TEXT

Top Abstract Text References

Green softwood lumber exports to offshore markets are currently worth several billion dollars annually (2). These softwood shipments may contain a variety of microorganisms, including wood-inhabiting fungi, which could be unacceptable to receiving countries. In addition, countries developing their own softwood forests could impose restrictions on the importation of infected wood (3). Freshly-cut wood surfaces are rich in nutrients and provide niches for a variety of interacting microorganisms, such as fungi, mites, and insects. For example, sapstaining fungi that cause wood discoloration are responsible for considerable losses in revenue for the forest products industry. Organisms belonging to the Ophiostoma genus (Ascomycota) are the fungi that are most frequently isolated from stained wood (9). Developing and applying new fungal control processes and responding to international regulations for pathogens will require an understanding not only of the ecology and pathology of fungi that discolor wood but also of the ability to rapidly identify these organisms.

Presently, fungal identification is carried out by traditional methods. The infected wood is first incubated and sampled for fungi with selective media amended with antibiotics. The obtained isolates are then purified and transferred to a nutrient agar medium, where the morphological and biological characteristics of the isolates are recorded. When possible, the isolated organism is mated with sexually-compatible strains. The whole procedure is tedious and time-consuming (it can take up to 2 months) and requires mycological and taxonomical expertise. The quarantine of wood shipments can be very costly for the forest industry. A simple, quick, and reliable detection method would speed up the quarantine process and indicate whether additional treatment is required to protect the wood from pests. PCR techniques with fungal species-specific primers may provide such a solution (4, 6, 10).

Our aim in this work was to demonstrate the feasibility of PCR methods for the detection of sapstain fungi in wood samples. We selected O. piceae as our model organism, since this fungus is the most common sapstain species isolated from stained lumber and logs worldwide (9) and has been implicated as a biological control organism in the oak wilt disease cycle (7). Recently, this fungal species has been divided into two taxa, O. piceae, isolated mainly from softwood species, and O. quercus, isolated mainly from hardwood species (1, 5). In the first part of this study, we described how specific PCR primer pairs were generated for the two groups of organisms. Then we described the development of a quick genomic DNA preparation used in conjunction with the PCR procedure to directly detect O. piceae and O. quercus fungi in wood infected with known or unknown species.

DNA isolation, PCRs, cloning, and sequencing. A list of the isolates used in this work is given in Table 1. The fungi were pregrown on 2% malt extract agar (MEA) for 7 to 10 days at 20°C. Spore suspensions prepared from MEA cultures were spread onto sterile sheets of cellophane that were overlayered onto the MEA plates. After 2 days of incubation at 20°C, about 0.3 g of mycelium was harvested from the cellophane sheet by scraping the surface with a scalpel. The harvested mycelium was stored in a 2-ml sterile cryogenic vial (Sarstedt, Nümbrecht, Germany). Total genomic DNA from the mycelium was extracted by drilling twice (2 min each time) on ice with a stainless steel bit that fit the vial exactly. Prior to drilling, the mycelium was suspended into 200 µl of buffer (50 mM Tris-HCl [pH 8.5], 50 mM EDTA, and 3% sodium dodecyl sulfate). Then, 150 µl of 3 M sodium acetate (pH 5.2) was added to the ground mycelium. The mixture was kept at 20°C for 10 min and centrifuged for 10 min at 13,800 × g. The supernatant was removed, mixed with an equal volume of isopropanol, incubated for 5 min at room temperature, and centrifuged again. The DNA pellet was washed with 70% ethanol, dissolved in TE buffer (10 mM Tris [pH 8.0], 1 mM EDTA), and used for PCR amplification.

Developing PCR primer pairs specific for O. piceae and O. quercus. To generate specific primer pairs, it was necessary to sequence the internal transcribed spacer (ITS) region of several strains. First, we used the universal primer pair ITS1 and ITS4 (12) to amplify the ITS and the 5.8S ribosomal DNA regions of O. piceae (isolates H2154, H2009, and AU100-1) and O. quercus (isolates AU13, AU160-9, and H920). The 650-bp DNA fragments were amplified (Fig. 1), subcloned, and sequenced. The identity of the DNA fragments sequenced as ITS1-5.8S-ITS2 regions of rDNA was confirmed by high sequence homology (95%) with other ITS regions of different Ophiostoma species. After comparison of these sequences with ITS region sequences of other Ophiostoma-related species, we designed an O. piceae-specific primer pair, OPC1 (5' AGGGATCATTAGCGAGTTTTCAAC 3') and OPC2 (5' CCTCGAGAGGGTCGCCTGCG 3'), and an O. quercus-specific primer pair, OPH1 (5' AGGGATCATTACAGAGTTTTTAAC 3') and OPH2 (5' TCTGCAAGCAGAGCCTCCTG 3'). The primers OPC1 and OPH1 were located on the regions between the 3' end of the 18S and the 5' end of ITS1, while the primers OPC2 and OPH2 were located close to the 3' end of the ITS2 region. The two ITS-derived primer pairs targeted O. piceae and O. quercus DNA (Fig. 1). The amplified bands corresponded to the expected size of 560 bp, calculated from the DNA sequence information. The identity of the amplified DNA bands as ITS fragments was confirmed by Southern hybridization with the [-³²P]ATP-labeled ITS1-5.8S-ITS2 insert DNA (650 bp) subcloned in pCR 2.1-TOPO vector used as a probe (data not shown). The presence and absence of bands matched with the intended specificity of the primer pairs.

View larger version (38K): [in this window] [in a new window]   FIG. 1.   Gel electrophoresis of PCR products from O. piceae (lanes 1, 3, and 5) and O. quercus (lanes 2, 4, and 6) with primer pairs ITS1-ITS4, OPC1-OPC2, and OPH1-OPH2. Lane M, 1-kb ladder (Gibco BRL).

Detecting O. piceae and O. quercus directly in wood samples. To develop an efficient and rapid detection system, it is desirable to directly extract fungal DNA from infected samples and to minimize the time required for DNA extraction. Consequently, we assessed the feasibility of using a microwave to extract DNA directly from spores or mycelium produced on artificial media and wood. In this preliminary experiment, only O. quercus (AU13) was used. The organism was grown on MEA for 10 days. About 0.2 µl of the spore mass was taken from the top of synnemata with the tip of a pipetman and transferred into 0.5-ml microcentrifuge tubes. The tubes were capped and heated in a microwave for 5 min at 700 W. To each tube, 30 µl of ice-cold TE buffer was added. The tubes were then vortexed for 1 min and centrifuged at 13,800 × g for 1 min at 4°C. Without additional extraction steps, the supernatant (5 or 10 µl) was used directly for PCRs with the OPH1-OPH2 primer pair. The PCR produced the ITS rDNA fragment as shown in lane 6 of Fig. 1. We found that culture age affected the band intensity of the PCR products and that DNA prepared from a younger culture produced a stronger band (Fig. 2A). In this set of preliminary experiments, we also assessed the effects of various microwave heating times (30, 60, 180, 240, and 300 s). Usually, heating the sample in the microwave for 60 s was enough to extract and amplify the DNA. However, a heating time of 300 s gave more consistent results and thus was used in all of our experiments. Using this DNA extracting method, we were able to repeatedly amplify the O. quercus ITS rDNA from a spore mass at the tip of a single synnema. The minimum number of spores needed for PCR amplification by this method was 10².

View larger version (27K): [in this window] [in a new window]   FIG. 2.   Gel electrophoresis of PCR products obtained with template DNAs prepared by a microwave heating method. (A) PCRs with primers OPH1-OPH2 and template DNAs from O. quercus at different culture ages (in days): lane 1, 6; lane 2, 12; and lane 3, 18. (B) PCRs with primers NL1-NL2 and template DNAs from different species. Lanes: 1, O. canum; 2, O. flexuosum; 3, O. ips; 4, O. minus; 5, O. piceaperdum; 6, O. piliferum; 7, species C; 8, species D; 9, species E; M, 1-kb ladder (Gibco BRL).

View larger version (32K): [in this window] [in a new window]   FIG. 3.   Examples of direct detection of O. piceae by PCR amplification of ITS rDNA with primers OPC1-OPC2 in stained wood. Lanes 1 to 8, randomly selected, unidentified spore samples collected from a sawmill; lane M, 1-kb ladder (Gibco BRL).

Conclusions. We have developed two ITS-derived primer pairs, OPC1-OPC2 and OPH1-OPH2, that were specific for and detected fungal species O. piceae and O. quercus, respectively, not only in artificial media but also on stained wood. The method described in this study has a number of advantages. First, this method does not necessitate the growth of organisms in artificial media, thus saving considerable time and money. Second, the simple and rapid DNA extraction method eliminates the tedious steps of freezing and grinding the mycelium, treating extracts with RNase and phenol, and precipitating the DNA with ethanol. Third, the possible cross-contamination of isolates during the sampling procedure is less likely when species-specific primers are used. Our only limitation at present is the lack of specific primers for the remaining species. We look forward to the widespread use of our on-site detection approach in the forest industry when more specific primers become available.

Nucleotide sequence accession numbers. The sequences of the ITS regions obtained in this study have been submitted to the GenBank database under accession no. AF081129, AF081130, and AF081131 for O. piceae AU100-1, H2009, and H2154, respectively, and AF081132, AF081133, and AF081134 for O. quercus AU160-9, AU13, and H920, respectively.