This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, S. H.
Right arrow Articles by Breuil, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, S. H.
Right arrow Articles by Breuil, C.
Agricola
Right arrow Articles by Kim, S. H.
Right arrow Articles by Breuil, C.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, January 1999, p. 287-290, Vol. 65, No. 1
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

Rapid Detection of Ophiostoma piceae and O. quercus in Stained Wood by PCR

Seong Hwan Kim, Adnan Uzunovic, and Colette Breuil*

Chair of Forest Products Biotechnology, Department of Wood Science, University of British Columbia, Vancouver, British Columbia, Canada V6T 1Z4

Received 6 August 1998/Accepted 3 November 1998


    ABSTRACT
Top
Abstract
Text
References

A rapid, sensitive, and simple method was developed to detect the sapstain fungi Ophiostoma piceae and O. quercus in stained wood. By using microwave heating for DNA extraction and PCR with internal transcribed spacer-derived-specific primers, detection was feasible within 4 h, even with DNA obtained from a single synnema. This method can easily be extended for the detection of other wood-inhabiting fungi.


    TEXT
Top
Abstract
Text
References

Green softwood lumber exports to offshore markets are currently worth several billion dollars annually (2). These softwood shipments may contain a variety of microorganisms, including wood-inhabiting fungi, which could be unacceptable to receiving countries. In addition, countries developing their own softwood forests could impose restrictions on the importation of infected wood (3). Freshly-cut wood surfaces are rich in nutrients and provide niches for a variety of interacting microorganisms, such as fungi, mites, and insects. For example, sapstaining fungi that cause wood discoloration are responsible for considerable losses in revenue for the forest products industry. Organisms belonging to the Ophiostoma genus (Ascomycota) are the fungi that are most frequently isolated from stained wood (9). Developing and applying new fungal control processes and responding to international regulations for pathogens will require an understanding not only of the ecology and pathology of fungi that discolor wood but also of the ability to rapidly identify these organisms.

Presently, fungal identification is carried out by traditional methods. The infected wood is first incubated and sampled for fungi with selective media amended with antibiotics. The obtained isolates are then purified and transferred to a nutrient agar medium, where the morphological and biological characteristics of the isolates are recorded. When possible, the isolated organism is mated with sexually-compatible strains. The whole procedure is tedious and time-consuming (it can take up to 2 months) and requires mycological and taxonomical expertise. The quarantine of wood shipments can be very costly for the forest industry. A simple, quick, and reliable detection method would speed up the quarantine process and indicate whether additional treatment is required to protect the wood from pests. PCR techniques with fungal species-specific primers may provide such a solution (4, 6, 10).

Our aim in this work was to demonstrate the feasibility of PCR methods for the detection of sapstain fungi in wood samples. We selected O. piceae as our model organism, since this fungus is the most common sapstain species isolated from stained lumber and logs worldwide (9) and has been implicated as a biological control organism in the oak wilt disease cycle (7). Recently, this fungal species has been divided into two taxa, O. piceae, isolated mainly from softwood species, and O. quercus, isolated mainly from hardwood species (1, 5). In the first part of this study, we described how specific PCR primer pairs were generated for the two groups of organisms. Then we described the development of a quick genomic DNA preparation used in conjunction with the PCR procedure to directly detect O. piceae and O. quercus fungi in wood infected with known or unknown species.

DNA isolation, PCRs, cloning, and sequencing. A list of the isolates used in this work is given in Table 1. The fungi were pregrown on 2% malt extract agar (MEA) for 7 to 10 days at 20°C. Spore suspensions prepared from MEA cultures were spread onto sterile sheets of cellophane that were overlayered onto the MEA plates. After 2 days of incubation at 20°C, about 0.3 g of mycelium was harvested from the cellophane sheet by scraping the surface with a scalpel. The harvested mycelium was stored in a 2-ml sterile cryogenic vial (Sarstedt, Nümbrecht, Germany). Total genomic DNA from the mycelium was extracted by drilling twice (2 min each time) on ice with a stainless steel bit that fit the vial exactly. Prior to drilling, the mycelium was suspended into 200 µl of buffer (50 mM Tris-HCl [pH 8.5], 50 mM EDTA, and 3% sodium dodecyl sulfate). Then, 150 µl of 3 M sodium acetate (pH 5.2) was added to the ground mycelium. The mixture was kept at -20°C for 10 min and centrifuged for 10 min at 13,800 × g. The supernatant was removed, mixed with an equal volume of isopropanol, incubated for 5 min at room temperature, and centrifuged again. The DNA pellet was washed with 70% ethanol, dissolved in TE buffer (10 mM Tris [pH 8.0], 1 mM EDTA), and used for PCR amplification.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Sapstain fungal species and isolates used in this study and results of PCR assay with respective O. piceae and O. quercus ITS-derived primer pairs, OPC1-OPC2 and OPH1-OPH2

PCRs were performed in 0.6-ml Omnitubes with a Hybaid Touch Down thermal cycler. PCR mixtures (25 µl each) contained 5 to 30 ng of fungal genomic DNA, 20 pmol of each primer, 1× PCR buffer (10 mM Tris-Cl [pH 8.0], 1.5 mM MgCl2, 50 mM KCl), 25 µM (each) of the four deoxynucleoside triphosphates, and 0.5 U of Taq polymerase (Appligene, Watford, United Kingdom). Thermal cycling conditions were as follows: initial denaturation (94°C, 4 min), 30 cycles of denaturation (94°C, 50 s), annealing (55°C, 50 s), and primer extension (72°C, 50 s), followed by one final cycle of primer extension (72°C, 5 min). Five microliters of the reaction product was analyzed by electrophoresis on a 1.4% agarose gel in Tris-acetate-EDTA buffer (TAE) with ethidium bromide and visualized under UV light.

The PCR-amplified DNA products were subcloned into pCR 2.1-TOPO vector (Invitrogen Co., Carlsbad, Calif.) according to the manufacturer's instructions and sequenced. The sequencing reactions were carried out in a DNA thermal cycler (Perkin-Elmer Cetus) by using ABI AmpliTaq dye termination cycle sequencing chemistry. Nucleotide sequences were analyzed with the ABI 373 DNA sequencer (Applied Biosystems, Foster City, Calif.) and determined on both strands. Sequence alignments and comparisons were performed by using PC/Gene software (IntelliGenetics Inc.). Database searches were done by using the services provided by the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov).

Developing PCR primer pairs specific for O. piceae and O. quercus. To generate specific primer pairs, it was necessary to sequence the internal transcribed spacer (ITS) region of several strains. First, we used the universal primer pair ITS1 and ITS4 (12) to amplify the ITS and the 5.8S ribosomal DNA regions of O. piceae (isolates H2154, H2009, and AU100-1) and O. quercus (isolates AU13, AU160-9, and H920). The 650-bp DNA fragments were amplified (Fig. 1), subcloned, and sequenced. The identity of the DNA fragments sequenced as ITS1-5.8S-ITS2 regions of rDNA was confirmed by high sequence homology (95%) with other ITS regions of different Ophiostoma species. After comparison of these sequences with ITS region sequences of other Ophiostoma-related species, we designed an O. piceae-specific primer pair, OPC1 (5' AGGGATCATTAGCGAGTTTTCAAC 3') and OPC2 (5' CCTCGAGAGGGTCGCCTGCG 3'), and an O. quercus-specific primer pair, OPH1 (5' AGGGATCATTACAGAGTTTTTAAC 3') and OPH2 (5' TCTGCAAGCAGAGCCTCCTG 3'). The primers OPC1 and OPH1 were located on the regions between the 3' end of the 18S and the 5' end of ITS1, while the primers OPC2 and OPH2 were located close to the 3' end of the ITS2 region. The two ITS-derived primer pairs targeted O. piceae and O. quercus DNA (Fig. 1). The amplified bands corresponded to the expected size of 560 bp, calculated from the DNA sequence information. The identity of the amplified DNA bands as ITS fragments was confirmed by Southern hybridization with the [gamma -32P]ATP-labeled ITS1-5.8S-ITS2 insert DNA (650 bp) subcloned in pCR 2.1-TOPO vector used as a probe (data not shown). The presence and absence of bands matched with the intended specificity of the primer pairs.


View larger version (38K):
[in this window]
[in a new window]
 
FIG. 1.   Gel electrophoresis of PCR products from O. piceae (lanes 1, 3, and 5) and O. quercus (lanes 2, 4, and 6) with primer pairs ITS1-ITS4, OPC1-OPC2, and OPH1-OPH2. Lane M, 1-kb ladder (Gibco BRL).

The specificity of the designed primers was further tested by using PCR on the genomic DNA of a broad selection of isolates which were concomitantly isolated with O. piceae during a survey study of sapstaining fungi (11). The results, shown in Table 1, confirmed that the OPC1-OPC2 and the OPH1-OPH2 primer pairs amplified only the targeted DNA fragments of the O. piceae and O. quercus isolates, respectively. To confirm that the lack of amplification in the other species was due not to the quality of the DNA extracted but to the absence of specificity of the primers used, we also tried to PCR amplify a region of the 18S rDNA, using the universal rDNA primer pair NS1 and NS8 (12). For all the isolates listed in Table 1, we successfully amplified 1.7-kb bands corresponding to the 18S rDNA region (data not shown), confirming that the quality of the DNA was appropriate for PCR amplification and that the lack of amplification in other species could be related to the primers' specificity for O. piceae or O. quercus.

Detecting O. piceae and O. quercus directly in wood samples. To develop an efficient and rapid detection system, it is desirable to directly extract fungal DNA from infected samples and to minimize the time required for DNA extraction. Consequently, we assessed the feasibility of using a microwave to extract DNA directly from spores or mycelium produced on artificial media and wood. In this preliminary experiment, only O. quercus (AU13) was used. The organism was grown on MEA for 10 days. About 0.2 µl of the spore mass was taken from the top of synnemata with the tip of a pipetman and transferred into 0.5-ml microcentrifuge tubes. The tubes were capped and heated in a microwave for 5 min at 700 W. To each tube, 30 µl of ice-cold TE buffer was added. The tubes were then vortexed for 1 min and centrifuged at 13,800 × g for 1 min at 4°C. Without additional extraction steps, the supernatant (5 or 10 µl) was used directly for PCRs with the OPH1-OPH2 primer pair. The PCR produced the ITS rDNA fragment as shown in lane 6 of Fig. 1. We found that culture age affected the band intensity of the PCR products and that DNA prepared from a younger culture produced a stronger band (Fig. 2A). In this set of preliminary experiments, we also assessed the effects of various microwave heating times (30, 60, 180, 240, and 300 s). Usually, heating the sample in the microwave for 60 s was enough to extract and amplify the DNA. However, a heating time of 300 s gave more consistent results and thus was used in all of our experiments. Using this DNA extracting method, we were able to repeatedly amplify the O. quercus ITS rDNA from a spore mass at the tip of a single synnema. The minimum number of spores needed for PCR amplification by this method was 102.


View larger version (27K):
[in this window]
[in a new window]
 
FIG. 2.   Gel electrophoresis of PCR products obtained with template DNAs prepared by a microwave heating method. (A) PCRs with primers OPH1-OPH2 and template DNAs from O. quercus at different culture ages (in days): lane 1, 6; lane 2, 12; and lane 3, 18. (B) PCRs with primers NL1-NL2 and template DNAs from different species. Lanes: 1, O. canum; 2, O. flexuosum; 3, O. ips; 4, O. minus; 5, O. piceaperdum; 6, O. piliferum; 7, species C; 8, species D; 9, species E; M, 1-kb ladder (Gibco BRL).

To test the relevance of this rapid DNA extraction method on a variety of sapstaining fungi, we used the universal NL1-NL2 primer pair that targets a region of 350 bp in the 26S rDNA gene (8). We did not have specific primer pairs for all of the Ophiotoma species used in this work. This region was amplified in all the fungal strains listed in Table 1. Examples of the PCR-amplified products are shown in Fig. 2B. The results suggested that PCR detection of sapstaining fungi is feasible with DNA extracted by a microwave. However, specific primers or DNA probes need to be generated for the different Ophiostoma species.

We also tested our methodology with fungal species grown on and sampled directly from wood. Spore suspensions of O. piceae, O. quercus, and four other Ophiostoma species (species C, D, and E and a Leptographium sp.) were artificially inoculated, individually or as a mixture, onto noninfected surface-sterilized lodgepole pine slabs and logs. After a 2-week incubation period, synnemata were sampled from each inoculated-wood sample. We were able to rapidly detect O. quercus or O. piceae from both the individual and the mix-inoculated wood by PCR with the OPH1-OPH2 or the OPC1-OPC2 primer pair, respectively. The method was also tested with samples collected from naturally-infected lodgepole pine lumber or logs. Sixty-five unidentified spore samples were collected in microcentrifuge tubes by using sterile forceps. A single synnema head was collected, and DNA extraction was performed as described above. During the sampling, one part of each spore head was deposited into the tube, and the other part was streaked onto MEA medium to grow the fungal isolate and carry out identification by the classical method, based on morphology. A PCR product of the expected size (560 bp) was produced by a total of 23 samples with the OPC1 and OPC2 primer pair. All PCR detection was completed in a period of less than 4 h. Figure 3 shows examples of PCR results for randomly-selected unidentified samples. The samples in lanes 1, 3, and 7 produced the expected 560-bp band, suggesting that they are likely O. piceae. A month later these results were compared with those from the morphology-based identification. Five different fungal species, including O. piceae, were morphologically identified from the 65 samples. All 23 samples, including the 3 samples shown in lanes 1, 3, and 7 in Fig. 3, were identified as O. piceae. These results demonstrated that simple DNA extraction of a single synnema, followed by PCR amplification, was feasible not only with fungal culture grown in artificial media but also with stained wood from a sawmill.


View larger version (32K):
[in this window]
[in a new window]
 
FIG. 3.   Examples of direct detection of O. piceae by PCR amplification of ITS rDNA with primers OPC1-OPC2 in stained wood. Lanes 1 to 8, randomly selected, unidentified spore samples collected from a sawmill; lane M, 1-kb ladder (Gibco BRL).

Conclusions. We have developed two ITS-derived primer pairs, OPC1-OPC2 and OPH1-OPH2, that were specific for and detected fungal species O. piceae and O. quercus, respectively, not only in artificial media but also on stained wood. The method described in this study has a number of advantages. First, this method does not necessitate the growth of organisms in artificial media, thus saving considerable time and money. Second, the simple and rapid DNA extraction method eliminates the tedious steps of freezing and grinding the mycelium, treating extracts with RNase and phenol, and precipitating the DNA with ethanol. Third, the possible cross-contamination of isolates during the sampling procedure is less likely when species-specific primers are used. Our only limitation at present is the lack of specific primers for the remaining species. We look forward to the widespread use of our on-site detection approach in the forest industry when more specific primers become available.

Nucleotide sequence accession numbers. The sequences of the ITS regions obtained in this study have been submitted to the GenBank database under accession no. AF081129, AF081130, and AF081131 for O. piceae AU100-1, H2009, and H2154, respectively, and AF081132, AF081133, and AF081134 for O. quercus AU160-9, AU13, and H920, respectively.


    ACKNOWLEDGMENTS

We thank J. Zuzwik, J. Webber, Y. Yamamoto, and E. Halmschlager for the kind gift of O. piceae and O. quercus isolates.

This work was supported by a partnership grant from the Natural Sciences and Engineering Research Council of Canada, the Canadian Forest Service, and Forintek Canada.


    FOOTNOTES

* Corresponding author. Mailing address: Chair of Forest Products Biotechnology, Department of Wood Science, University of British Columbia, Vancouver, BC, Canada V6T 1Z4. Phone: 1-604-822-9738. Fax: 1-604-822-9104. E-mail: breuil{at}interchg.ubc.ca.


    REFERENCES
Top
Abstract
Text
References

1. Brasier, C. M., and S. A. Kirk. 1993. Sibling species within Ophiostoma piceae. Mycol. Res. 97:811-816.
2. COFI. 1996. British Columbia Forest Industry Fact Book---1995. Council of Forest Industries, Vancouver, British Columbia, Canada.
3. Federal Register. 1994. Proposed rules: importation of logs, lumber, and other unmanufactured wood articles, p. 3002-3209. Animal and Plant Health Inspection Service, United States Department of Agriculture.
4. Förster, H., and M. D. Coffy. 1993. Molecular taxonomy of Phytophthora megasperma based on mitochondrial and nuclear DNA polymorphisms. Mycol. Res. 97:1101-1112.
5. Halmschlager, E., R. Messner, T. Kowalski, and H. Prillinger. 1994. Differentiation of Ophiostoma piceae and Ophiostoma quercus by morphology and RAPD analysis. Syst. Appl. Microbiol. 17:554-562.
6. Henson, J. M., T. Goins, W. Grey, D. E. Mathre, and M. L. Elliot. 1993. Use of polymerase chain reaction to detect Gaeumannomyces graminis DNA in plants grown in artificially and naturally infested soil. Phytopathology 83:283-287.
7. Juzwik, J., and K. R. Cease. 1997. Colonization of oak wilt fungal mats by Ophiostoma piceae during spring in Minnesota. Plant Dis. 81:410-414.
8. O'Donnell, K. 1992. Ribosomal DNA internal transcribed spacers are highly divergent in the phytopathogenic ascomycete Fusarium sambucinum (Gibberella pulicaris). Curr. Genet. 22:213-220[Medline].
9. Seifert, K. A. 1993. Sapstain of commercial lumber by species of Ophiostoma and Ceratocystis, p. 141-151. In M. J. Wingfield, K. A. Seifert, and J. F. Webber (ed.), Ceratocystis and ophiostoma. Taxonomy, ecology, and pathogenecity. APS Press, St. Paul, Minn.
10. Simon, L., M. Lalonde, and T. D. Bruns. 1992. Specific amplification of 18S fungal ribosomal genes from vascular-arbuscular endomycorrhizal fungi colonizing roots. Appl. Environ. Microbiol. 58:291-295[Abstract/Free Full Text].
11. Uzunovic, A., D.-Q. Yang, P. Gagné, C. Breuil, L. Bernier, and A. Byrne. 1998. Which fungi cause sapstain in Canadian softwoods? IRG doc. no. IGR/WP 98-10285. International Research Group on Wood Preservation, Stockholm, Sweden.
12. White, T. J., T. Bruns, S. Lee, and J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p. 315-322. In M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols: a guide to methods and applications. Academic Press, San Diego, Calif.


Applied and Environmental Microbiology, January 1999, p. 287-290, Vol. 65, No. 1
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Alamouti, S. M., Kim, J.-J., Breuil, C. (2006). A new Leptographium species associated with the northern spruce engraver, Ips perturbatus, in western Canada.. Mycologia 98: 149-160 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kim, S. H.
Right arrow Articles by Breuil, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, S. H.
Right arrow Articles by Breuil, C.
Agricola
Right arrow Articles by Kim, S. H.
Right arrow Articles by Breuil, C.