Previous Article | Next Article 
Applied and Environmental Microbiology, October 1999, p. 4357-4362, Vol. 65, No. 10
0099-2240/99/$04.00+0
Biodegradation of Pentachlorophenol in a Continuous Anaerobic
Reactor Augmented with Desulfitobacterium frappieri
PCP-1
B.
Tartakovsky,1
M.-J.
Levesque,1
R.
Dumortier,1
R.
Beaudet,2 and
S.
R.
Guiot1,*
Biotechnology Research Institute, NRC,
Montreal, Quebec, Canada H4P 2A2,1 and
Institut Armand-Frappier, INRS, Laval, Quebec, Canada H7N
4Z32
Received 3 May 1999/Accepted 21 July 1999
 |
ABSTRACT |
In this work, a strain of anaerobic pentachlorophenol (PCP)
degrader, Desulfitobacterium frappieri PCP-1, was used to
augment a mixed bacterial community of an anaerobic upflow sludge bed reactor degrading PCP. To estimate the efficiency of augmentation, the
population of PCP-1 in the reactor was enumerated by a competitive PCR
technique. The PCP-1 strain appeared to compete well with other
microorganisms of the mixed bacterial community, with its population
increasing from 106 to 1010 cells/g of volatile
suspended solids within a period of 70 days. Proliferation of strain
PCP-1 allowed for a substantial increase of the volumetric PCP load
from 5 to 80 mg/liter of reaction volume/day. A PCP removal efficiency
of 99% and a dechlorination efficiency of not less than 90.5% were
observed throughout the experiment, with 3-Cl-phenol and phenol being
observable dechlorination intermediates.
| |
INTRODUCTION |
Augmentation of natural bacterial
populations with highly efficient laboratory strains is attractive in
maximizing bioprocess performance. In a mixed bacterial community,
however, laboratory strains compete with indigenous species for common
substrates. This competition often results in a replacement of the
laboratory strain by wild-type populations more adapted to that
particular environment. The outcome of the competition problem could be
controlled, to a certain extent, by optimizing bioprocess parameters.
However, retention of the inoculated population is not guaranteed, and thorough monitoring is thus required to evaluate the bioaugmentation efficiency.
Anaerobic degradation of pentachlorophenol (PCP) is an example of a
process that may benefit from the addition of a laboratory strain. PCP
can be completely mineralized to methane and CO2 under anaerobic conditions in a sequential process of dechlorination and
mineralization by a mixed bacterial consortium (5, 13, 14).
First, PCP dehalogenation occurs, resulting in the appearance of
lightly chlorinated phenols and phenol. Next, the dechlorination products are mineralized by anaerobic bacteria. In this two-step biotransformation, the dechlorination step is rate limiting due to the
high toxicity of PCP (7). While a PCP-degrading consortium could be developed by species' adaptation to the presence of PCP, the
adaptation process is rather slow, requiring a long period of time to
achieve a high dechlorination rate (8, 19). Alternatively, an anaerobic consortium with high dechlorination activity could be
created by augmentation of the anaerobic consortium with a known strain
of efficient PCP dechlorinators (5).
In this work, a strain of anaerobic PCP degrader,
Desulfitobacterium frappieri PCP-1 (4), was used
to augment a mixed bacterial community in an anaerobic bioreactor. This
organism is a strictly anaerobic gram-positive bacterium isolated from
a methanogenic consortium-degrading PCP. It is the first known
anaerobic microorganism that can degrade PCP to 3-Cl-phenol (3-CP) via
the formation of 2,3,4,5- and 3,4,5-CPs (4). Although the
exact mechanism of PCP dechlorination by strain PCP-1 is not fully
understood, some microorganisms belonging to the genus
Desulfitobacterium were shown to be capable of
dechlorination by halorespiration (18). However, a
cometabolic dechlorination of PCP by strain PCP-1 is not excluded. In
addition to PCP, strain PCP-1 can dehalogenate at ortho,
meta, and para positions a large variety of
aromatic molecules with substituted hydroxyl or amino groups
(6). To estimate the efficiency of the augmentation, the
population of PCP-1 in the reactor was enumerated by using a
competitive PCR (cPCR) (3, 9).
| |
MATERIALS AND METHODS |
Chemicals and analytical methods.
Chemicals were obtained
from Sigma-Aldrich Canada (Oakville, Ontario, Canada). All chemicals
were of analytical grade.
Reactor off-gas composition (CH4 and CO2) was
determined by gas chromatography (Sigma 2000; Perkin-Elmer, Norwalk,
Conn.) equipped with a flame ionization detector. Details of the method are provided elsewhere (15). The inorganic chloride content was determined by using the colorimetric mercuric thiocyanate method
(1).
Concentrations of PCP and its metabolites were determined by
high-performance liquid chromatography. Samples (10 ml) were
mixed with
5 ml of acetonitrile, centrifuged for 10 min at 30,000
×
g, and then filtered through a 0.45-µm-pore-diameter Millipore
(Mississauga, Ontario, Canada) filter. A Spectra-Physics (San
Jose, Calif.) system was used for PCP quantification. Other details
of
the method can be found elsewhere (
2).
Microorganisms.
D. frappieri PCP-1 (ATCC 700397) was
grown under anaerobic conditions at 37°C in a mineral salts medium
supplemented with 55 mM pyruvate and 0.1% yeast extract. Anaerobic
sludge (62 g of volatile suspended solids [VSS]/liter) was obtained
from an upflow anaerobic sludge bed (UASB) reactor treating wastewater from a food industry (Champlain Industries, Cornwall, Ontario, Canada).
DNA extraction from sludge and PCR.
One- to two-milliliter
sludge samples were centrifuged for 5 min at 10,000 × g. The pellet was resuspended in 700 µl of TEN (10 mM Tris-HCl
[pH 8.0], 1 mM EDTA, 100 mM NaCl), and DNAs were extracted with a
glass mill homogenizer according to a protocol described in reference
(10).
PCR amplifications were performed with 2 µl of sludge DNA in the
presence of oligonucleotides specific for PCP-1
PCP1G
(5'CGAACGGTCCAGGTGTCTA
3') and PCP3D
(5'ACTCCCATGTTTCCACAG 3')
as described by Levesque
et al.
(
10). Cycling parameters in Perkin-Elmer 2400 were an
initial denaturation for 4 min at 94°C; 30 to 35 cycles at 94°C
for
30 s, 55°C for 30 s, and 72°C for 30 s; and a final
extension
at 72°C for 7 min. Nested PCR was carried out by using 2 µl of
the first PCR and internal primers with the same conditions as
above.
cPCR.
The enumeration of strain PCP-1 cells by cPCR was
based on the procedure of (20) and described by Levesque et
al. (9). Briefly, PCR amplifications were performed on
serial dilutions of an internal standard mixed with a constant amount
of sludge DNA in the presence of the specific primers PCP1G and PCP4D
(5'AGGTACCGTCATGTAAGTAC3'). The internal standard was
composed of the same primer binding sites, size, and sequence as the
target DNA (16S rRNA gene), except that an EcoRV restriction
site was introduced by PCR-mediated site-directed mutagenesis. The
resulting PCR products were digested by EcoRV, fractionated
by 2% agarose gel electrophoresis, and colored with Vistra Green
(Molecular Dynamics, Sunnyvale, Calif.). The EcoRV
digestions of the amplified internal standard produced two DNA
fragments (408 and 136 bp), whereas the amplified target DNA remained
unchanged. Densitometric scanning of fluorescent DNA fragments was
performed with the Molecular FluorImager (Molecular Dynamics), and the
results were analyzed with ImageQuaNT software (Molecular Dynamics).
For each PCR amplification, the ratio between the fluorescent
intensities of the internal standard (408-bp DNA fragment) and those of
the target sludge DNA (544 bp) were plotted against the amount of added
internal standard. The point at which the ratio was equal to 1 was
taken as a measure of the amount of target sludge DNA molecules (PCP-1
ribosomal DNA [rDNA] gene copies) initially present in the PCR
mixture. Finally, the number of the PCP-1 cells in the sludge was
expressed in cells per gram of VSS.
Reactor setup and operation.
Experiments were performed in a
5-liter UASB reactor. A schematic of the reactor is given elsewhere
(7). To minimize adsorption of PCP and its metabolites, the
reactor was made of glass, and recirculation and feeding lines were
made of glass and lindone (Viton). The reactor was operated at a
temperature of 35°C and a residence time of 28 h. The pH
controller maintained the pH at 7.3 ± 0.1 by using a 20-g/liter
NaOH solution.
All influent solutions were pumped into the recirculating reactor
stream in different sidestreams. The dilution stream contained
a
bicarbonate buffer (NaHCO
3, 1.36 g/liter; KHCO
3
1.74 g/liter).
The PCP solution contained 2 g of PCP per liter
dissolved in 20
g of NaOH solution per liter. The solution of
nutrients contained
the following (in grams per liter): sucrose, 304;
butyric acid,
96; yeast extract, 7; ethanol (95%), 70;
KH
2PO
4, 6; K
2HPO
4, 7;
NH
4HCO
3, 68. The chloride-free trace metal
solution contained
the following (in grams per liter):
FeSO
4 · 7H
2O, 1.63;
H
3BO
3,
0.12; ZnSO
4 · 7H
2O, 0.42; CuSO
4, 0.14; MnSO
4
· H
2O, 1.3; CoSO
4 · 7H
2O,
0.52; NiSO
4 · 6H
2O, 0.24;
(NH
4)
6Mo
7O
24 · 4H
2O, 0.42; AlK(SO
4)
2 · 12H
2O, 0.05; Na
2-EDTA, 1.5;
MgSO
4 · 7H
2O 2.57;
Na
2SeO
4, 0.04;
Na
2WO
4,
70.08. The feeding rates of the nutrient and microelement
solutions
were 28 and 15 ml/day,
respectively.
The recirculating stream provided a linear upflow liquid velocity in
the reactor of 0.8 to 1 m/h. Simultaneously, the recirculating
stream
allowed for the dilution of the influent PCP solution to
avoid its
precipitation upon
injection.
| |
RESULTS |
Attachment tests.
Prior to reactor experiments, attachment of
strain PCP-1 to anaerobic granules was verified in batch tests. In
these tests, 180-ml serum bottles containing 20 ml of phosphate buffer
were inoculated with 5 ml of anaerobic sludge and spiked with serial dilutions of the PCP-1 culture. Thus, the initial concentration of
strain PCP-1 in the bottles varied from 104 to
107 cells/ml. The bottles were supplemented with PCP and
nutrients to obtain initial concentrations of 0.25 mg/liter and 800 mg
of chemical oxygen demand (COD)/liter, respectively. After a 7-day incubation at 30°C, sludge samples were withdrawn from the bottles and gently washed three times in a phosphate buffer to remove unattached cells of strain PCP-1. DNA was then extracted from the
samples, and PCR amplifications were carried out with 100-ng DNA
samples. The PCP-1 strain was considered to be present if a
PCP-1-specific 1,080-bp fragment was detected (10).
PCR signals were detected in the sludge samples inoculated with
10
6 and 10
7 cells/ml. To increase the
sensitivity, nested PCR was carried
out with the PCP2G-PCP4D primers.
This allowed for the detection
of the PCR signal in the sludge sample
inoculated with 10
5 cells/ml. However, no PCR signals were
detected in the sample
inoculated with 10
4 cells/ml and in
the noninoculated sludge samples. For comparison,
the sensitivity limit
of the nested PCR applied to soil samples
inoculated with strain PCP-1
was estimated to be 10
2 cells/g of soil (
10).
Reactor studies.
The persistence of strain PCP-1 within a
mixed bacterial community of an anaerobic reactor was studied in two
experimental runs. In the first run, a UASB reactor was inoculated with
0.5 liter of exponentially growing PCP-1 culture and 1.5 liter (39.2 g
of VSS) of anaerobic granular sludge; i.e., a high PCP-1/sludge ratio
was used. Consequently, an aggressive PCP feeding strategy was
attempted with a PCP load which increased exponentially by increments
of 25% every 6 h. In contrast, only 10 ml of pure culture per 1.5 liter of sludge was used to inoculate the reactor for the second run.
In this run, the PCP loading rate was related to methane production;
i.e., the toxicity of PCP towards the anaerobic consortium expressed as
a normalized methane yield would determine the PCP load.
In addition, PCP degradation by an indigenous bacterial population of
an anaerobic reactor was studied in a control run. In
this run, a PCP
feeding strategy similar to that of the bioaugmented
run 2 was applied,
but the reactor was not augmented with PCP-1.
A history plot of the first run is shown in Fig.
1. The reactor was started at a
volumetric PCP load of 2 mg/liter of reactor
volume
(L
R)/day. The feeding rate was then increased in increments
of 25% of its current value every 6 h, thus providing an
exponential
increase in the PCP load. On-line methane measurements
showed
almost constant methane production during the first 11 days of
the experiment. No PCP was observed in the effluent for the first
3 days, probably due to its initial adsorption onto biomass. As
the
sludge became saturated with PCP, its appearance was noted
in the
effluent. From day 4 to day 10, the effluent concentration
of PCP was
in a range of 0.05 to 0.15 mg/liter (Fig.
2a). Simultaneously,
peaks of phenol and
3-CP were detected (Fig.
2b). While the PCP
load was increasing
exponentially, the effluent concentration
of PCP remained constant, and
only a slight increase in the effluent
concentration of phenol (up to
3.5 mg/liter) was noted until day
11. The increase of 3-CP was more
pronounced, with its concentration
reaching 10 mg/liter (Fig.
2b) at a
PCP load of 45 mg/L
R/day.
At this time, intensive
dechlorination was confirmed by inorganic
chloride release estimated as
a difference between measured effluent
and influent chloride
concentrations, as shown in Fig
2a. At day
10, the chloride material
balance suggested an 86.6% dechlorination
of PCP. Indeed, effluent
3-CP (9 mg/liter) accounted for 18% of
the chloride content of the PCP
fed in the reactor.
PCP load continued to increase exponentially until it reached a value
of 45 mg/L
R/day. At this load, the bacterial population
of
the reactor was unable to keep pace with increasing amounts
of PCP and
its metabolites. Reactor upset was evidenced by a sharp
decline in the
normalized methane production which occurred between
days 11 and 12 (Fig.
1). Nevertheless, the PCP load continued
to increase
exponentially, and by day 17, it reached 70 mg/L
R/day.
Off-line analysis of the reactor effluent confirmed reactor overload,
because the PCP concentration in the effluent climbed to a value
of 80 mg/liter, while concentrations of phenol, 3-CP, and chloride
dropped to
almost zero, indicating the absence of biodegradation
(Fig.
2).
At day 17, the PCP load was decreased to its initial value of 2 mg/L
R/day to allow for reactor recovery. However, no
improvement
in the methane production was observed during the following
13
days of reactor operation (Fig.
1).
Throughout the experiment, sludge samples were withdrawn from the
reactor and the population of PCP-1 was enumerated by using
the cPCR
technique. The enumeration showed that the PCP-1 population
was almost
constant over the course of the experiment (Fig.
3).
Only a slight decrease in the cell
number after the reactor upset
was noted. This is contrary to the
observed drastic decrease in
the normalized methane production and the
reactor dechlorination
capacity. PCR analysis of the effluent showed
the presence of
strain PCP-1 for the first 5 days of reactor operation,
and then
the strain was not detected in the effluent, i.e., the cell
density
was below a detection limit of 10
5 as determined
throughout the attachment tests.
The results of the first run were considered in the second attempt to
establish an effective PCP-degrading consortium. In
this run, the PCP
load was related to the rate of methane production.
An increase in the
load was imposed only if no decline in methane
production was observed.
The load was unchanged or even decreased
if a decline in the methane
production was noted. At each time,
this feeding strategy ensured a
maximization of the feeding rate
while avoiding reactor overload.
Volumetric PCP load and normalized
methane yield during the second run
are shown in Fig.
4.
Due to a different PCP feeding pattern, a PCP load of 45 mg/L
R/day was reached later than in the first run, at day
47 (Fig.
4). A further increase in the load did not result in reactor
failure.
Figure
4 shows that the normalized methane production remained
steady over the course of the experiment. A steady state was reached
at
a PCP load of 80 mg/L
R/day. At this load, no further
increase
was allowed by the algorithm, indicating that a maximal
reactor
capacity had been
reached.
Analysis of the effluent composition showed a PCP concentration below
0.3 mg/liter throughout the experiment; i.e., the removal
efficiency
was at about 99% (Fig.
5a). Once more,
phenol and 3-CP
were the only observed intermediates. Traces of other
chlorophenols
were noted, but their concentrations were too low to be
quantified.
While phenol concentration remained below 0.5 mg/liter
during
the entire run, a distinct increase in the 3-CP concentration
was observed with increasing PCP load. At the highest PCP load,
27 to
30 mg of 3-CP per liter was observed in the effluent (Fig.
5b).
The chloride concentration in the effluent well corresponded with the
observed disappearance of PCP and production of 3-CP.
At steady state
(a PCP load of 80 mg/L
R/day), the dechlorination
efficiency
was 90.5%. Also, 3-CP accounted for 13.1% of chloride
fed in the
reactor as PCP. Thus, the PCP material balance was
completed with an
acceptable accuracy. The dechlorination rate,
estimated by using the
chloride release data, was 45.4 mg of Cl/L
R/day
(70 mg of
PCP/L
R/day) or 2.4 mg of Cl/g of VSS/day.
Strain PCP-1 enumeration by cPCR of the sludge samples suggested an
increase of at least 2 orders of magnitude during the
first week of
reactor operation (Fig.
3). After an initial fast
proliferation, the
growth rate slowed down. Nevertheless, the
cell number approached
10
10 to 10
11 cells/g
VSS by the end of
the run. For comparison, the highest
cell density observed in the first
run was 10
9 cells/g of VSS. Also, the 1,080-bp
PCP-1-specific fragment was
detected in the reactor effluent at day 60, suggesting intensive
growth of the strain in the reactor followed by a
washout of excessive
biomass.
At steady state (day 67), liquid samples were withdrawn from different
heights of the reactor to study a spatial distribution
of PCP and its
metabolites. A distinct vertical gradient of PCP
was observed (Fig.
6). In fact, 95% of PCP was
dechlorinated in
the first half of the sludge bed, suggesting a maximal
dechlorination
rate of 6.8 mg of PCP/g of VSS/day. No vertical
gradients for
3-CP and phenol were observed (Fig.
6).
In the control (nonbioaugmented) run, a constant yield of methane was
maintained up to a load of 15 mg of PCP/L
R/day (Fig.
7a). At this load, we observed a drastic
decline in the methane
production accompanied by an increase in the
effluent concentration
of CODs (data not shown). While the PCP load was
automatically
reduced as soon as the methane production declined, no
reactor
recovery was observed even 10 days later. Analysis of the
effluent
composition showed that a drop in the methane production
coincided
with the appearance of 3,4,5-CP (Fig.
7b). No
monochlorophenols
and phenol were detected in the effluent. Overall,
the highest
PCP load in this experiment comprised only 19% of the load
in
the second bioaugmented run.
View larger version (22K):
[in this window]
[in a new window]
|
FIG. 7.
PCP load and normalized methane production (a) and
effluent concentrations of PCP and dechlorination products (b) in
control run.
|
|
| |
DISCUSSION |
While bioaugmentation of natural bacterial communities in target
strains is an obvious method of bioprocess design, the retention of a
laboratory strain is not easy to achieve. In fact, disappearance of
introduced strains was observed as often as retention (5, 11,
12). Not only do indigenous species outcompete target strains,
they often demonstrate similar or even better performance, making the
use of laboratory strains unnecessary. However, the bioaugmentation
approach could be advantageous in certain situations, e.g., if a fast
start-up period and a protection from accidental spikes of the toxicant
are required.
Proliferation of strain PCP-1 in the reactor with a mixed bacterial
population is the first important result of this study. The strain
PCP-1 not only demonstrated effective attachment to anaerobic granules
in batch tests, but also successfully competed with the mixed bacterial
population of anaerobic sludge in a continuous reactor. Interestingly,
retention of the strain was not significantly affected by reactor
overload in run 1, while the dechlorination capacity declined. PCP-1 is
a spore-forming bacterium; it may revert to a protective form to escape
adverse or stressful conditions and thus be retained in the reactor.
Since the cPCR technique did not allow for the discrimination between
viable, nonviable, and sporulated cells, the fate of strain PCP-1 in
run 1 after the reactor overload could only be hypothesized.
Retention and proliferation of strain PCP-1 in the reactor could be
explained by its complementary role within the anaerobic consortium
exposed to PCP. Literature review (5) suggests the existence
of at least two dechlorination pathways. If PCP is initially dechlorinated at the meta position, the transformation
occurs via a 2,4,6-trichlorophenol
2,6-dichlorophenol4-CP route.
Initial para or ortho dechlorination results in
the formation of 3-CP via either 2,3,5- or 3,4,5-trichlorophenol. In an
indigenous PCP-degrading consortium, more than one bacterial strain is
required for this sequential biotransformation. Different bacterial
strains have different growth rates, and as a consequence, accumulation
of partially dechlorinated products is to be expected throughout the
adaptation period. Such an accumulation was observed in the control
run, in which the appearance of trichlorophenol (3,4,5-CP) was followed
by a reactor failure due to its high toxicity (5, 16).
Since strain PCP-1 is capable of dechlorination at the
ortho, meta, and para positions, its
presence in the reactor reduced the number of bacteria required for
successful dechlorination. Fewer members of the consortium were
required, thus eliminating rate-limiting steps in the dechlorination
process. Indeed, 3-CP which is a known product of PCP dechlorination by
strain PCP-1, was the only observable intermediate in the reactor
effluent during bioaugmented runs. Thus, the presence of strain PCP-1
minimized the PCP degradation pathway as well as the number of toxic
intermediates in the reactor. Consequently, methanogens and other
members of the anaerobic consortium were protected and allowed to
thrive in this less toxic environment.
In fact, a mutualistic consortium of PCP-1 and other anaerobic bacteria
was established in the reactor. A previous study demonstrated that
strain PCP-1 requires pyruvate as a carbon source (4). In
our reactor studies, this carbon source was provided by metabolism of
other members of the anaerobic consortium, while strain PCP-1 dechlorinated PCP to less toxic 3-CP. Thus, mutualistic ties were established between the introduced strain and indigenous bacteria. It
could be hypothesized that upon attachment to anaerobic granules, strain PCP-1 proliferated on the granular surface. Consequently, a
steep gradient of PCP within anaerobic granules was expected, thus
leaving the granular core PCP free and methanogenic bacteria protected
from the PCP toxicity. This hypothesis was confirmed by the presence of
strain PCP-1 in the reactor effluent during run 2. According to the
model of a layered anaerobic granular biofilm (17),
faster-growing species are located on the granule surface. These
species will be present in the detached biofilm particles as well.
The high initial concentration of strain PCP-1 in the reactor did not
guarantee successful performance of the entire consortium. In the first
bioaugmented run, the reactor was inoculated with strain PCP-1 at
2.7 × 109 cells/g of VSS. Yet, the process
failed at a PCP load of 45 mg/LR/day due to an exponential
increase in the PCP loading. Successful colonization of the granular
surface by PCP-1 starting from 5.7 × 106 cells/g
of VSS in the second run allowed methanogens in the granular core to
withstand a significantly higher PCP load.
Efficient functioning of the entire bacterial community was required to
achieve PCP mineralization rather than partial dechlorination. While
PCP-1 transformed PCP to 3-CP, we observed further transformation of
3-CP to phenol followed by phenol mineralization. It could be
hypothesized that syntrophic or methanogenic bacteria were responsible
for the dechlorination of 3-CP to phenol. A PCP feeding strategy
applied in the second bioaugmented run, which linked the PCP load to
the rate of methane production, allowed for the proliferation of not
only strain PCP-1 but other strains required to degrade intermediates,
such as 3-CP and phenol. Nevertheless, degradation of 3-CP became a
rate-limiting factor at the highest PCP load, and the concentration of
this dechlorination intermediate reached 30 mg/liter. A further
improvement of the system performance can be achieved by augmentation
of the anaerobic population with an effective strain of 3-CP dechlorinators.
Alternatively, an enrichment in 3-CP degraders could be achieved not
only by an addition of a laboratory strain but also by a proper reactor
control strategy aimed at the enrichment of a bacterial community in
target bacteria. This control strategy, which we call "a selective
stress control strategy," involves the presence of an elevated
concentration of a toxicant under consideration. The concentration of
such a compound, however, should be below a certain level to avoid
reactor failure (as happened in the control reactor). Automated reactor
control is a valuable approach to obtain fast enrichment in the desired population.
| |
ACKNOWLEDGMENTS |
The technical support of M. Manuel and S. Deschamps is greatly appreciated.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: 6100 Royalmount
Ave., Montreal, Quebec H4P 2R2, Canada. Phone: (514) 496-6181. Fax: (514) 496-6265. E-mail: Serge.Guiot{at}nrc.ca.
This is NRC paper number 43272.
| |
REFERENCES |
| 1.
|
American Public Health Association.
1995.
Standard methods for the examination of water and wastewater, 19th ed.
American Public Health Association, Washington, D.C..
|
| 2.
|
Arcand, Y.,
J. Hawari, and S. Guiot.
1995.
Solubility of pentachlorophenol in aqueous solutions: the pH effect.
Water Res.
29:131-136.
|
| 3.
|
Beaudet, R.,
M.-J. Levesque,
R. Villemur,
M. Lanthier,
M. Chenier,
F. Lepine, and J.-G. Bisaillon.
1998.
Anaerobic biodegradation of pentachlorophenol in a contaminated soil inoculated with a methanogenic consortium or with Desulfitobacterium frappieri strain PCP-1.
Appl. Microbiol. Biotechnol.
50:135-141[Medline].
|
| 4.
|
Bouchard, B.,
R. Beaudet,
R. Villemur,
G. McSween,
F. Lépine, and J.-G. Bisaillon.
1996.
Isolation and characterization of Desulfitobacterium frappieri sp. nov., an anaerobic bacterium which reductively dechlorinates pentachlorophenol to 3-chlorophenol.
Int. J. Syst. Bacteriol.
46:1010-1015[Abstract/Free Full Text].
|
| 5.
|
Christiansen, N.,
H. V. Hendriksen,
T. Jarvinen, and B. K. Ahring.
1995.
Degradation of chlorinated aromatic compounds in UASB reactors.
Water Sci. Technol.
31:249-259.
|
| 6.
|
Dennie, D.,
I. Gladu,
F. Lépine,
R. Villemur,
J.-G. Bissaillon, and R. Beaudet.
1998.
Spectrum of the reductive dehalogenation activity of Desulfitobacterium frappieri PCP-1.
Appl. Environ. Microbiol.
64:4603-4606[Abstract/Free Full Text].
|
| 7.
|
Duff, S. J. B.,
K. J. Kennedy, and A. J. Brady.
1995.
Treatment of dilute phenol/PCP wastewaters using the upflow anaerobic sludge blanket (UASB) reactor.
Water Res.
29:645-651.
|
| 8.
|
Juteau, P.,
R. Beaudet,
G. McSween,
F. Lepine,
S. Milot, and J.-G. Bisaillon.
1995.
Anaerobic biodegradation of pentachlorophenol by a methanogenic consortium.
Appl. Microbiol. Biotechnol.
44:218-224.
|
| 9.
|
Levesque, M.-J.,
R. Beaudet,
J.-G. Bisaillon, and R. Villemur.
1998.
Quantification of Desulfitobacterium frappieri strain PCP-1 and Clostridium like strain 6 in mixed bacterial populations by competitive polymerase chain reaction.
J. Microbiol. Methods
32:263-271.
|
| 10.
|
Levesque, M.-J.,
S. La Boissiere,
J.-C. Thomas,
R. Beaudet, and R. Villemur.
1997.
Rapid method for detecting Desulfitobacterium frappieri strain PCP-1 in soil by the polymerase chain reaction.
Appl. Microbiol. Biotechnol.
47:719-725[Medline].
|
| 11.
|
Massol-Deyá, A.,
R. Weller,
L. Ríos-Hernández,
J.-Z. Zhou,
R. F. Hickey, and J. M. Tiedje.
1997.
Seccession and convergence of biofilm communities in fixed-film reactors treating aromatic hydrocarbons in groundwater.
Appl. Environ. Microbiol.
63:270-276[Abstract].
|
| 12.
|
Miguez, C. B.,
C.-F. Shen,
D. Bourque,
S. R. Guiot, and D. Groleau.
1999.
Monitoring methanotrophic bacteria in hybrid anaerobic-aerobic reactors with PCR and a catabolic gene probe.
Appl. Environ. Microbiol.
65:381-388[Abstract/Free Full Text].
|
| 13.
|
Mikesell, M. D., and S. A. Boyd.
1986.
Complete reductive dechlorination and mineralization of pentachlorophenol by anaerobic microorganisms.
Appl. Environ. Microbiol.
52:861-865[Abstract/Free Full Text].
|
| 14.
|
Mohn, W. W., and K. J. Kennedy.
1992.
Limited degradation of chlorophenols by anaerobic sludge granules.
Appl. Environ. Microbiol.
58:2131-2136[Abstract/Free Full Text].
|
| 15.
|
Shen, C. F., and S. R. Guiot.
1996.
Long-term impact of dissolved O2 on the activity of anaerobic granules.
Biotechnol. Bioeng.
49:611-620.
|
| 16.
|
Stuart, S. L., and S. L. Woods.
1998.
Kinetic evidence for pentachlorophenol-dependent growth of a dehalogenating population in a pentachlorophenol- and acetate-fed methanogenic culture.
Biotechnol. Bioeng.
57:420-429[Medline].
|
| 17.
|
Tartakovsky, B., and S. R. Guiot.
1997.
Modeling and analysis of layered stationary anaerobic granular biofilms.
Biotechnol. Bioeng.
54:122-130.
|
| 18.
|
Utkin, I.,
C. Woese, and J. Wiegel.
1995.
Isolation and characterization of Desulfitobacterium dehalogenans gen. nov., sp. nov., an anaerobic bacterium which reductively dechlorinates chlorophenolic compounds.
Int. J. Syst. Bacteriol.
44:612-619[Abstract/Free Full Text].
|
| 19.
|
Wu, W.-M.,
L. Bhatnagar, and J. G. Zeikus.
1993.
Performance of anaerobic granules for degradation of pentachlorophenol.
Appl. Environ. Microbiol.
59:389-397[Abstract/Free Full Text].
|
| 20.
|
Zachar, V.,
R. A. Thomas, and A. S. Goutin.
1993.
Absolute quantification of target DNA: a simple competitive PCR for efficient analysis of multiple samples.
Nucleic Acids Res.
21:2017-2018[Free Full Text].
|
Applied and Environmental Microbiology, October 1999, p. 4357-4362, Vol. 65, No. 10
0099-2240/99/$04.00+0
This article has been cited by other articles:
-
Lanthier, M., Juteau, P., Lepine, F., Beaudet, R., Villemur, R.
(2005). Desulfitobacterium hafniense Is Present in a High Proportion within the Biofilms of a High-Performance Pentachlorophenol-Degrading, Methanogenic Fixed-Film Reactor. Appl. Environ. Microbiol.
71: 1058-1065
[Abstract]
[Full Text]
-
Lanthier, M., Tartakovsky, B., Villemur, R., DeLuca, G., Guiot, S. R.
(2002). Microstructure of Anaerobic Granules Bioaugmented with Desulfitobacterium frappieri PCP-1. Appl. Environ. Microbiol.
68: 4035-4043
[Abstract]
[Full Text]
Top
Abstract
Introduction
