Previous Article | Next Article 
Applied and Environmental Microbiology, January 1999, p. 351-354, Vol. 65, No. 1
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Persistence of Colonization of Human Colonic
Mucosa by a Probiotic Strain, Lactobacillus rhamnosus
GG, after Oral Consumption
Minna
Alander,1
Reetta
Satokari,1
Riitta
Korpela,2
Maija
Saxelin,2
Terttu
Vilpponen-Salmela,3
Tiina
Mattila-Sandholm,1 and
Atte
von
Wright1,*
VTT Biotechnology and Food Research,
FIN-02044 VTT,1
Valio Ltd. Research and
Development Centre, FIN-00101 Helsinki,2 and
Harjula Hospital, FIN-70101 Kuopio,3
Finland
Received 8 June 1998/Accepted 30 September 1998
 |
ABSTRACT |
Lactobacillus rhamnosus GG is one of the most
thoroughly studied probiotic strains. Its advantages in the treatment
of gastrointestinal disorders are well documented. The aim of the
present study was to demonstrate with colonic biopsies the attachment
of strain GG to human intestinal mucosae and the persistence of the
attachment after discontinuation of GG administration. A whey drink
fermented with strain GG was fed to human volunteers for 12 days. Fecal samples were collected before, during, and after consumption. L. rhamnosus GG-like colonies were detected in both fecal and colonic biopsy samples. Strain GG was identified by its characteristic colony morphology, a lactose fermentation test, and PCR. This study
showed that strain GG was able to attach in vivo to colonic mucosae
and, although the attachment was temporary, to remain for more than a
week after discontinuation of GG administration. The results
demonstrate that the study of fecal samples alone is not sufficient in
evaluating colonization by a probiotic strain.
| |
TEXT |
Oral consumption of health-promoting
lactic acid bacteria or probiotics has been associated with the
prevention, alleviation, or cure of diverse intestinal disorders such
as lactose intolerance, viral and bacterial diarrhea, adverse effects
of abdominal radiotherapy, constipation, inflammatory bowel disease,
and food allergy (3, 5, 11). Much of the early evidence on
the actual health effects of probiotics was anecdotal, but during the
last few years data based on rigorous clinical studies indicating real
health-promoting properties of certain well-characterized strains have
started to accumulate (8).
Adhesion to the intestinal epithelium is one of the selection criteria
for new probiotic strains (6). The adhesion properties have
generally been deduced from in vitro experiments with intestinal cell
lines, although, for example, rectal mucosal samples have been
successfully used to demonstrate intestinal colonization by
lactobacillar strains (7).
Lactobacillus rhamnosus GG (ATCC 53103) (previously known as
Lactobacillus casei GG) is one of the most thoroughly
studied probiotics (11). The reviewed beneficial effects
(9, 12, 13) include prevention of antibiotic-associated
diarrhea, treatment and prevention of rotavirus diarrhea, treatment of
relapsing Clostridium difficile diarrhea, prevention of
acute diarrhea, and enhancement of intestinal immunity. The ability of
strain GG to survive passage through the gastrointestinal tract has
been demonstrated in both adults and children by the use of fecal
samples (4, 10, 14). Recently, adhesion of the strain to
human colonic mucosae has been demonstrated with colonic biopsy samples
(1). The aims of the present study were to confirm with
colonic biopsy samples the attachment of L. rhamnosus GG
to human intestinal mucosae and to evaluate the persistence of this
attachment after discontinuation of strain GG administration.
Volunteers and L. rhamnosus GG administration.
The
three experimental groups in this study each consisted of six to eight
adults undergoing routine diagnostic colonoscopy. The experimental
protocol was designed to fit within the normal diagnostic schedule of
the volunteers. Informed consent from all subjects was obtained before
the experiment. With the exception of various gastric symptoms, all
subjects considered themselves healthy. No antibiotic therapy was
applied either during the trial or during the month immediately
preceding the administration period. The volunteers had no immediate
past history of consuming L. rhamnosus GG-containing
products. For this study they took 100 ml of a commercial drink based
on lactose-hydrolyzed whey fermented with strain GG and flavored with a
peach-apricot concentrate (Gefilus; Valio Ltd., Kouvola Dairy, Kouvola,
Finland) twice daily for 12 days. The daily dose of strain GG was
approximately 6 × 1010 CFU. After administration of
strain GG, the volunteers were divided into three groups (see Fig. 1):
those having undergone colonoscopy immediately after the 12-day GG
administration period (one male, five females, 34 to 78 years old),
those having undergone colonoscopy 1 week after stopping GG
administration (five males, three females, 42 to 68 years old), and
those having undergone colonoscopy 2 weeks after stopping GG
administration (four males, three females, 27 to 73 years old).
Colonoscopy and biopsies.
In preparation for colonoscopy,
evacuation of the colon was induced by three doses of a laxative
(Pico-salax; Malmö, Sweden) consumed within 36 h. The
instrument used for colonoscopy and sampling of biopsies was a Pentax
ES-3801L (Tokyo, Japan). The diameter of the biopsies was approximately
3 mm. Three parallel biopsies were taken from the descending colon.
This location was selected on the basis of previous results
(1) showing preferential adhesion of L. rhamnosus
GG to this part of the large intestine.
Cultivation of L. rhamnosus GG from fecal and biopsy
samples.
Fecal samples were collected as indicated in Fig. 1. The
samples were immediately stored at about 
20°C in the home freezers of the patients (for up to 3 weeks) and afterwards at 20°C in the
laboratory until analysis (within 9 weeks after collection). Biopsy
samples from the descending colon were immediately transferred into a
thioglycolate medium (Difco, Detroit, Mich.) and stored at 4°C until
analysis (within a day). The samples were homogenized for 30 s in
a stomacher (Stomacher 400; Seward, London, United Kingdom) before
dilution and cultivation on MRS agar (Merck, Darmstadt, Germany). The
plates were incubated under anaerobic conditions (Anaerocult A; Merck)
for 3 days at 37°C.
L. rhamnosus GG forms large, creamy, white colonies on MRS
agar that are generally distinct from other lactic acid bacterial colonies. Strain GG is further distinguished from most other lactic acid bacteria by its inability to efficiently ferment lactose (4), which was tested by selecting one to four typical
GG-like colonies from each fecal and biopsy sample and further
cultivating them for 48 h in lactose MRS broth with indicator dye
(bromocresol purple, 0.04 g/liter). One or two lactose-negative
isolates per sample were further confirmed as L. rhamnosus
by species-specific PCR.
PCR confirmation of L. rhamnosus isolates.
Bacterial cells were collected from 1 ml of an overnight culture by
centrifugation, washed with 50 mM Tris buffer (pH 8.0), and suspended
in 100 µl of 50 mM Tris-EDTA buffer (pH 8.0). Lysozyme (100 µl, 20 mg/ml) (Sigma, St. Louis, Mo.) and mutanolysin (8 µl, 0.5 mg/ml)
(Sigma) were added, and the mixture was incubated at 37°C for 1 h. The cells were lysed by addition of 20 µl of 20% sodium dodecyl
sulfate and 12 µl of proteinase K solution (14.6 mg/ml) (Boehringer,
Mannheim, Germany) followed by a 10-min incubation at 65°C. The
volume was adjusted to 500 µl with sterile ultrapure water.
Deproteinization was done by extraction with 1 volume of Tris-saturated
phenol (Amresco, Solon, Ohio). The water phase was extracted once more
with phenol-chloroform (1:1). Finally, DNA was precipitated by adding
0.1 volume of 3 M sodium acetate to the water phase followed by 2 volumes of 94% ethanol and incubating the mixture in an ice bath for
30 min. The DNA was collected by centrifugation at 13,000 rpm for 15 min, and the pellet was washed with 70% ethanol and finally dissolved
in 20 µl of sterile ultrapure water.
The universal 16S rRNA gene forward and reverse primers (5' to 3') were
AGAGTTTGATCCTGGCTCAGG and ACGGCAACCTTGTTACGAGTT,
respectively. The species-specific primers
(CTTGCATCTTGATTTAATTTTG, forward; CCGTCAATTCCTTTGAGTTT,
reverse) were designed on the basis of the L. rhamnosus (previously L. casei subsp.
rhamnosus) 16S ribosomal DNA sequence (GenBank accession no.
M58815) specifying the 863-bp fragment between positions 91 and 953 in
the gene. The primers were made with a PCR Mate EP 391 DNA synthesizer,
model 391 (Applied Biosystems, Foster City, Calif.), according to the manufacturer's instructions.
Taq DNA polymerase and PCR buffer (final concentrations of
10 mM Tris-HCl, 1.5 mM MgCl
2 and 50 mM KCl [pH 8.3]) were
obtained
from Boehringer, and the deoxynucleotides were purchased from
Sigma. The primer concentrations were 0.5 µM with specific primers
and 0.25 µM with universal primers, and those of the deoxynucleotides
were 200 µM. The amount of template was 1 µl of the DNA extracted
from fecal isolates or 1 µl of an appropriate dilution of the
DNA
extracted from pure cultures. The amount of
Taq DNA
polymerase
used was 2.0 U in a total reaction volume of 100 µl. A
Gene Amp
PCR System 9600 apparatus (Perkin-Elmer Cetus, Norwalk, Conn.)
was used for PCR cycling. Initial denaturation was carried out
at
94°C for 5 min followed by a touch-down thermocycling program
with 30 amplification cycles (annealing for 30 s at 62°C in cycles
1 to
10, at 60°C in cycles 11 to 20, and at 58°C in cycles 21
to 30, with extension for 1 min at 72°C and denaturation for 40
s at
94°C) and a final extension for 10 min at 72°C. Reaction
mixtures
were subsequently cooled to 4°C. In the PCR with universal
primers,
the annealing temperature was 55°C.
The specificity of the
L. rhamnosus primers was confirmed
with 8 different
L. rhamnosus strains and 17 other
lactobacillar
species or strains as references (data not shown). To
exclude
the possibility of DNA extraction failure or the presence
of inhibitors
in samples, reference strains were subjected to PCR with
universal
primers prior to PCR with specific
primers.
L. rhamnosus GG-like colonies in biopsy and fecal
samples of different test groups.
The counts of total fecal lactic
acid bacteria and strain GG-like colonies in the three experimental
groups are presented in Fig. 1. The
results of PCR (Fig. 2) were in good
agreement (88%) with screening based on colony morphology and the
lactose fermentation test, confirming the general reliability of
identification of the strain. The counts of strain GG-like colonies
decreased as a function of time after discontinuation of GG
administration. Strain GG was detected in biopsy specimens and final
fecal samples of all volunteers in group A (Table
1). The counts of lactic acid bacteria in
biopsy samples were 3 × 102 to 4 × 104 CFU per biopsy (mean, 6 × 103 CFU per
biopsy). The corresponding counts of strain GG-like colonies were
6 × 101 to 4 × 104 CFU per biopsy.
View larger version (15K):
[in this window]
[in a new window]
|
FIG. 1.
Fecal counts of lactic acid bacteria ( ) and L. rhamnosus GG-like colonies ( ). The solid line shows the mean
counts of lactic acid bacteria, and the dashed line shows the mean
counts of strain GG. In this context, lactic acid bacteria are defined
as colonies growing on MRS agar without further taxonomic
characterization, with the exception of GG-like colonies. The end of
L. rhamnosus GG administration is marked by a vertical arrow
below the horizontal axis.
|
|
View larger version (46K):
[in this window]
[in a new window]
|
FIG. 2.
Detection of L. rhamnosus by PCR coupled with
gel electrophoresis. Lanes: 1, molecular weight marker; 2 through 19, strain GG-like findings from fecal samples; 20, positive control
(L. rhamnosus GG VTT E-96666); 21, control reaction with no
template DNA.
|
|
In group B,
L. rhamnosus GG-like colonies were detected in
seven of eight biopsy samples (Tables
1 and
2), with counts varying
between 2 × 10
3 and 1 × 10
6 CFU per biopsy. The total
counts of lactic acid bacteria were
3 × 10
3 to 2 × 10
6 CFU per biopsy (mean, 1 × 10
5 CFU
per biopsy). Only two of the eight subjects, however, had
strain
GG-like colonies at detectable levels in the final fecal
samples; these
counts were 6 × 10
3 and 5 × 10
5
CFU/g (wet weight). The individual counts of GG-like colonies
in the
biopsies and final fecal samples of the group B volunteers
are
presented in Table
2.
None of the seven subjects in group C had strain GG-like colonies in
the final fecal samples (Table
1). However, GG-like
colonies were
detected in the biopsy samples of two of the seven
volunteers at counts
of 1 × 10
2 and 1 × 10
4 CFU per
biopsy. The total counts of lactic acid bacteria in biopsies
of group C
were 6 × 10
2 to 2 × 10
5 CFU per
biopsy (mean, 2 × 10
4 CFU per
biopsy).
L. rhamnosus GG has been shown to adhere in vitro to the
Caco-2 intestinal cell line (
2) and in vivo to human colonic
mucosae
(
1). The finding reported here that strain GG can
persist in
colonic mucosae even after its disappearance from fecal
samples
may have significance in the elucidation of the colonization
mechanisms
of probiotic strains. The fact that the strain GG counts
observed
in the biopsy samples from group B are rather similar to those
obtained from group A is particularly interesting, since it indicates
that GG can survive in high numbers in colonic mucosae despite
its
rapid turnover. This finding suggests that
L. rhamnosus GG
can multiply on the colonic surface at a rate that partially
counterbalances
its shedding. However, as can be seen from the results
from group
C, even an adherent strain can be gradually diluted out of
the
colon unless it is replenished with a fresh inoculum. The high
counts of endogenous lactic acid bacteria associated with colonic
biopsies mean that the probiotic strain faces strong competition
when
establishing itself. This may well be one of the reasons
that permanent
colonization by a probiotic strain seldom, if ever,
occurs.
The present study confirms that
L. rhamnosus GG is able to
attach in vivo to colonic mucosae and to persist there for prolonged
periods after discontinuation of administration of strain GG.
In
accounting for the findings reported here, the study of fecal
samples
alone may underestimate colonization by probiotic
strains.
| |
ACKNOWLEDGMENTS |
This work was conducted as a part of the FAIR PROBDEMO CT96-1028
project. Support from the Ministry of Agriculture and Forestry of
Finland is gratefully acknowledged.
We thank Sherwood Gorbach for commenting on the manuscript and Helena
Toivanen, Marja-Liisa Jalovaara, Anu Miettinen, Marja-Leena Kekäläinen, and Saara Tirkkonen for technical assistance.
| |
FOOTNOTES |
*
Corresponding author. Present address: University of
Kuopio, Department of Biochemistry and Biotechnology, P.O. Box 1627, FIN-70211 Kuopio, Finland. Phone: 358 17 162087. Fax: 358 17 2811510. E-mail: Atte.vonWright{at}uku.fi.
| |
REFERENCES |
| 1.
|
Alander, M.,
R. Korpela,
M. Saxelin,
T. Vilpponen-Salmela,
T. Mattila-Sandholm, and A. von Wright.
1997.
Recovery of Lactobacillus rhamnosus GG from human colonic biopsies.
Lett. Appl. Microbiol.
24:361-364[Medline].
|
| 2.
|
Elo, S.,
M. Saxelin, and S. Salminen.
1991.
Attachment of Lactobacillus casei strain GG to human colon carcinoma cell line Caco-2: comparison with other dairy strains.
Lett. Appl. Microbiol.
13:154-156.
|
| 3.
|
Gilliland, S. E.
1990.
Health and nutritional benefits from lactic acid bacteria.
FEMS Microbiol. Rev.
87:175-188.
|
| 4.
|
Goldin, B. R.,
S. L. Gorbach,
M. Saxelin,
S. Barakat,
L. Gualtieri, and S. Salminen.
1992.
Survival of Lactobacillus species (strain GG) in human gastrointestinal tract.
Dig. Dis. Sci.
37:121-128[Medline].
|
| 5.
|
Hammes, W. P., and P. S. Tichaczek.
1994.
The potential of lactic acid bacteria for the production of safe and wholesome food.
Z. Lebensm.-Unters. -Forsch.
198:193-201.
|
| 6.
|
Huis In't Veld, J. H. J., and C. Shortt.
1996.
Selection criteria for probiotic microorganisms.
R. Soc. Med. Int. Congr. Symp. Ser.
219:27-36.
|
| 7.
|
Johansson, M.-L.,
G. Molin,
B. Jeppsson,
S. Nobaek,
S. Ahrné, and S. Bengmark.
1993.
Administration of different Lactobacillus strains in fermented oatmeal soup: in vivo colonization of human intestinal mucosa and effect on the indigenous flora.
Appl. Environ. Microbiol.
59:15-20[Abstract/Free Full Text].
|
| 8.
|
Lee, Y. K., and S. Salminen.
1995.
The coming age of probiotics.
Trends Food Sci. Technol.
6:241-245.
|
| 9.
|
Majamaa, H., and E. Isolauri.
1997.
Probiotics: a novel approach in the management of food allergy.
J. Allergy Clin. Immunol.
99:179-185[Medline].
|
| 10.
|
Millar, M. R.,
C. Bacon,
S. L. Smith,
V. Walker, and M. A. Hall.
1993.
Enteral feeding of premature infants with Lactobacillus GG.
Arch. Dis. Child.
69:483-487[Abstract/Free Full Text].
|
| 11.
|
Salminen, S.,
M. Deighton,
Y. Benno, and S. Gorbach.
1998.
Lactic acid bacteria in health and disease, p. 211-253.
In
S. Salminen, and A. von Wright (ed.), Lactic acid bacteria. Microbiology and functional aspects. Marcel Dekker, New York, N.Y.
|
| 12.
|
Salminen, S.,
E. Isolauri, and E. Salminen.
1996.
Clinical uses of probiotics for stabilizing the gut mucosal barrier: successful strains and future challenges.
Antonie Leeuwenhoek J. Microbiol.
70:347-358.
|
| 13.
|
Saxelin, M.
1997.
Lactobacillus GG a human probiotic strain with thorough clinical documentation.
Food Rev. Int.
13:293-313.
|
| 14.
|
Saxelin, M.,
M. Ahokas, and S. Salminen.
1993.
Dose response on the faecal colonisation of Lactobacillus strain GG administered in two different formulations.
Microb. Ecol. Health Dis.
6:119-122.
|
Applied and Environmental Microbiology, January 1999, p. 351-354, Vol. 65, No. 1
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Dommels, Y. E. M., Kemperman, R. A., Zebregs, Y. E. M. P., Draaisma, R. B., Jol, A., Wolvers, D. A. W., Vaughan, E. E., Albers, R.
(2009). Survival of Lactobacillus reuteri DSM 17938 and Lactobacillus rhamnosus GG in the Human Gastrointestinal Tract with Daily Consumption of a Low-Fat Probiotic Spread. Appl. Environ. Microbiol.
75: 6198-6204
[Abstract]
[Full Text]
-
Tsai, Y.-K., Chen, H.-W., Lo, T.-C., Lin, T.-H.
(2009). Specific point mutations in Lactobacillus casei ATCC 27139 cause a phenotype switch from Lac- to Lac+. Microbiology
155: 751-760
[Abstract]
[Full Text]
-
Lebeer, S., Claes, I. J. J., Verhoeven, T. L. A., Shen, C., Lambrichts, I., Ceuppens, J. L., Vanderleyden, J., De Keersmaecker, S. C. J.
(2008). Impact of luxS and Suppressor Mutations on the Gastrointestinal Transit of Lactobacillus rhamnosus GG. Appl. Environ. Microbiol.
74: 4711-4718
[Abstract]
[Full Text]
-
Farnworth, E. R.
(2008). The Evidence to Support Health Claims for Probiotics. J. Nutr.
138: 1250S-1254S
[Abstract]
[Full Text]
-
Guglielmetti, S., De Noni, I., Caracciolo, F., Molinari, F., Parini, C., Mora, D.
(2008). Bacterial Cinnamoyl Esterase Activity Screening for the Production of a Novel Functional Food Product. Appl. Environ. Microbiol.
74: 1284-1288
[Abstract]
[Full Text]
-
Lebeer, S., Verhoeven, T. L. A., Perea Velez, M., Vanderleyden, J., De Keersmaecker, S. C. J.
(2007). Impact of Environmental and Genetic Factors on Biofilm Formation by the Probiotic Strain Lactobacillus rhamnosus GG. Appl. Environ. Microbiol.
73: 6768-6775
[Abstract]
[Full Text]
-
Xu, Y., Li, Y.
(2007). Induction of Immune Responses in Mice after Intragastric Administration of Lactobacillus casei Producing Porcine Parvovirus VP2 Protein. Appl. Environ. Microbiol.
73: 7041-7047
[Abstract]
[Full Text]
-
Galdeano, C. M., de Moreno de LeBlanc, A., Vinderola, G., Bonet, M. E. B., Perdigon, G.
(2007). Proposed Model: Mechanisms of Immunomodulation Induced by Probiotic Bacteria. CVI
14: 485-492
[Full Text]
-
Oozeer, R., Leplingard, A., Mater, D. D. G., Mogenet, A., Michelin, R., Seksek, I., Marteau, P., Dore, J., Bresson, J.-L., Corthier, G.
(2006). Survival of Lactobacillus casei in the Human Digestive Tract after Consumption of Fermented Milk. Appl. Environ. Microbiol.
72: 5615-5617
[Abstract]
[Full Text]
-
Boyle, R. J, Robins-Browne, R. M, Tang, M. L.
(2006). Probiotic use in clinical practice: what are the risks?. Am. J. Clin. Nutr.
83: 1256-1264
[Abstract]
[Full Text]
-
Teo, A. Y.-L., Tan, H.-M.
(2005). Inhibition of Clostridium perfringens by a Novel Strain of Bacillus subtilis Isolated from the Gastrointestinal Tracts of Healthy Chickens. Appl. Environ. Microbiol.
71: 4185-4190
[Abstract]
[Full Text]
-
Lavermicocca, P., Valerio, F., Lonigro, S. L., De Angelis, M., Morelli, L., Callegari, M. L., Rizzello, C. G., Visconti, A.
(2005). Study of Adhesion and Survival of Lactobacilli and Bifidobacteria on Table Olives with the Aim of Formulating a New Probiotic Food. Appl. Environ. Microbiol.
71: 4233-4240
[Abstract]
[Full Text]
-
Salminen, S. J., Gueimonde, M., Isolauri, E.
(2005). Probiotics That Modify Disease Risk. J. Nutr.
135: 1294-1298
[Abstract]
[Full Text]
-
Suokko, A., Savijoki, K., Malinen, E., Palva, A., Varmanen, P.
(2005). Characterization of a Mobile clpL Gene from Lactobacillus rhamnosus. Appl. Environ. Microbiol.
71: 2061-2069
[Abstract]
[Full Text]
-
Dickson, E M, Riggio, M P, Macpherson, L
(2005). A novel species-specific PCR assay for identifying Lactobacillus fermentum. J Med Microbiol
54: 299-303
[Abstract]
[Full Text]
-
Baharav, E., Mor, F., Halpern, M., Weinberger, A.
(2004). Lactobacillus GG Bacteria Ameliorate Arthritis in Lewis Rats. J. Nutr.
134: 1964-1969
[Abstract]
[Full Text]
-
Tannock, G. W.
(2004). A Special Fondness for Lactobacilli. Appl. Environ. Microbiol.
70: 3189-3194
[Full Text]
-
Drakes, M., Blanchard, T., Czinn, S.
(2004). Bacterial Probiotic Modulation of Dendritic Cells. Infect. Immun.
72: 3299-3309
[Abstract]
[Full Text]
-
Lee, Y. K., Ho, P. S., Low, C. S., Arvilommi, H., Salminen, S.
(2004). Permanent Colonization by Lactobacillus casei Is Hindered by the Low Rate of Cell Division in Mouse Gut. Appl. Environ. Microbiol.
70: 670-674
[Abstract]
[Full Text]
-
De Champs, C., Maroncle, N., Balestrino, D., Rich, C., Forestier, C.
(2003). Persistence of Colonization of Intestinal Mucosa by a Probiotic Strain, Lactobacillus casei subsp. rhamnosus Lcr35, after Oral Consumption. J. Clin. Microbiol.
41: 1270-1273
[Abstract]
[Full Text]
-
Zoetendal, E. G., von Wright, A., Vilpponen-Salmela, T., Ben-Amor, K., Akkermans, A. D. L., de Vos, W. M.
(2002). Mucosa-Associated Bacteria in the Human Gastrointestinal Tract Are Uniformly Distributed along the Colon and Differ from the Community Recovered from Feces. Appl. Environ. Microbiol.
68: 3401-3407
[Abstract]
[Full Text]
-
Nakayama, J., Kariyama, R., Kumon, H.
(2002). Description of a 23.9-Kilobase Chromosomal Deletion Containing a Region Encoding fsr Genes Which Mainly Determines the Gelatinase-Negative Phenotype of Clinical Isolates of Enterococcus faecalis in Urine. Appl. Environ. Microbiol.
68: 3152-3155
[Abstract]
[Full Text]
-
Moser, S. A., Savage, D. C.
(2001). Bile Salt Hydrolase Activity and Resistance to Toxicity of Conjugated Bile Salts Are Unrelated Properties in Lactobacilli. Appl. Environ. Microbiol.
67: 3476-3480
[Abstract]
[Full Text]
-
Vanderhoof, J. A
(2001). Probiotics: future directions. Am. J. Clin. Nutr.
73
: 1152S-1155S
[Abstract]
[Full Text]
-
Satokari, R. M., Vaughan, E. E., Akkermans, A. D. L., Saarela, M., de Vos, W. M.
(2001). Bifidobacterial Diversity in Human Feces Detected by Genus-Specific PCR and Denaturing Gradient Gel Electrophoresis. Appl. Environ. Microbiol.
67: 504-513
[Abstract]
[Full Text]
-
Jacobsen, C. N., Rosenfeldt Nielsen, V., Hayford, A. E., Møller, P. L., Michaelsen, K. F., Pærregaard, A., Sandström, B., Tvede, M., Jakobsen, M.
(1999). Screening of Probiotic Activities of Forty-Seven Strains of Lactobacillus spp. by In Vitro Techniques and Evaluation of the Colonization Ability of Five Selected Strains in Humans. Appl. Environ. Microbiol.
65: 4949-4956
[Abstract]
[Full Text]
-
Tynkkynen, S., Satokari, R., Saarela, M., Mattila-Sandholm, T., Saxelin, M.
(1999). Comparison of Ribotyping, Randomly Amplified Polymorphic DNA Analysis, and Pulsed-Field Gel Electrophoresis in Typing of Lactobacillus rhamnosus and L. casei Strains. Appl. Environ. Microbiol.
65: 3908-3914
[Abstract]
[Full Text]
Top
Abstract
Text
