Previous Article | Next Article 
Applied and Environmental Microbiology, October 1999, p. 4575-4581, Vol. 65, No. 10
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Utilization of Trihalogenated Propanes by Agrobacterium
radiobacter AD1 through Heterologous Expression of the Haloalkane
Dehalogenase from Rhodococcus sp. Strain m15-3
Tjibbe
Bosma,
Edwin
Kruizinga,
Erik J.
de
Bruin,
Gerrit J.
Poelarends, and
Dick B.
Janssen*
Department of Biochemistry, Groningen
Biomolecular Sciences and Biotechnology Institute, University of
Groningen, 9747 AG Groningen, The Netherlands
Received 15 April 1999/Accepted 30 July 1999
 |
ABSTRACT |
Trihalogenated propanes are toxic and recalcitrant organic
compounds. Attempts to obtain pure bacterial cultures able to use these
compounds as sole carbon and energy sources were unsuccessful. Both the
haloalkane dehalogenase from Xanthobacter autotrophicus GJ10 (DhlA) and that from Rhodococcus sp. strain m15-3
(DhaA) were found to dehalogenate trihalopropanes to 2,3-dihalogenated propanols, but the kinetic properties of the latter enzyme are much
better. Broad-host-range dehalogenase expression plasmids, based on
RSF1010 derivatives, were constructed with the haloalkane dehalogenase
from Rhodococcus sp. strain m15-3 under the control of the
heterologous promoters Plac,
PdhlA, and Ptrc. The
resulting plasmids yielded functional expression in several
gram-negative bacteria. A catabolic pathway for trihalopropanes was
designed by introducing these broad-host-range dehalogenase expression plasmids into Agrobacterium radiobacter AD1, which has the
ability to utilize dihalogenated propanols for growth. The recombinant strain AD1(pTB3), expressing the haloalkane dehalogenase gene under the
control of the dhlA promoter, was able to utilize both 1,2,3-tribromopropane and 1,2-dibromo-3-chloropropane as sole carbon
sources. Moreover, increased expression of the haloalkane dehalogenase
resulted in elevated resistance to trihalopropanes.
 |
INTRODUCTION |
Trihalogenated propanes are toxic
and volatile organic compounds and have been released into the
environment primarily via agricultural usage or the improper disposal
of industrial waste. Brominated propanes, such as 1,2,3-tribromopropane
and 1,2-dibromo-3-chloropropane, were used as nematocides for a variety
of crops (2, 23). The chlorinated analog,
1,2,3-trichloropropane, is formed as an undesirable by-product during
the synthesis of epichlorohydrin and the nematocide 1,3-dichloropropene
(12). Both 1,2-dibromo-3-chloropropane and
1,2,3-trichloropropane are significant contaminants of groundwater (2, 10, 37), although the U. S. Environmental
Protection Agency banned the use of the former compound in 1979. The
toxicity, carcinogenic potential, and recalcitrant nature of
trihalopropanes raise concerns about their effects on public health and
the environment.
Limited information is available about the biodegradation of
trihalogenated propanes. Reductive, oxidative, and hydrolytic conversions of trihalopropanes under laboratory conditions have been
described (5, 8, 38). However, pure cultures of bacteria that can grow aerobically on trihalogenated propanes have never been
described. These compounds have probably not provided sufficient selective pressure on microorganisms to stimulate the evolution of
complete catabolic pathways due to their relatively recent anthropogenic entry into the environment. Moreover, if some conversion occurs, the accumulation of toxic intermediates due to incomplete pathways could inhibit bacterial growth and degradation of these chemicals.
The aim of this work was to obtain aerobic bacterial growth on
trihalogenated propanes by a genetically engineered bacterium. Studies
with haloalkane dehalogenases have revealed that these enzymes
hydrolyze several chemicals that are structurally similar to
trihalopropanes, such as 1,2-dichloropropane, 1,2-dichlorobutane, 1,2-dibromopropane, and 1,3-dichloropropane, yielding (halo)alcohols as
degradation products (20, 24, 39). The resulting
dihalogenated propanols, which would be produced during hydrolytic
dehalogenation of trihalogenated propanes, are good growth substrates
for several gram-negative organisms (7, 17, 18), including
Agrobacterium radiobacter AD1, which was originally isolated
on epichlorohydrin (34). Thus, introducing an appropriate
haloalkane dehalogenase into these strains would yield a recombinant
bacterium containing a complete catabolic pathway for trihalogenated propanes.
In the present study, we describe the steady-state kinetics of the
conversion of trihalogenated propanes by the haloalkane dehalogenases
from Xanthobacter autotrophicus GJ10 (DhlA) and Rhodococcus sp. strain m15-3 (DhaA). The gene encoding the
latter dehalogenase was engineered to be under the control of different heterologous promoters and was functionally expressed in several gram-negative bacteria. High expression of the haloalkane dehalogenase was obtained in A. radiobacter AD1, allowing this strain to
grow on 1,2,3-tribromopropane and 1,2-dibromo-3-chloropropane.
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and growth conditions.
The
bacterial strains and plasmids used in this work are listed in Table
1. T. Omori kindly provided
Rhodococcus sp. strain m15-3, formerly
Corynebacterium sp. strain m15-3 (39). Based on
16S rRNA gene sequence analysis, strain m15-3 was identified as a
Rhodococcus sp. (25a).
Escherichia coli strains were grown in Luria-Bertani (LB)
medium (
30) at 30°C. The synthetic mineral (MMY) medium
used in
all growth experiments with
A. radiobacter AD1,
derivatives thereof,
and
Pseudomonas strains contained (per
liter) 5.4 g of Na
2HPO
4 · 12H
2O, 1.4 g of KH
2PO
4,
0.5 g of (NH
4)
2SO
4, 0.2 g
of MgSO
4 ·
7H
2O, 5 ml of trace element
metal solutions (
15), and 5 mg of
yeast extract. For the
preparation of crude extracts for enzyme
assays,
A. radiobacter AD1 and the
Pseudomonas strains were grown
in MMY medium containing 5 mM citrate. For plates, 1.5% agar was
added. Liquid cultures were cultivated at 30°C, if not stated
otherwise, with rotary shaking (200 to 250 rpm). When appropriate,
antibiotics were added at the following concentrations: ampicillin,
100 µg/ml; kanamycin, 50 µg/ml, and chloramphenicol, 10 µg/ml.
Utilization of halogenated compounds by strain AD1 or its recombinant
derivatives was determined in batch cultures to which substrates
were
added at the concentrations indicated. Growth was followed
by measuring
the turbidity at 450 nm. For the toxicity experiments,
strains AD1,
AD1(pTB1), and AD1(pTB3) were grown in MMY medium
containing 5 mM
1,3-dichloro-2-propanol and increasing concentrations
of
1,2,3-trichloropropane, 1,2,3-tribromopropane, or
1,2-dibromo-3-chloropropane.
The optical density at 450 nm
(OD
450) was determined after 7 days
of
incubation.
Preparation of crude extracts.
Crude extracts were prepared
by sonication of cells grown to the stationary phase as described by
van den Wijngaard et al. (34).
Isolation and manipulation of DNA.
Plasmid isolation, DNA
amplification, and restriction enzyme digestions, ligations, and
transformations were performed as described by Sambrook et al.
(30) or according to the specifications of the manufacturer
of the materials used. Total DNA from X. autotrophicus GJ10
and Rhodococcus sp. strain m15-3 was isolated by the phenol extraction procedure described by Poelarends et al. (26).
Construction of the broad-host-range expression plasmids.
The dhaA gene was placed under the control of the
lac, dhlA, and trc promoters. For
this, the dhaA gene was amplified by PCR using total DNA of
Rhodococcus sp. strain m15-3 as template. PCR amplification
was performed with Taq DNA polymerase (Boehringer Mannheim,
Mannheim, Germany) using a PCR program of 25 to 35 cycles of 94°C for
2 min, 94°C for 30 s, 50 to 55°C for 30 s, and 72°C for
45 s, with a final extension step of 72°C for 5 min.
Oligonucleotides used for the amplification of the dhaA gene
and the promoter fragments were synthesized by Eurosequence BV
(Groningen, The Netherlands). In plasmids pTB5 and pKKdhaA, the
N-terminal sequence of DhaA was changed from MSEIGT (wild type) to
MAEIGT with the introduction of a NcoI restriction site for
fusion into the ATG of dhaA. In plasmids pTB1 and pTB3, the
coding sequence was unchanged.
For the construction of pTB1, pDSK519 was digested with
BamHI and ligated with an 890-bp PCR fragment encoding the
dhaA gene,
yielding pTB1. The primers used were p1,
5'-GAGAAAATC
GGATCCC
ATGTCAGAAATCGGTACAGGCTTCCCC
(forward), and p2,
5'-GAGGGG
GGATCCGACCATGGCGTGAAC
CTAGAGTGCGGGGAG
(reverse), where underlining indicates
BamHI sites and
start and
stop codons are in boldface. In this way, the
dhaA
gene was fused
to the 54 initial codons of the
lacZ
gene
of
pDSK519.
For the construction of pTB3, a 648-bp fragment containing the
dhlA promoter sequences (
16) was amplified by PCR
on total
DNA of
X. autotrophicus GJ10 using primers p3,
5'-GTTACCGAATTCCCCTCAACATAA
(forward), and p4,
5'-GCCTGTACCGATTTCTGA
CATAGAGCCTCCGTAAGC
(reverse), where the start codon is in boldface. The
dhaA gene,
including its own transcription terminator
(
21), was amplified
by PCR using primers p5,
5'-TCAGAAATCGGTACAGGCTTC (forward), and
p6,
5'-AATGAATT
GGATCCAGTTGGGGTGTCAGGTTTGGCATTG
(reverse), where
the
BamHI site is underlined. The
reverse primer, p4, of the
dhlA promoter fragment contained
an additional 18-bp segment that was
complementary to the forward
primer, p5, of the
dhaA gene. The
isolated promoter and
dehalogenase sequences were joined by PCR
fusion using the combined
fragments as template and the two terminal
primers, p3 and p6, yielding
a chimeric molecule of 1.6 kb. For
the introduction of a
NdeI restriction site, primer p4 was replaced
by primer p9,
5'-GCCTGTACCGATTTCTGA
CATAtgGGCCTCCGTAAGC
(reverse), where the
NdeI site is underlined and the
start codon
is in boldface. Two nucleotides (lowercase) of the triplet
directly
preceding the start codon were altered to create a
NdeI recognition
site. After digestion with
HindIII and
BamHI, the combined construct
was
ligated into the
HindIII and
BamHI
restriction sites of the
broad-host-range cosmid pJRD215, resulting in
pTB3.
Plasmid pTB5 was constructed as follows. A 1.4-kb PCR fragment
containing the
trc promoter, the
dhaA gene, and
the
rrnB transcription
terminator sequences was amplified
from plasmid pKKdhaA with primers
p7,
5'-TAATAAGT
GGATCCGGATACATATTTGAATGT (forward),
and p8, 5'-CATATAAAC
GGATCCGGCAAATAT
(reverse),
where the
BamHI sites are underlined. The PCR product
was
digested with
BamHI and ligated into
BamHI-digested vector
pJRD215, resulting in
pTB5.
For the construction of pKKdhaA, the
dhaA gene was PCR
amplified with primer p10,
5'-AAAATCG
CCATGGCAGAAATCGGTA
(forward),
and p11, 5'-TGGACATCGGA
CCATGGCGTGAACC
(reverse), where the
NcoI
sites are underlined and the
start codon is in boldface. After
restriction with
NcoI, the
dhaA gene was ligated into
NcoI-digested
trc expression vector pKK233-2, yielding the
E. coli dehalogenase
expression vector
pKKdhaA.
Mobilization of broad-host-range plasmids to gram-negative
bacteria.
Triparental matings were performed with pRK600 as the
helper plasmid, providing the transfer functions for mobilization. The helper strain and donor strains (RSF1010 derivatives in E. coli HB101) were grown overnight in LB medium with antibiotic
selection. Equal volumes of these cultures were mixed and streaked on
nonselective agar plates. After overnight incubation, these plates were
replicated on separate nonselective plates previously spread with the
recipient strains A. radiobacter AD1, Pseudomonas
sp. strain GJ1, and Pseudomonas putida US2 and GJ31. After
incubation for 16 to 20 h, the mating mixtures were replicated on
MMY agar plates supplemented with 5 mM citrate and kanamycin.
Transconjugants were selected and tested for dehalogenase activity.
Purification of haloalkane dehalogenase.
The haloalkane
dehalogenases were expressed with a T7 promoter-based expression system
and were purified by DEAE-cellulose and hydroxylapatite chromatography
according to the method of Schanstra et al. (31).
Enzyme assays.
Haloalkane dehalogenase assays were routinely
carried out at 30°C by incubating appropriate amounts of purified
enzyme solution or crude extracts in 50 mM NaHCO3-NaOH
buffer, pH 9.4, for DhaA, or in 50 mM Tris-SO4 buffer, pH
8.2, for DhlA. Dehalogenase activities were measured by determining
levels of halide released from halogenated substrates as described
previously (20). Samples were taken at different times (5 to
45 min), and halide concentrations (0.1 to 1 mM) were measured
colorimetrically at 460 nm after the addition of mercuric thiocyanate
and ferric ammonium sulfate. Substrates were added to the following
concentrations: 1,2-dibromoethane, 10 mM; 1,2,3-tribromopropane, 2.5 mM; 1,2-dibromo-3-chloropropane, 3 mM; and 1,2,3-trichloropropane, 10 mM. One unit of enzyme activity was defined as the amount of enzyme
that catalyzes the formation of 1 µmol of halide per min.
The
Km values for trihalogenated propanes were
determined by measuring the initial rate of haloalcohol or halide
production
at various concentrations of halogenated substrate. The
Km values
were estimated by nonlinear regression
analysis of the initial
rate of haloalcohol and halide production as
described by Schanstra
et al. (
32). Transformants of
E. coli HB101, containing dehalogenase
expression plasmids,
were screened for dehalogenase activity in
96-well plates or on pH
indicator plates with 1,2-dibromoethane
as the substrate according to
the procedure described by Schanstra
et al. (
31).
Protein concentrations of crude extracts were measured with Coomassie
brilliant blue using bovine serum albumin as the standard.
The
concentration of the purified enzymes was measured
spectrophotometrically
at 280 nm. An absorbance of 1 corresponds to
0.54 and 0.72 mg
of protein/ml for DhaA and DhlA, respectively, as
calculated with
the DNASTAR program (DNASTAR, Inc., Madison, Wis.).
Gas chromatography.
Concentrations of halogenated compounds
were determined quantitatively by gas chromatography. Samples (4.5 ml)
were extracted with diethylether (1.5 ml) containing 0.05 mM
1-bromohexane as the internal standard. The ether layer was analyzed by
split injection of 1-µl samples on a Chrompack 438S gas chromatograph
equipped with a flame ionization detector and an HP-inowax column
(length, 25 m; inner diameter, 0.2 mm; film thickness, 0.2 µm)
(Hewlett Packard). The carrier gas was nitrogen (50 kPa), and the
temperature program was 3-min isothermal at 45°C followed by an
increase to 220°C at a rate of 10°C/min.
Gas-chromatographic mass spectrometry was performed on an HP 5890 gas
chromatograph with an HP5 capillary column (length,
25 m; inner
diameter, 0.2 mm; film thickness, 0.2 µm) (Hewlett
Packard) connected
to a flame ionization detector and a type 5971
mass-selective detector.
Helium was used as a carrier gas (0.9
ml min
1), and the
temperature program was the same as described
above.
Chemicals.
All organic compounds used were obtained from
commercial suppliers (Across, Merck, Aldrich, Janssen Chimica, and
Lancaster). Restriction enzymes, T4 DNA ligase, Taq DNA
polymerase, High Pure Plasmid Isolation kit, and the High Pure PCR
Product Purification kit were all purchased from Boehringer.
 |
RESULTS |
Specificity of haloalkane dehalogenase for trihalogenated
propanes.
To evaluate the activity of the haloalkane dehalogenases
from X. autotrophicus GJ10 (DhlA) and Rhodococcus
sp. strain m15-3 (DhaA) on trihalogenated propanes, we used the
recombinant enzymes expressed in E. coli. The quantity of
both enzymes comprised up to 50% of the total soluble protein in
E. coli BL21(DE3) when the expression was under the control
of the T7 promoter using the expression vector pGEF+
(28). Recent work in our laboratory (25a) showed
that the haloalkane dehalogenase gene from strain m15-3 is identical to that of the corresponding gene from Rhodococcus rhodochrous
NCIMB 13064 (21). Based on sequence comparisons between DhlA
and DhaA, these proteins are expected to have similar structures and
catalytic mechanisms, but the substrate ranges are different (20,
39).
The steady-state kinetics of the conversion of trihalogenated propanes
were studied using purified DhlA and DhaA. The halogenated
products of
these reactions were identified by gas chromatography
and
gas-chromatographic mass spectrometry analyses (Table
2).
Both enzymes hydrolyzed
trihalogenated propanes with a concomitant
and stoichiometric
accumulation of 2,3-dihalogenated propanol
and halide. However, the
kinetic properties of DhaA for trihalogenated
propanes are much better
(Table
2). For the trihalogenated propanes
tested, DhaA had higher
kcat and lower
Km values
than DhlA. The
enzyme specificity
(
kcat/Km) of DhaA for these
chemicals is at
least ninefold higher. Therefore, this enzyme was
selected for
the construction of a catabolic pathway for trihalogenated
propanes.
The
kcat and
Km
values of DhaA were comparable for 1,2,3-tribromopropane
and
1,2-dibromo-3-chloropropane. However, its affinity for
1,2-dibromo-3-chloropropane
was somewhat lower. The chlorinated
analog 1,2,3-trichloropropane
was a poor substrate for the
dehalogenase, as the enzyme had a
high
Km and a
low
kcat for this compound.
The activity of both enzymes towards 1,2-dibromoethane was striking.
This compound is the best known substrate for DhlA in
terms of
kcat and
Km. The
kcat and
Km values for
DhaA were much
higher than the values for
DhlA.
Utilization of halopropanols by A. radiobacter
AD1.
In previous studies, it was shown that A. radiobacter AD1 exhibited good growth kinetics for the conversion
of 1,3-dichloro-2-propanol. The organism had a high affinity for this
compound, which was correlated with a low Km
value of the haloalcohol dehalogenase, the first catabolic enzyme in
the pathway, for 1,3-dichloro-2-propanol (34, 35).
Therefore, we used A. radiobacter AD1 as a possible host
organism for the construction of a degradation pathway for trihalopropanes. Utilization of 2,3-dichloro- and
2,3-dibromo-1-propanol by strain AD1 was tested, since these compounds
were produced during hydrolytic conversion of trihalopropanes by
haloalkane dehalogenase. The results showed that strain AD1 was able to
grow on both 2,3-dichloro- and 2,3-dibromo-1-propanol with similar generation times (Table 3). The highest
growth rate was obtained on 1,3-dichloro-2-propanol with a generation
time of 4 h. Strain AD1 completely utilizes both
2,3-dibromo-1-propanol and 1,3-dichloro-2-propanol. In contrast,
approximately 50% conversion was found for 2,3-dichloro-1-propanol. Chiral gas chromatography of the culture fluid with a Chiraldex B-TA
capillary column (30 m) (Astec) showed that only the
(S)-enantiomer of 2,3-dichloro-1-propanol remained after
growth had ceased, indicating that the conversion of
2,3-dichloro-1-propanol was stereospecific (32a), whereas
both enantiomers of the brominated analog supported growth.
Construction of a broad-host-range dehalogenase expression
plasmid.
Expanding the substrate range of A. radiobacter AD1 by introducing the dhaA gene requires
an efficient vector system and sufficient expression of the
dehalogenase, since both the kinetic properties of the first catabolic
enzyme and the dehalogenase content are important (35). We
therefore constructed three different broad-host-range expression
vectors containing different promoters to direct expression of DhaA.
The resulting expression vectors, pTB1, pTB3, and pTB5, are all based
on the RSF1010 replicon, because the mobilization and replication of
RSF1010 derivatives have been reported for Agrobacterium
(3, 22). Figure 1 shows
schematically the promoter dehalogenase regions of the constructed
expression vectors.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic organization of the promoter and dehalogenase
coding region of the constructed expression vectors.
Rhodococcus DNA is shown as a hatched block. Thin arrows
indicate the direction of transcription of the dhaA gene.
Thick arrows represent the promoters. The shaded blocks indicate the
transcriptional terminator. Only relevant restriction sites are
shown.
|
|
In plasmid pTB1, the
dhaA gene was fused to the 5' part of
the
lacZ
gene and placed under the control of the
lac promoter.
This resulted in the formation of a fusion
protein composed of
the first 18 amino acids of LacZ

followed by
DhaA.
Plasmid pTB3 contained the
dhaA gene under the control of
the
dhlA promoter from
X. autotrophicus GJ10,
which was previously
shown to operate efficiently in several
gram-negative bacteria
(
16). The
dhaA gene,
including its own transcription terminator
(
21), was
attached by PCR fusion to a fragment containing both
promoter sequences
of the
dhlA gene (
16). Overlap between primers
p4
and p5 resulted in the precise attachment of the promoter to
the
dehalogenase gene. The
dhlA promoter fragment provided a
strong
ribosome binding site four nucleotides upstream from the start
codon (
16).
The
E. coli hybrid
trp-lac promoter,
Ptrc, was used to direct the expression of DhaA
in plasmid pTB5. The vector carries the
dhaA gene
translationally fused to the
trc promoter, the
lacZ ribosome binding site, and the
rrnB
transcription
terminators.
Kanamycin-resistant transformants of
E. coli HB101
containing the different broad-host-range expression vectors were
identified
by screening for dehalogenase
activity.
PCR-amplified segments of all constructs were sequenced. Only in
plasmid pTB3 was a base substitution (C

T) at position

13
found in
the spacer region between the

35 and

10 promoter sequences
of the
first
dhlA promoter.
Expression of the dhaA gene in different gram-negative
bacteria.
To evaluate the use of the constructs for the expression
of the dehalogenase, the recombinant plasmids were introduced by triparental mating into different gram-negative bacteria. A. radiobacter AD1, Pseudomonas sp. strain GJ1, and
P. putida US2 and GJ31 were used as recipients because these
organisms could grow on various halogenated alcohols. Dehalogenase
activities were measured in cell-free extracts with 1,2-dibromoethane
as the assay substrate (Table 4). The
broad-host-range plasmids are all based on the same replicon, RSF1010,
so the efficiency of the different promoters can be compared without
regard to copy number effects.
View this table:
[in this window]
[in a new window]
|
TABLE 4.
Haloalkane dehalogenase activities towards
1,2-dibromoethane (10 mM) in crude extracts of various host
plasmid systems
|
|
Low dehalogenase activities were obtained in strains containing plasmid
pTB1, where the
dhaA gene is under the control of
the
lac promoter. In all of these cases, the expression level
of
the dehalogenase was approximately 1% or less of the total
soluble
cellular protein. Higher specific activities were found
in strains
containing plasmid pTB3 or pTB5. The expression levels
of the
dehalogenase were comparable for these constructs, but
levels varied
with the host organism. Only small differences were
observed
between the efficiencies of the
dhlA and
trc promoters
in various
Pseudomonas species.
P. putida US2 (pTB3) exhibited
the highest
dehalogenase activity. The enzyme amounted to almost
20% of the total
soluble cellular protein in crude extracts. In
A. radiobacter AD1, the
dhlA and
trc promoters
generated similar
dehalogenase levels. The haloalkane dehalogenase was
present at
approximately 7 to 8% of the total soluble cellular
protein. The
strength of the
dhlA promoter is similar to
that of the
trc promoter,
which is one of the strongest
hybrid
E. coli promoters (
29).
Introducing a
NdeI restriction site at the ATG translation initiation
codon of
dhaA in pTB3 would facilitate the exchange of
dhaA with
other dehalogenase genes. However, the expression
level of the
dehalogenase in
E. coli HB101 was almost
fivefold lower (data
not shown). Due to the introduction of this
NdeI site, the triplet
preceding the start codon has been
changed from TCT to CAT. This
may explain the decrease in dehalogenase
activity, since it is
known that this triplet can affect the efficiency
of translation
(
13). The recombinant strain
A. radiobacter AD1(pTB3) was further
characterized with respect to
utilization of trihalogenated
propanes.
Utilization of trihalopropanes by A. radiobacter
AD1(pTB3).
The introduction of halogen substituents into organic
compounds may increase toxicity. Therefore we tested which
concentrations of trihalogenated propanes were tolerated by strain
AD1 and its derivatives (Fig. 2).
The addition of increasing concentrations of trihalogenated
propanes inhibited the growth of strains AD1, AD1(pTB1), and
AD1(pTB3). Both 1,2,3-tribromopropane and 1,2-dibromo-3-chloropropane exhibited a high toxicity. Addition of these chemicals to a growing culture of strain AD1, AD1(pTB1), or AD1(pTB3) caused strong
inhibition of growth and even cell death. No viable cells were
obtained on nutrient broth plates from cultures that were previously
incubated with the highest concentrations of 1,2,3-tribromopropane (1.5 mM) and 1,2-dibromo-3-chloropropane (1.6 mM). However, for the recombinant strain AD1(pTB3), the tolerance towards these compounds was
increased due to a high expression level of DhaA. Of the trihalogenated propanes tested, 1,2,3-trichloropropane was least toxic. Moreover, the
presence of DhaA did not increase the tolerance towards
1,2,3-trichloropropane, due to the low conversion rates of the
dehalogenase for this compound.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
Effect of increasing concentrations of trihalogenated
propanes on growth of A. radiobacter strains AD1 ( ),
AD1(pTB1) ( ), and AD1(pTB3) ( ) growing on 5 mM
1,3-dichloro-2-propanol. The turbidity (OD450) of the
cultures was measured after 7 days of cultivation at 30°C. Initial
OD450 values ranged from 0.5 to 0.7. (A)
1,2,3-tribromopropane; (B) 1,2-dibromo-3-chloropropane; (C)
1,2,3-trichloropropane.
|
|
Growth of the recombinant strain AD1(pTB3) with 1,2,3-tribromopropane,
1,2-dibromo-3-chloropropane, or 1,2,3-trichloropropane
was monitored in
batch cultures (Fig.
3). Because of their
toxicity,
pulses of 1 mM 1,2,3-tribromopropane and 1.2 mM
1,2-dibromo-3-chloropropane
were added, while 1,2,3-trichloropropane
was added at an initial
concentration of 1.6 mM. The concentrations of
1,2,3-tribromopropane
and 1,2-dibromo-3-chloropropane rapidly decreased
immediately
after the addition of these substrates. The subsequent
addition
of these compounds resulted in an increase of biomass.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 3.
Growth and degradation of trihalogenated propanes by
A. radiobacter AD1(pTB3). Cultures were grown aerobically at
room temperature in MMY medium supplemented with 1 mM
1,2,3-tribromopropane (4 pulses), 1.2 mM 1,2-dibromo-3-chloropropane (2 pulses), or 1.6 mM 1,2,3-trichloropropane as carbon source. (A)
1,2,3-Tribromopropane ( ), 2,3-dibromo-1-propanol ( ),
OD450 ( ); (B) 1,2-dibromo-3-chloropropane ( ),
2-bromo-3-chloro-1-propanol ( ), OD450 ( ); (C)
1,2,3-trichloropropane ( ), 2,3-dichloro-1-propanol ( ),
OD450 ( ); (D) (sterile controls) 1,2,3-tribromopropane
( ), 1,2-dibromo-3-chloropropane ( ), 1,2,3-trichloropropane
( ).
|
|
The conversion of 1,2,3-trichloropropane proceeded at a much lower
rate. After 25 days of incubation, approximately 0.7 mM
of
1,2,3-trichloropropane was converted, yielding a very small
increase in
OD. Transformation of the trihalogenated propanes
was due to enzymatic
activity, since its concentration decreased
much more slowly in sterile
controls (Fig.
3). During conversion
of the trihalogenated propanes,
the corresponding halopropanols
accumulated. The brominated propanols
were completely converted,
while a low amount of
2,3-dichloro-1-propanol remained present
in the culture.
The results thus showed that the recombinant strain
AD1(pTB3) was
able to rapidly dehalogenate 1,2,3-tribromopropane
and
1,2-dibromo-3-chloropropane to the corresponding haloalcohols,
which
were subsequently utilized. The chlorinated analog
1,2,3-trichloropropane,
which is a poor substrate for DhaA, was
converted slower and stimulated
growth to a much lower
extent.
 |
DISCUSSION |
To obtain bacterial growth on trihalogenated propanes, we
introduced the haloalkane dehalogenase from Rhodococcus sp.
strain m15-3 (DhaA) into A. radiobacter AD1. The resulting
strain could use the environmental chemicals 1,2,3-tribromopropane
and 1,2-dibromo-3-chloropropane as sole carbon and energy sources. The
proposed degradation pathway of strain AD1(pTB3) is shown in Fig.
4. The complete dehalogenation of
trihalogenated propanes involves the combined activities of haloalkane
dehalogenase, haloalcohol dehalogenase, and epoxide hydrolase, finally
yielding glycerol, which is further metabolized by the organism
(34). The conversion of 2,3-dihalogenated propanols by the
host strain AD1 is similar to that of a Flavobacterium sp.
utilizing 2,3-dibromo-1-propanol (7).

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 4.
Proposed pathway for complete degradation of
trihalogenated propanes by A. radiobacter AD1(pTB3). X,
chloride or bromide.
|
|
For growth on trihalogenated propanes, the kinetic properties
(kcat and Km) of DhaA for
trihalopropanes are of major importance. The best substrate for DhaA,
1,2,3-tribromopropane, was rapidly degraded by strain AD1(pTB3),
whereas degradation of 1,2-dibromo-3-chloropropane by AD1(pTB3), for
which the dehalogenase has a lower affinity, was somewhat slower. This
is probably due to a lower conversion rate of
1,2-dibromo-3-chloropropane by DhaA, since the concentration used was
approximately the Km value of the dehalogenase
for this compound. Although 1,2,3-trichloropropane is a poor substrate for DhaA and did not support growth, strain AD1(pTB3) was still able to convert about 46% of the 1,2,3-trichloropropane added in 25 days, yielding a small increase in OD. Furthermore, the haloalcohol dehalogenase produced by strain AD1 converted only the (R)-enantiomer of 2,3-dichloro-1-propanol, which also
limited utilization of 1,2,3-trichloropropane. The stereospecific
degradation of 2,3-dichloro-1-propanol by strain AD1 was similar to
that of Pseudomonas sp. strain OS-K-29 (17).
A high expression level of DhaA in strain AD1 increased the conversion
rates of trihalogenated propanes. Due to the low expression level of
DhaA in strain AD1(pTB1), growth was only observed on 1,2,3-tribromopropane, and the maximum concentration tolerated was
about 0.7 mM (data not shown). The low expression levels of DhaA in
strains containing plasmid pTB1 are probably caused by the production
of a fusion protein. In this construct, the dhaA gene was
translationally fused to the 5' end of the lacZ gene. This
could result in reduced stability of the mRNA, which depends on
its sequence, secondary structure, and association with ribosomes (4), or increased degradation of the fusion protein.
Because of the higher DhaA content, strain AD1(pTB3) was capable of
growth on 1,2,3-tribromopropane to a concentration of 1.2 mM and could also grow on 1,2-dibromo-3-chloropropane.
Both the dhlA and trc promoters directed
high-level constitutive expression of DhaA in several gram-negative
bacteria. Because contaminated sites and industrial waste streams often
contain mixtures of halogenated compounds, constitutive expression
could be an advantage, since degradation of a wide range of haloalkanes could be enhanced due to the broad substrate range of DhaA.
Toxicity of halogenated aliphatics or the formation of toxic
intermediates during conversion of these chemicals may inhibit bacterial growth. For example, the formation of bromoacetaldehyde is
probably the cause of the inability of strain GJ10 to grow on
1,2-dibromoethane. The loss of the haloalkane dehalogenase causes
resistance towards the latter compound (36). The
1,2-dibromoethane-utilizing strain Mycobacterium sp.
strain GP1 circumvents the formation of bromoacetaldehyde as an
intermediate (27). On the other hand, trihalogenated
propanes are toxic themselves, since strain AD1 could efficiently grow
on dihalogenated propanols, at least up to 5 mM. Here, the presence of
a haloalkane dehalogenase causes resistance towards trihalogenated propanes.
The fact that a catabolic route can be easily established indicates
that the absence of organisms that utilize trihalogenated propanes in
the environment is due to the absence of dehalogenases for haloalcohols
and for haloalkanes in a single organism. This could be due to the
relatively recent entry of these compounds into the environment, giving
microorganisms insufficient time to evolve appropriate pathways. The
only example of an isolate which can produce both enzymes is a
recently described isolate of Mycobacterium sp. strain GP1
which grows on 1,2-dibromoethane. This organism was obtained after
prolonged adaptation and selection in batch culture (27).
 |
ACKNOWLEDGMENTS |
This work was supported by a grant from Ciba Specialty Chemicals
Schweizerhalle, Inc., Basel, Switzerland.
We thank G. Stucki for valuable discussions.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry, Groningen Biomolecular Sciences and Biotechnology
Institute, University of Groningen, Nijenborgh 4, 9747 AG Groningen,
The Netherlands. Phone: 31-50-363-4208. Fax: 31-50-363-4165. E-mail: d.b.janssen{at}chem.rug.nl.
 |
REFERENCES |
| 1.
|
Amann, E., and J. Brosius.
1985.
ATG vectors for regulated high-level expression of cloned genes in Escherichia coli.
Gene
40:183-190[Medline].
|
| 2.
|
Babich, H.,
D. L. Davis, and G. Stotzky.
1981.
Dibromochloropropane (DBCP): a review.
Sci. Total Environ.
17:207-221[Medline].
|
| 3.
|
Bagdasarian, M.,
R. Lurz,
B. Rückert,
F. C. H. Franklin,
M. M. Bagdasarian,
J. Frey, and K. N. Timmis.
1981.
Specific-purpose plasmid cloning vectors. II. Broad host range, high copy number, RSF1010-derived vectors, and a host-vector system for gene cloning in Pseudomonas.
Gene
16:237-247[Medline].
|
| 4.
|
Belasco, J. G., and C. F. Higgins.
1988.
Mechanisms of mRNA decay in bacteria: a perspective.
Gene
72:15-23[Medline].
|
| 5.
|
Bosma, T., and D. B. Janssen.
1998.
Conversion of chlorinated propanes by Methylosinus trichosporium OB3b expressing soluble methane monooxygenase.
Appl. Microbiol. Biotechnol.
50:105-112.
|
| 6.
|
Boyer, H. W., and D. Roulland-Dussoix.
1969.
A complementation analysis of the restriction and modification of DNA in Escherichia coli.
J. Mol. Biol.
41:459-472[Medline].
|
| 7.
|
Castro, C. E., and E. W. Bartnicki.
1968.
Biodehalogenation. Epoxidation of halohydrins, epoxide opening, and transhalogenation by a Flavobacterium sp.
Biochemistry
7:3213-3218[Medline].
|
| 8.
|
Castro, C. E., and N. O. Belser.
1968.
Biodehalogenation. Reductive dehalogenation of the biocides ethylene dibromide, 1,2-dibromo-3-chloropropane, and 2,3-dibromobutane in soil.
Environ. Sci. Technol.
10:779-783.
|
| 9.
|
Davison, J.,
M. Heusterspreute,
M. Chevalier,
V. Ha-Thi, and F. Brunel.
1987.
Vectors with restriction site banks. V. pJRD215, a wide-host-range cosmid vector with multiple cloning sites.
Gene
51:275-280[Medline].
|
| 10.
| Environmental Protection Agency. 27 January 1989, posting date. [Online.] Technical drinking water and health
contaminant specific fact sheets.
http://www.epa.gov/OGWDW/dwh/t-soc/1,2-dibromo-3-chloropropane.html.
[20 August 1999, last date accessed.]
|
| 11.
|
Finan, T. M.,
B. Kunkel,
G. F. de Vos, and E. R. Signer.
1986.
Second symbiotic megaplasmid in Rhizobium meliloti carrying exopolysaccharide and thiamine synthesis genes.
J. Bacteriol.
167:66-72[Abstract/Free Full Text].
|
| 12.
|
Health Council of The Netherlands. Dutch Expert Committee on Occupational Standards (DECOS).
1994.
1,2,3-Trichloropropane. Report no. 1994/25.
Health Council of The Netherlands, The Hague, The Netherlands.
|
| 13.
|
Hui, A.,
J. Hayflick,
K. Dinkelspiel, and H. A. de Boer.
1984.
Mutagenesis of the three bases preceding the start codon of the -galactosidase mRNA and its effect on translation in Escherichia coli.
EMBO J.
3:623-629[Medline].
|
| 14.
|
Janssen, D. B.,
A. Scheper, and B. Witholt.
1984.
Biodegradation of 2-chloroethanol and 1,2-dichloroethane by pure bacterial cultures, p. 169-178.
In
E. H. Houwink, and R. R. van der Meer (ed.), Innovations in biotechnology. Elsevier Publishers, Amsterdam, The Netherlands.
|
| 15.
|
Janssen, D. B.,
A. Scheper,
L. Dijkhuizen, and B. Witholt.
1985.
Degradation of halogenated aliphatic compounds by Xanthobacter autotrophicus GJ10.
Appl. Environ. Microbiol.
49:673-677[Abstract/Free Full Text].
|
| 16.
|
Janssen, D. B.,
F. Pries,
J. van der Ploeg,
B. Kazemier,
P. Terpstra, and B. Witholt.
1989.
Cloning of 1,2-dichloroethane degradation genes of Xanthobacter autotrophicus GJ10, and expression and sequencing of the dhlA gene.
J. Bacteriol.
171:6791-6799[Abstract/Free Full Text].
|
| 17.
|
Kasai, N.,
K. Tsujimura,
K. Unoura, and T. Suzuki.
1990.
Degradation of 2,3-dichloro-1-propanol by a Pseudomonas sp.
Agric. Biol. Chem.
54:3185-3190.
|
| 18.
|
Kasai, N.,
K. Tsujimura,
K. Unoura, and T. Suzuki.
1992.
Isolation of (S)-2,3-dichloro-1-propanol assimilating bacterium, its characterization, and its use in preparation of (R)-2,3-dichloro-1-propanol and (S)-epichlorohydrin.
J. Ind. Microbiol.
10:37-43.
|
| 19.
|
Keen, N. T.,
S. Tamaki,
D. Kobayashi, and D. Trollinger.
1988.
Improved broad-host-range plasmids for DNA cloning in gram-negative bacteria.
Gene
70:191-197[Medline].
|
| 20.
|
Keuning, S.,
D. B. Janssen, and B. Witholt.
1985.
Purification and characterization of hydrolytic haloalkane dehalogenase from Xanthobacter autotrophicus GJ10.
J. Bacteriol.
163:635-639[Abstract/Free Full Text].
|
| 21.
|
Kulakova, A. N.,
M. J. Larkin, and L. A. Kulakova.
1997.
The plasmid-located haloalkane dehalogenase gene from Rhodococcus rhodochrous NCIMB 13064.
Microbiology
143:109-115[Abstract/Free Full Text].
|
| 22.
|
Labes, M.,
A. Pühler, and R. Simon.
1990.
A new family of RSF1010-derived expression and lac-fusion broad-host-range vectors for gram-negative bacteria.
Gene
89:37-46[Medline].
|
| 23.
|
Merck & Co., Inc..
1983.
The Merck index, 10th ed.
Merck & Co., Inc., Rahway, N.J.
|
| 24.
|
Nagata, Y.,
K. Miyauchi,
J. Damborsky,
K. Manova,
A. Ansorgova, and M. Takagi.
1997.
Purification and characterization of a haloalkane dehalogenase of a new substrate class from a -hexachlorocyclohexane-degrading bacterium, Sphingomonas paucimobilis UT26.
Appl. Environ. Microbiol.
63:3707-3710[Abstract].
|
| 25.
|
Oldenhuis, R.,
L. Kuijk,
A. Lammers,
D. B. Janssen, and B. Witholt.
1988.
Degradation of chlorinated and non-chlorinated aromatic solvents in soil suspensions by pure bacterial cultures.
Appl. Microbiol. Biotechnol.
30:211-217.
|
| 25a.
| Poelarends, G. J., et al. Unpublished results.
|
| 26.
|
Poelarends, G. J.,
M. Wilkens,
M. J. Larkin,
J. D. van Elsas, and D. B. Janssen.
1998.
Degradation of 1,3-dichloropropene by Pseudomonas cichorii 170.
Appl. Environ. Microbiol.
64:2931-2936[Abstract/Free Full Text].
|
| 27.
|
Poelarends, G. J.,
J. E. T. van Hylckama Vlieg,
J. R. Marchesi,
L. M. Freitas Dos Santos, and D. B. Janssen.
1999.
Degradation of 1,2-dibromoethane by Mycobacterium sp. strain GP1.
J. Bacteriol.
181:2050-2058[Abstract/Free Full Text].
|
| 28.
|
Rink, R.,
M. Fennema,
M. Smids,
U. Dehmel, and D. B. Janssen.
1997.
Primary structure and catalytic mechanism of the epoxide hydrolase from Agrobacterium radiobacter AD1.
J. Biol. Chem.
272:14650-14657[Abstract/Free Full Text].
|
| 29.
|
Russel, D. R., and G. N. Bennet.
1982.
Construction and analysis of in vitro activity of E. coli promoter hybrids and promoter mutants that alter the 35 to 10 spacing.
Gene
20:231-243[Medline].
|
| 30.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 31.
|
Schanstra, J. P.,
R. Rink,
F. Pries, and D. B. Janssen.
1993.
Construction of an expression and site-directed mutagenesis system of haloalkane dehalogenase in Escherichia coli.
Protein Expr. Purif.
4:479-489[Medline].
|
| 32.
|
Schanstra, J. P.,
J. Kingma, and D. B. Janssen.
1996.
Specificity and kinetics of haloalkane dehalogenase.
J. Biol. Chem.
271:14747-14753[Abstract/Free Full Text].
|
| 32a.
| Spelberg, L., et al. Unpublished results.
|
| 33.
|
Strotmann, U. J.,
M. Pentenga, and D. B. Janssen.
1990.
Degradation of 2-chloroethanol by wildtype and mutants of Pseudomonas putida US2.
Arch. Microbiol.
154:294-300.
|
| 34.
|
van den Wijngaard, A. J.,
D. B. Janssen, and B. Witholt.
1989.
Degradation of epichlorohydrin and halohydrins by bacteria isolated from fresh water sediments.
J. Gen. Microbiol.
135:2199-2208.
|
| 35.
|
van den Wijngaard, A. J.,
R. D. Wind, and D. B. Janssen.
1993.
Kinetics of bacterial growth on chlorinated aliphatic compounds.
Appl. Environ. Microbiol.
59:2041-2048[Abstract/Free Full Text].
|
| 36.
|
van der Ploeg, J.,
M. P. Smidt,
A. S. Landa, and D. B. Janssen.
1994.
Identification of chloroacetaldehyde dehydrogenase involved in 1,2-dichloroethane degradation.
Appl. Environ. Microbiol.
60:1599-1605[Abstract/Free Full Text].
|
| 37.
|
van Rijn, J. P.,
N. M. van Straalen, and J. Willems.
1995.
Handboek bestrijdingsmiddelen: gebruik en milieu-effecten, p. 42.
VU uitgeverij, Amsterdam, The Netherlands.
|
| 38.
|
Yokota, T.,
F. Hiroyuki,
T. Omori, and Y. Minoda.
1986.
Microbial dehalogenation of haloalkanes mediated by oxygenases or halidohydrolase.
Agric. Biol. Chem.
50:453-460.
|
| 39.
|
Yokota, T.,
T. Omori, and T. Kodama.
1987.
Purification and properties of haloalkane dehalogenase from Corynebacterium sp. strain m15-3.
J. Bacteriol.
169:4049-4054[Abstract/Free Full Text].
|
Applied and Environmental Microbiology, October 1999, p. 4575-4581, Vol. 65, No. 10
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Jesenska, A., Monincova, M., Koudelakova, T., Hasan, K., Chaloupkova, R., Prokop, Z., Geerlof, A., Damborsky, J.
(2009). Biochemical Characterization of Haloalkane Dehalogenases DrbA and DmbC, Representatives of a Novel Subfamily. Appl. Environ. Microbiol.
75: 5157-5160
[Abstract]
[Full Text]
-
Jesenska, A., Bartos, M., Czernekova, V., Rychlik, I., Pavlik, I., Damborsky, J.
(2002). Cloning and Expression of the Haloalkane Dehalogenase Gene dhmA from Mycobacterium avium N85 and Preliminary Characterization of DhmA. Appl. Environ. Microbiol.
68: 3724-3730
[Abstract]
[Full Text]
-
Bosma, T., Damborsky, J., Stucki, G., Janssen, D. B.
(2002). Biodegradation of 1,2,3-Trichloropropane through Directed Evolution and Heterologous Expression of a Haloalkane Dehalogenase Gene. Appl. Environ. Microbiol.
68: 3582-3587
[Abstract]
[Full Text]
-
van Hylckama Vlieg, J. E. T., Tang, L., Lutje Spelberg, J. H., Smilda, T., Poelarends, G. J., Bosma, T., van Merode, A. E. J., Fraaije, M. W., Janssen, D. B.
(2001). Halohydrin Dehalogenases Are Structurally and Mechanistically Related to Short-Chain Dehydrogenases/Reductases. J. Bacteriol.
183: 5058-5066
[Abstract]
[Full Text]