table 6). On the other hand, consistent with the threonine production data, a fourfold increase in the HOM3-R2 transcript level
was observed at the end of the exponential growth phase. This could indicate that induction of the construction takes place at this growth
state. An explanation for the temporary lack of correlation between the
message level and threonine content could be that while mRNAs are
rapidly degraded after the heat shock (Table 6), the resulting enzyme
and also the threonine pool are more stable. In fact, a lack of
correspondence between enzyme activity and transcript levels in the
threonine/methionine pathway has also been observed by others
(22). Posttranscriptional regulation has been postulated to
explain this phenomenon.
Expression of HOM3-R2 from the GPH1
promoter.
GPH1 encodes glycogen phosphorylase, which is
involved in glycogen utilization. GPH1 transcription is
induced at the late exponential growth phase, almost simultaneously
with the onset of intracellular glycogen accumulation but before
glucose depletion from the medium (11). The main advantage
of the use of this promoter is that no external inducer is needed to
trigger its expression.
Strain HT2 was transformed with the pGPH plasmids (Table 1). The
transformants were grown in SD plus Trp (at a concentration fourfold
higher than usual) at 30°C, and threonine and homoserine production
was monitored throughout the growth curve until the late stationary
phase. The results shown in Fig. 3 reveal
that cells with plasmid pGPH-R2 accumulated a considerable amount of threonine and homoserine at the end of the exponential growth phase. In
140-h cultures these amino acid concentrations were the same as those
at 70 h (data not shown). The external concentration of threonine
was negligible.
View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3.
Threonine and homoserine accumulation in strain HT2
transformed with plasmids pGPH-H3 (circles) and pGPH-R2 (triangles).
Growth of HT2(pGPH-R2) is also shown (squares). The results are
means from two independent experiments, and the coefficients of
variation were lower than 20%. wt, weight.
|
|
| |
DISCUSSION |
From an energetic viewpoint, accumulation of a metabolite competes
with energy production for cell growth and maintenance. Thus, in order
to overproduce a metabolite such as threonine, it is convenient to
separate the trophophase or growth phase from the production phase.
This separation turns out to be necessary in the case of microorganisms
coming from fermentative industries that are intended to be used
afterwards as enriched biomass.
In this work we show that the control of expression from four different
inducible promoters of the yeast HOM3-R2 allele, which confers the ability to overproduce threonine, allows circumvention of
the overlap of the two phases. The use of each construction has some
advantages and inconveniences derived from their characteristics, which
makes the choice of a single promoter difficult. For instance, the
initial assumption that the presence of a high copy number of a certain
HOM3-R2 construct would favor threonine overproduction is
not necessarily true. The results obtained with the episomic plasmids
pEGAL-R2 and pEHSE-R2 suggest that a limitation of negative effector
molecules may make the basal level of threonine accumulation higher
than desirable under repression conditions. Moreover, under induction
conditions, the expression might not be optimal due to a limitation of
the number of activator molecules. In fact, it has been reported that
the level of Gal4p (transcriptional activator of GAL genes)
in the cell is very low (3), being insufficient even for the
maximum induction of the normal complement of GAL promoters
in a wild-type strain (13). To overcome this problem, we
decided to place the different constructs in single-copy plasmids,
which at the same time would represent more accurately the hypothetical
situation in an industrial yeast strain in which the construct would be
integrated into the genome, thus increasing the stability of the construction.
The induction of the fusion
CYC1-HSE2::HOM3/-R2 observed during the late
exponential growth phase is an interesting feature of this construct.
In S. cerevisiae there are a number of genes whose
expression is induced under stress conditions (18). The stress response is related to the presence of an STRE element in the
corresponding promoter (19). In the SSA1 gene
there are two STRE elements, although this gene is not induced at the
entry into the stationary growth phase (4). One of them is
present in the HSE2 region and hence in the CYC1-HSE2
promoter. This together with the fact that cytochrome
c-related genes are coordinately induced by glucose
exhaustion (6) might be responsible for the observed
induction effect. The GPH1 promoter induction observed at
the entry into stationary growth phase (11) is consistent with the presence of STRE elements. In this case, the induction has an
effect on threonine accumulation, which is congruent with the
GPH1 transcription pattern previously described.
A summary of the maximum threonine production achieved with each of the
constructions in centromeric plasmids, under both induction and
repression conditions, is shown in Fig.
4. Besides differences in overall
production, two general factors need to be considered if maximum
accumulation is to be achieved. First, under certain circumstances a
large part of the produced threonine is excreted to the culture medium,
especially at advanced growth phases. Threonine excretion by a yeast
strain seems to be highly dependent on its genetic background
(5), although we still do not have a complete picture of the
genetic factors involved in that phenomenon. Further investigations in
this field are necessary in order for this factor to be controlled.
Second, the Cha1p activity lowers threonine accumulation, although its
effect is observed mainly at the stationary growth phase. Thus,
inactivation of the CHA1 gene in the producer strain should
also improve threonine accumulation.
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
Maximum threonine production by strains carrying one
copy of the mutant HOM3-R2 allele under the control of
different regulatable promoters. The production is expressed as the sum
of threonine accumulated in the cells under either repression (open
bars) or induction (shaded bars) conditions and that excreted to the
medium (hatched bars).
|
|
The results presented in this and previous papers (7, 24)
show that manipulation of the genes involved in threonine biosynthesis, by both mutation and amplification, leads to a maximum production that
in all cases is around 400 nmol/mg (dry weight). Thus, with these kinds
of operations, this seems to be the upper limit, which may be
influenced by the efflux system for this amino acid. In fact, it has
been shown that threonine overproduction also leads to increased
formation of homoserine, an intermediate metabolite, and to a lesser
extent that of isoleucine and glycine, which are derived from threonine
(data not shown). These results are in agreement with those obtained
for bacteria (25). Therefore, further improvement of the
production should probably be achieved by engineering other factors,
such as the input of metabolites into the route or the degradation and
excretion of the amino acid. We are presently working on these topics.
This work was supported by the Spanish CICYT (grants BIO93-0423
and ALI96-0938) and by the Junta de Andalucía (grant CVI-0153).
We very much appreciate the collaboration of J. E. Martín-Oar and L. Navas (Grupo Cruzcampo S.A., Seville, Spain)
and P. Niederberger and D. Jäger (Nestlé Research Center,
Lausanne, Switzerland). We thank S. Holmberg, A. Aguilera, F. del Rey,
J. M. Pardo, A. Rodríguez, and J. François for
kindly providing the strains and plasmids mentioned in the text;
M. Arévalo for many helpful discussions; I. Velasco
for constructing strain HT2; and D. Jäger for critical reading of
the manuscript.
| 1.
|
Arévalo, M.
1996.
Aislamiento y caracterización de mutaciones del gen HOM3 que alteran la regulación de la síntesis de treonina y metionina en Saccharomyces cerevisiae. Ph.D. thesis.
University of Seville, Seville, Spain.
|
| 2.
|
Boeke, J. D.,
C. A. Garfinkel,
C. A. Styles, and G. R. Fink.
1985.
Ty elements transpose through an RNA intermediate.
Cell
40:491-500[Medline].
|
| 3.
|
Bram, R. J., and R. D. Kornberg.
1985.
Specific protein binding to far upstream activating sequences in polymerase II promoters.
Proc. Natl. Acad. Sci. USA
82:43-47[Abstract/Free Full Text].
|
| 4.
|
Craig, E. A.
1992.
The heat-shock response of Saccharomyces cerevisiae, p. 501-537.
In
E. W. Jones, J. R. Pringle, and J. R. Broach (ed.), The molecular and cellular biology of the yeast Saccharomyces. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 5.
|
Delgado, M. A.,
J. Guerrero, and J. Conde.
1982.
Genetic and biochemical study of threonine-overproducing mutants of Saccharomyces cerevisiae.
Mol. Cell. Biol.
2:731-736[Abstract/Free Full Text].
|
| 6.
|
DeRisi, J. L.,
V. R. Iyer, and P. O. Brown.
1997.
Exploring the metabolic and genetic control of gene expression on a genomic scale.
Science
278:680-686[Abstract/Free Full Text].
|
| 7.
|
Farfán, M. J.,
E. Martín-Rendón, and I. L. Calderón.
1996.
Effect of gene amplification on threonine production by yeast.
Biotechnol. Bioeng.
49:667-674.
|
| 8.
|
Feinberg, A. P., and B. Vogelstein.
1983.
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.
Anal. Biochem.
132:6-13[Medline].
|
| 9.
|
Gietz, D.,
A. St. Jean,
R. A. Woods, and R. H. Schiestl.
1992.
Improved method for high efficiency transformation of intact yeast cells.
Nucleic Acids Res.
20:142[Free Full Text].
|
| 9a.
|
Hama, M.,
Y. Sumita,
Y. Kakutani,
M. Tsuda, and T. Tsuchiya.
1990.
Target of serine inhibition in Escherichia coli.
Biochem. Biophys. Res. Commun.
168:1211-1216[Medline].
|
| 10.
|
Hanahan, D.
1985.
Techniques for transformation of E. coli, p. 109-114.
In
D. M. Glover (ed.), DNA cloning. A practical approach. IRL Press, Oxford, United Kingdom.
|
| 11.
|
Hwang, P. K.,
S. Tugendreich, and R. J. Fletterick.
1989.
Molecular analysis of GPH1, the gene encoding glycogen phosphorylase in Saccharomyces cerevisiae.
Mol. Cell. Biol.
9:1659-1666[Abstract/Free Full Text].
|
| 12.
|
Johnston, M.,
J. S. Flick, and T. Pexton.
1994.
Multiple mechanisms provide rapid and stringent glucose repression of GAL gene expression in Saccharomyces cerevisiae.
Mol. Cell. Biol.
14:3834-3841[Abstract/Free Full Text].
|
| 13.
|
Johnston, S. A., and J. E. Hopper.
1982.
Isolation of the yeast regulatory gene GAL4 and analysis of its dosage effects on the galactose/melibiose regulon.
Proc. Natl. Acad. Sci. USA
79:6971-6975[Abstract/Free Full Text].
|
| 14.
|
Kleemann, A.,
W. Leuchtenberger,
B. Hoppe, and H. Tanner.
1985.
Amino acids, p. 57-97.
In
E. Bartholomé, E. Biekert, and H. Hellmann (ed.), Ullmann's encyclopedia of industrial chemistry, vol. A2. VCH, Weinheim, Germany.
|
| 15.
|
Köhrer, K., and H. Domdey.
1991.
Preparation of high molecular weight RNA.
Methods Enzymol.
194:398-405[Medline].
|
| 16.
|
Kramer, B.,
W. Kramer, and H. J. Fritz.
1984.
Different base/base mismatches are corrected with different efficiencies by the methyl-directed DNA mismatch-repair system of E. coli.
Cell
38:879-887[Medline].
|
| 17.
|
Leuchtenberger, W.
1996.
Amino acids. Technical production and use, p. 465-502.
In
M. Roehr (ed.), Biotechnology. Products of primary metabolism. VCH, Weinheim, Germany.
|
| 18.
|
Mager, W. H., and P. Moradas Ferreira.
1993.
Stress response of yeast.
Biochem. J.
290:1-13.
|
| 19.
|
Marchler, G.,
C. Schüller,
G. Adam, and H. Ruis.
1993.
A Saccharomyces cerevisiae UAS element controlled by protein kinase A activates transcription in response to a variety of stress conditions.
EMBO J.
12:1997-2003[Medline].
|
| 20.
|
Martínez-Force, E., and T. Benítez.
1992.
Selection of amino-acid overproducer yeast mutants.
Curr. Genet.
21:191-196.
|
| 21.
|
Martín-Rendón, E.,
M. J. Farfán,
C. Ramos, and I. L. Calderón.
1993.
Isolation of a mutant allele that deregulates the threonine biosynthesis in Saccharomyces cerevisiae.
Curr. Genet.
24:465-471[Medline].
|
| 22.
|
Mountain, H. A.,
A. S. Byström,
J. T. Larsen, and C. Korch.
1991.
Four major transcriptional responses in the methionine/threonine biosynthetic pathway of Saccharomyces cerevisiae.
Yeast
7:781-803[Medline].
|
| 23.
|
Petersen, J. G. L.,
M. C. Kielland-Brandt,
T. Nilsson-Tillgren,
C. Bornæs, and S. Holmberg.
1988.
Molecular genetics of serine and threonine catabolism in Saccharomyces cerevisiae.
Genetics
119:527-534[Abstract/Free Full Text].
|
| 24.
|
Ramos, C., and I. L. Calderón.
1992.
Overproduction of threonine by yeast mutants resistant to hydroxynorvaline.
Appl. Environ. Microbiol.
58:1677-1682[Abstract/Free Full Text].
|
| 24a.
|
Ramos, F., and J. M. Wiame.
1982.
Occurrence of a catabolic L-serine (L-threonine) deaminase in Saccharomyces cerevisiae.
Eur. J. Biochem.
123:571-576[Medline].
|
| 25.
|
Reinscheid, D. J.,
W. Kronemeyer,
L. Eggeling,
B. J. Eikmanns, and H. Sahm.
1994.
Stable expression of hom-1-thrB in Corynebacterium glutamicum and its effect on the carbon flux to threonine and related amino acids.
Appl. Environ. Microbiol.
60:126-132[Abstract/Free Full Text].
|
| 26.
|
Rose, M. D.,
P. Novick,
J. H. Thomas,
D. Botstein, and G. R. Fink.
1987.
A Saccharomyces cerevisiae genomic plasmid bank based on a centromere-containing shuttle vector.
Gene
60:237-243[Medline].
|
| 27.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 28.
|
Seibold, M.,
K. Nill, and K. Poralla.
1981.
Homoserine and threonine pools of borrelidin resistant Saccharomyces cerevisiae mutants with altered aspartokinase.
Arch. Microbiol.
129:368-370[Medline].
|
| 29.
|
Sherman, F.,
G. R. Fink, and J. B. Hicks.
1986.
Laboratory course manual for methods in yeast genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 30.
|
Slater, M. R., and E. A. Craig.
1987.
Transcriptional regulation of an hsp70 heat shock gene in the yeast Saccharomyces cerevisiae.
Mol. Cell. Biol.
7:1906-1916[Abstract/Free Full Text].
|
| 31.
|
Sulser, H.,
J. DePizzol, and W. Büchi.
1967.
A probable flavoring principle in vegetable-protein hydrolysates.
J. Food Sci.
32:611-615.
|
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Top
Abstract
Introduction
