Previous Article | Next Article 
Applied and Environmental Microbiology, November 1999, p. 4767-4774, Vol. 65, No. 11
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Quantification of Syntrophic Fatty
Acid-
-Oxidizing Bacteria in a Mesophilic Biogas Reactor by
Oligonucleotide Probe Hybridization
Kaare H.
Hansen,1,2
Birgitte K.
Ahring,2 and
Lutgarde
Raskin1,*
Department of Civil and Environmental Engineering,
University of Illinois at Urbana-Champaign, Urbana, Illinois
61801,1 and Department of
Environmental Science and Engineering, Technical University of
Denmark, DK-2800 Lyngby, Denmark2
Received 19 November 1998/Accepted 16 July 1999
 |
ABSTRACT |
Small-subunit rRNA sequences were obtained for two saturated fatty
acid-
-oxidizing syntrophic bacteria, Syntrophomonas
sapovorans and Syntrophomonas wolfei LYB, and
sequence analysis confirmed their classification as members of the
family Syntrophomonadaceae. S. wolfei LYB was
closely related to S. wolfei subsp. wolfei, but
S. sapovorans did not cluster with the other members of the genus Syntrophomonas. Five oligonucleotide probes targeting
the small-subunit rRNA of different groups within the family
Syntrophomonadaceae, which contains all currently known
saturated fatty acid-
-oxidizing syntrophic bacteria, were developed
and characterized. The probes were designed to be specific at the
family, genus, and species levels and were characterized by
temperature-of-dissociation and specificity studies. To demonstrate the
usefulness of the probes for the detection and quantification of
saturated fatty acid-
-oxidizing syntrophic bacteria in methanogenic
environments, the microbial community structure of a sample from a
full-scale biogas plant was determined. Hybridization results with
probes for syntrophic bacteria and methanogens were compared to
specific methanogenic activities and microbial numbers determined with
most-probable-number estimates. Most of the methanogenic rRNA was
comprised of Methanomicrobiales rRNA, suggesting that
members of this order served as the main hydrogen-utilizing
microorganisms. Between 0.2 and 1% of the rRNA was attributed to the
Syntrophomonadaceae, of which the majority was accounted
for by the genus Syntrophomonas.
 |
INTRODUCTION |
In full-scale biogas plants in
Denmark, manure is digested along with industrial organic waste (IOW)
(2). Since digestion of lipids results in a higher methane
yield than digestion of carbohydrates and proteins, biogas plants often
use IOW that is rich in lipids (2). The degradation of
lipids results in the production of fatty acids through the hydrolysis
of triglycerides. Subsequently, saturated fatty acids are degraded by
proton-reducing acetogens in syntrophic association with
hydrogen-utilizing methanogens and aceticlastic methanogens (3, 8,
31, 36). Thus, sufficient levels of saturated fatty
acid-
-oxidizing syntrophs should be present in biogas reactors to
maximize the consumption of butyrate and higher fatty acids.
Only a limited number of saturated fatty acid-degrading syntrophs
(SFAS) have been isolated (either in pure culture or in defined binary
or ternary mixed cultures) and characterized (31). They all
group into a separate cluster within the phylum consisting of
gram-positive organisms and have been placed in the family Syntrophomonadaceae based on comparative small-subunit (SSU)
rRNA sequence analysis (42, 43). This family currently
contains three genera, Syntrophomonas,
Syntrophospora, and Thermosyntropha, as
well as two closely related isolates, strains FSM2 and FSS7 (19,
36, 42, 43). Even though SSU rRNA sequences are available for
strains FSM2 and FSS7, these isolates were lost before they were
deposited in a culture collection (43). SFAS are extremely fastidious organisms (31), with doubling times ranging from 40 h for Syntrophomonas sapovorans (29) to
90 h for Syntrophomonas wolfei subsp. wolfei
(21) grown under optimal conditions with butyrate as a
substrate. Their low growth rates and syntrophic associations make the
characterization of anaerobic microbial consortia particularly challenging.
Previously, oligonucleotide probes targeting the SSU rRNA of
phylogenetic groups of methanogens (26), which are also
fastidious and sometimes difficult to culture, were used to determine
the abundance of and to study the population dynamics of these
microorganisms in anaerobic digesters (16, 27). With
laboratory-scale digesters, it was demonstrated that the combined
application of oligonucleotide probes and traditional performance
measurements can result in an improved understanding of the operation
of engineered reactor systems (16). In this study, we
obtained SSU rRNA sequences for S. wolfei LYB and S. sapovorans, and we designed and characterized oligonucleotide
probes for different phylogenetic groups of the mesophilic members of
the family Syntrophomonadaceae. The new probes, as well as
previously designed probes, were used to characterize the microbial
community in an anaerobic biogas reactor. These hybridization results
were compared with specific methanogenic activities and the numbers of
various microbial groups determined by traditional approaches
(most-probable-number [MPN] estimates).
 |
MATERIALS AND METHODS |
Organisms, culture techniques, and nucleic acid extractions.
The organisms used in this study are listed in Fig.
1. Most organisms were obtained from the
American Type Culture Collection (Manassas, Va.) and the Deutsche
Sammlung von Mikroorganismen und Zellkulturen GmbH (Braunschweig,
Germany). Additional strains were obtained from various collections at
the University of Illinois at Urbana-Champaign and the Oregon
Collection of Methanogens.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 1.
Membrane template used for the specificity study (Fig.
4). OCM, Oregon Collection of Methanogens; DSM, Deutsche Sammlung von
Mikroorganismen und Zellkulturen GmbH; ATCC, American Type Culture
Collection.
|
|
Cultures were grown as recommended by the respective culture
collections and were harvested while the cells were in the exponential
growth phase (25 ml of culture was centrifuged [2,040 ×
g,
10
min, 4°C] and the supernatant was discarded). Gram-negative
cells
were lysed with lysozyme and guanidine isothiocyanate lysing
buffer,
and DNA was extracted by a phenol-chloroform extraction
procedure
(
30). DNA was extracted from gram-positive cells
by a microwave
protocol involving a phenol-chloroform-isoamyl alcohol
extraction
step (
11). Total RNA was extracted from pure
cultures and from
a full-scale biogas reactor sample by a low-pH
hot-phenol extraction
protocol similar to the one described by Stahl et
al. (
34),
except that samples were "bead-beaten" in
intervals of 2 min instead
of 3 min. The quality of the extracted RNA
was evaluated by polyacrylamide
gel electrophoresis (
4) and
quantified with BIT image analysis
software (Bioimaging Technologies,
Elburn, Ill.).
Cloning, sequencing, and in vitro transcription.
SSU rRNA
gene amplifications were performed in 50-µl reaction mixtures with
1× PCR buffer (Gibco BRL, Gaithersburg, Md.), 1 to 100 ng of DNA, 10 pmol of each primer, 2 µl of 50 mM MgCl2, 2 µl of each
deoxynucleoside triphosphate at 1.25 mM (Promega Corp., Madison, Wis.),
and 1.25 U of Taq polymerase (Gibco BRL). The PCR was
carried out in a PTC-200 thermocycler (MJ Research Inc., Watertown,
Mass.) with an initial cycle of 4 min at 95°C and then 30 cycles of 1 min at 92°C, 1 min at 50°C, and 1 min at 72°C. After the last
cycle, the mixtures were kept at 72°C for an additional 5 min before
termination of the reaction. The following primer pair was used:
S-D-Bact-0011-a-S-17 (GTTTGATCCTGGCTCAG) and
S-D-Bact-1492-a-A-21 (ACGGYTACCTTGTTACGACTT) (5,
17) or S-D-Bact-0008-a-S-21 (CAGAGTTTGATCCTGGCTCAG)
and S-*-Univ-1508-a-A-21 (ACGGCTACCTTGTTACGACTT)
(40). The purity of the PCR product was evaluated by
0.7% agarose gel electrophoresis. Pure PCR product was ligated into a
TA cloning vector (pCR2.1) with a TA cloning kit (Invitrogen
Corporation, San Diego, Calif.). Cell pellets were prepared from an
overnight growth of transformed Escherichia coli cells. One
each of the clones containing the SSU rRNA genes of S. sapovorans and S. wolfei LYB was sequenced with four
primers specific for the bacterial domain, S-*-Bact-0343-a-S-15
(TACGGGAGGCAGCAG), S-*-Bact-0519-a-A-18
(GTATTACCGCGGCTGCTG), S-*-Bact-0907-a-S-20 (AAACTCAAATGAATTGACGG), and S-*-Bact-1100-a-A-16
(AGGGTTGCGCTCGTTG) (12), and the M13(
20)
forward and M13 reverse primers (Invitrogen Corporation). An additional
clone each for S. sapovorans and S. wolfei LYB
was sequenced with the M13 primer set, S-*-Bact-0343-a-S-15, and
S-*-Bact-1100-a-A-16. Sequencing was performed by the University of
Illinois Biotechnology Center, Genetic Engineering Facility (Urbana).
Clones of
S. wolfei subsp.
wolfei and
Syntrophospora bryantii were partially sequenced [with only
the M13(

20) forward primer]
to ensure that the gene was inserted in
the right direction for
subsequent in vitro transcription. SSU rRNA
transcripts were produced
in vitro with purified linearized plasmid and
T7 RNA polymerase
from the Ampliscribe transcription kit (Epicentre
Technologies,
Madison, Wis.) (
22).
Phylogenetic analyses.
Alignment analyses were performed
with the sequences available for the members of the
Syntrophomonadaceae with the CLUSTAL W program (version 1.6)
(38). The sequences were further aligned by hand and gaps
and unknown bases were not considered, resulting in 1,081 nucleotides
per sequence. A phylogenetic analysis was performed with DNAML, a
maximum-likelihood program available in the PHYLIP package, with a
transition/transversion rate set at 2.000 (13).
Design and characterization of oligonucleotide probes.
The
SSU rRNA sequences of S. wolfei LYB and S. sapovorans (obtained in this study), of S. bryantii and
S. wolfei subsp. wolfei (available in the
Ribosomal Database Project [20]), and of strains FSM2
and FSS7 (kindly provided by Carl R. Woese) were used for oligonucleotide probe design. Five probes were designed to target the
mesophilic members of the family Syntrophomonadaceae at
different levels of specificity. The probes and their target groups are shown in Fig. 2 and
3. The probes were synthesized with a DNA synthesizer (Applied Biosystems, Foster City, Calif.) at the University of Illinois Biotechnology Center, Genetic Engineering Facility, and
purified with an oligonucleotide purification cartridge (Applied Biosystems), and the 5' ends were labeled with
[
-32P]ATP (ICN Radiochemicals, Irvine, Calif.) by
bacteriophage T4 polynucleotide kinase (Promega Corp.)
(26). A universal base analogue, 5-nitroindole
(N5) (Glen Research, Sterling, Va.) (18), was
incorporated during the synthesis of one of the probes
(S-F-Synm-0700-a-A-23).

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 2.
Unrooted phylogenetic tree for the family
Syntrophomonadaceae, inferred from comparisons of SSU rRNA
sequences with a maximum-likelihood algorithm. The tree was constructed
with the evolutionary distances shown in Table 2.
|
|

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 3.
Td studies for probes
S-F-Synm-0700-a-A-23, S-G-Synm-0126-a-A-19, S-S-S.bry-0181-a-A-21,
S-S-S.sap-0181-a-A-20, and S-S-S.wol-0180-a-A-21. Adjacent to the probe
dissociation results are SSU rRNA sequences of target and nontarget
species and probe sequences. The top SSU rRNA sequences for each list
of organisms are those of the target organisms. Dashes in the
succeeding sequences signify identical nucleotides. A superscript
a indicates that an unlabeled version of the competitive
probe was used with the labeled probe; X represents the universal base
analogue N5. A superscript b indicates organisms
that were not included in the experimental evaluation of probe
specificity. A superscript c indicates that the organism was
not included in the experimental evaluation of probe specificity due to
three significant mismatches.
|
|
Temperature-of-dissociation (
Td) curves were
determined for the five oligonucleotide probes with various target and
nontarget
SSU rRNAs, according to the elution method described by Zheng
et al. (
44). Subsequently, the posthybridization wash
temperature
(
Tw) was determined by the
replicate-slot
Td method (
44) for
four temperatures around the previously determined
Tds.
The specificities of the five oligonucleotide probes and universal
probe S-*-Univ-1390-a-A-18 (
44) were evaluated by applying
approximately 30 ng of total RNA extracted from 39 organisms,
representing a wide phylogenetic diversity (Fig.
1), to six Magna
Charge membranes (Micron Separations, Inc., Westboro, Mass.).
Prehybridization, hybridization, wash, and imaging procedures
were
described previously (
25,
44). A
Tw
of 44°C was used
for the universal probe (
44), and the
Tws used for the five
probes designed in this
study are listed in Table
1.
Anaerobic biogas reactor analyses.
A 2-liter sample was
collected from the full-scale mesophilic biogas reactor in Hashøj,
Denmark (37). The biogas plant consists of a single
continuously stirred tank reactor of 3,000 m3 and is
operated at a retention time of approximately 30 days. The plant treats
a mixture of swine and cattle manure and a variety of IOW streams.
Analyses of volatile solids (VS) and total solids were performed
according to standard methods (15). Volatile fatty acids
(VFAs) were determined with a gas chromatograph (model 5890;
Hewlett-Packard, Palo Alto, Calif.) equipped with a flame ionization
detector. Specific methanogenic activities (SMA) were determined with
BA medium (9) containing acetate, hydrogen and carbon
dioxide, butyrate, and propionate as substrates (32, 33).
The SMA tests were initiated less than 5 h after sampling.
Triplicate MPN determinations were performed in BA medium
(
9) with glucose, butyrate, propionate, acetate, and
hydrogen
as substrates. Furthermore, sulfate-reducing bacteria were
enumerated
by using Postgate medium, which contains lactate as the
substrate
(
24).
Quantitative membrane hybridizations were performed by triplicate
applications of 30 ng of denatured RNA, extracted from the
sample
obtained from the biogas reactor, to Magna Charge membranes
(Micron
Separations, Inc.) in combination with dilution series
of pure-culture
RNA samples (
28). Hybridizations with
32P-labeled oligonucleotide probes were performed as
previously
described (
25), and hybridization results were
analyzed with
a PhosphorImager (Molecular Dynamics, Sunnyvale, Calif.)
(
23,
44). In addition to the five probes designed in this
study,
the following SSU rRNA-targeted probes were used, with the
Tws
given in parentheses: S-*-Univ-1390-a-A-18
(44°C), S-D-Euca-0502-a-A-16
(58°C), S-D-Bact-0338-a-A-18 (54°C),
S-D-Arch-0915-a-A-20 (58°C),
S-O-Msar-0860-a-A-21 (60°C),
S-G-Msar-0821-a-A-21 (60°C), S-F-Mcoc-1109-a-A-20
(55°C),
S-F-Mbac-310-a-A-22 (57°C), S-O-Mmic-1200-a-A-21 (53°C),
and
S-S-M.con-0381-a-A-22 (56°C [
45]). Original
citations for
the first nine probes can be found in the Oligonucleotide
Probe
Database (
5). The
Tws for the
five probes designed in this
study are listed in Table
1.
Nucleotide sequence accession numbers.
Nucleotide sequences
have been deposited in the GenBank database under the accession no.
AF022248 for S. wolfei LYB and AF022249 for S. sapovorans.
 |
RESULTS AND DISCUSSION |
Sequence analysis.
The phylogenetic analysis of the SSU rRNA
sequences confirmed that S. sapovorans and S. wolfei LYB, the sequences of which were obtained in this study,
are members of the family Syntrophomonadaceae (Fig. 2 and
Table 2). As expected, S. wolfei LYB is closely related to S. wolfei subsp.
wolfei (evolutionary distance, 1.88 [Table 2]). However,
the alignment of the rRNA sequence for S. sapovorans indicates that this strain does not cluster with the other members of
the genus Syntrophomonas (Fig. 2) and that the evolutionary distance between S. sapovorans and the two other members of
the Syntrophomonas genus is about 9 (Table 2). S. sapovorans is somewhat more closely related to one (strain FSS7)
of the two uncharacterized members of the family
Syntrophomonadaceae and to the recently characterized
thermophilic syntrophic species Thermosyntropha lipolytica.
Based on our phylogenetic analysis, we suggest that S. sapovorans be considered a representative of a new genus.
Design of oligonucleotide probes.
Probe design was based on
the previously published phylogeny of the
Syntrophomonadaceae (43) and
Syntrophomonas genus characterization (19).
Probes targeting each of the three mesophilic
Syntrophomonadaceae species were designed:
S-S-S.bry-0181-a-A-21 (S. bryantii), S-S-S.sap-0181-a-A-20 (S. sapovorans), and S-S-S.wol-0180-a-A-21 (S. wolfei) (Fig. 2). The specificities of the oligonucleotide
probes were determined with CHECK_PROBE software provided through
the Ribosomal Database Project (20) and the Oligonucleotide
Probe Database (5) and with BLAST software available from
the National Center for Biotechnology Information (6).
Figure 3 shows sequence alignments of the probes with target organisms
and a few nontarget organisms. The probes were found to have at least
three mismatches with the nearest nontarget SSU rRNA. The three probes
target a region of the SSU rRNA (positions 180 to 201, according to
E. coli numbering) which corresponds to the target region of
a number of probes that were previously used successfully for
whole-cell hybridizations (7), indicating that the
species-specific probes designed in this study will likely perform well
for whole-cell hybridizations.
A probe targeting all currently known species of the genus
Syntrophomonas, including
S. sapovorans, was also
designed (S-G-Synm-0126-a-A-19)
(Fig.
2). This probe perfectly matched
the SSU rRNA of all target
organisms and had at least two mismatches
with the nearest nontarget
organisms (Fig.
3).
Finally, a probe targeting all mesophilic members of the family
Syntrophomonadaceae (S-F-Synm-0700-a-A-23) was designed
(Fig.
2). At position 716 (according to
E. coli numbering),
the SSU
rRNA of the target organisms contains a C or a T (Fig.
3). In
order to ensure equal specificity of the probe to all target organisms,
a universal base analogue, N
5, was used in this location
(
18).
This approach was previously successful for the design
of an SSU
rRNA-targeted probe for mycolic acid-containing actinomycetes
(
10). Probe S-F-Synm-0700-a-A-23 has one T-G mismatch
(position
720, according to
E. coli numbering) with the
recently described
thermophilic member of the
Syntrophomonadaceae
T. lipolytica.
Since a T-G mismatch is considered to have little
effect on hybridization
(
39), it is likely that the probe
also binds to
T. lipolytica (this was not evaluated
experimentally as part of this study).
Consequently, probe
S-F-Synm-0700-a-A-23 may be a family-specific
probe for all presently
described members of the
Syntrophomonadaceae.
Furthermore,
probe S-F-Synm-0700-a-A-23 may have only one mismatch
with the
nontarget organism
Achromatium oxaliferum (Fig.
3). This
organism has been isolated from freshwater sediments and appears
to
have a role in the oxidation of reduced sulfur species to sulfate
(
14). Therefore, it is unlikely that
A. oxaliferum plays a role
in anaerobic reactors. The SSU rRNA of
Desulfovibrio sapovorans has one or two mismatches
with the family-specific probe (Fig.
3). In order to eliminate
the potential binding of this probe
to nontarget species, a
competitive probe targeting
D. sapovorans was designed
(S-F-Synm-0700-p-A-23 [ACTGGTN
5TTCCTCCTGATATCTA]).
An
unlabeled version of this probe was always used with the labeled
probe
S-F-Synm-0700-a-A-23 in a 1:1
ratio.
Optimization of Tws.
Since the
oligonucleotide probes designed in this study were to be used to
quantify the SSU rRNA extracted from complex microbial systems, it was
necessary to determine the optimal Tw
experimentally. The Td, or the temperature at
which 50% of the oligonucleotide remains bound to a perfect target
(39), is generally used as the posthybridization
Tw to ensure the dissociation of duplexes with
one or more mismatches (35). Figure 3 shows representative Td curves for the five probes and sequence
alignments of the probes with the target and nontarget organisms used
in the Td studies. The experimentally determined
Tds are summarized in Table 1. The
Tds of the five oligonucleotides ranged from 49 to 55°C. Probe S-F-Synm-0700-a-A-23 demonstrated the largest
variation in Td among different target organisms
(50 to 53°C) (Table 1). This variation can be explained by small
differences in the duplex stability for the various target SSU rRNAs
due to the incorporation of N5 into this probe
(18).
Tds determined by the elution method (which
involves a 10-min wash) are typically slightly higher than those
obtained with
a
Td experiment involving a 30-min
wash (
44). Since the posthybridization
wash step during
routine quantitative hybridizations lasts 30
min (
44), a
hybridization experiment was performed to determine
the optimal
Tws. This experiment involved the use of four
different
posthybridization
Tws close to the
experimentally determined
Tds.
Tws were selected such that the probes bound
only to the desired
targets while maintaining as much of the
hybridization signals
as possible. The resulting
Tws (Table
1) were generally 1 to
2°C below
the
Tds, except for that of probe
S-F-Synm-0700-a-A-23.
Probe specificity studies.
RNA samples obtained from a diverse
selection of 39 target and nontarget organisms (Fig. 1) were hybridized
with a universal probe and the five newly designed probes to assess
probe specificities. Figure 4 shows the
hybridization membranes for this specificity study. The hybridization
result obtained with the universal probe, S-*-Univ-1390-a-A-18 (Fig.
4a), indicates that target and nontarget RNAs were applied to the
membranes at approximately the same levels. Hybridization results for
the five newly designed probes show that they bound only to their
target RNA (Fig. 4b to f), as expected from database searches. The
hybridization signal of probe S-F-Synm-0700-a-A-23 for the SSU rRNA of
S. wolfei LYB was slightly lower than the response obtained
for the SSU rRNA of the other members of the family
Syntrophomonadaceae (Fig. 4b). This observation was in accordance with the experimentally determined
Tds (Table 1).

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 4.
Results of the probe specificity study. Membrane
hybridization results were analyzed with a PhosphorImager and were
scanned and printed with Adobe Photoshop 3.0 (Adobe, Seattle, Wash.).
(a) Probe S-*-Univ-1390-a-A-18; (b) probe S-F-Synm-0700-a-A-23; (c)
probe S-G-Synm-0126-a-A-19; (d) probe S-S-S.bry-0181-a-A-21; (e) probe
S-S-S.sap-0181-a-A-20; (f) probe S-S-S.wol-0180-a-A-21.
|
|
Anaerobic biogas reactor analyses.
Influent and effluent grab
samples were obtained from the full-scale mesophilic biogas reactor in
Hashøj, Denmark. The reactor influent, which consisted of a mixture of
swine and cattle manure and a variety of IOW streams, had a VS content
of 79 kg/m3. The VS level of the reactor effluent was 53 kg/m3, corresponding to a 33% removal of VS. The plant
produced 0.38 m3 of biogas per kg of VS, with a methane
content of 70%. Acetate, propionate, butyrate, and isobutyrate levels
in the effluent were low (Table 3),
indicating that the reactor exhibited stable performance.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Concentrations of VFAs in samples of influent and
effluent of the full-scale mesophilic biogas reactor in
Hashøj, Denmark
|
|
Fifteen different oligonucleotide probes targeting the SSU rRNA of the
three domains, phylogenetically defined groups of methanogens,
and the
SFAS were used in quantitative membrane hybridizations
with RNA
extracted from a sample obtained from the biogas reactor.
Only seven of
the probes resulted in a hybridization response
above the detection
limit. Detection limits varied with probe
labeling efficiency, the
amount of nucleic acid applied to the
hybridization membrane, and the
length of exposure of the hybridization
membranes and are therefore
different for each sample and probe.
In general, the detection limits
for our standard hybridization
protocol varied between 0.1 and 0.2%.
The values obtained with
the domain-specific probes correspond with
previous studies of
anaerobic digester microbial communities. For
example, the archaeal
(methanogen) rRNA level of 13% ± 2% (mean ± standard deviation,
determined with probe S-D-Arch-0915-a-A-20)
corresponds well with
the archaeal rRNA concentration of 8 to 12% for
stable mesophilic
sewage sludge digesters (
27). The levels
of SSU rRNA were low
for the
Eucarya (0.3% ± 0.2%) and
high for the
Bacteria (79% ±
3%) (determined with probes
S-D-Euca-0502-a-A-16 and S-D-Bact-0338-a-A-18,
respectively), which is
consistent with values obtained in other
digester studies (
16,
27). The combined use of the domain-specific
probes targeted most
of the rRNA present in the biogas reactor
sample. The sum of the
percentages obtained with the three domains
was 92% ± 4%, which is
close to the expected value of 100%.
The results obtained with the various methanogenic probes indicate that
most of the methanogenic SSU rRNA was comprised of
Methanomicrobiales SSU rRNA (probe S-O-Mmic-1200-a-A-21
detected
10% ± 1% of the total SSU rRNA). Thus, members of the
Methanomicrobiales were the dominant hydrogenotrophic
methanogens and may have served
as the hydrogen-utilizing partners of
the
Syntrophomonadaceae in the biogas reactor. A small but
significant number of
Syntrophomonadaceae was present (probe
S-F-Synm-0700-a-A-23 targeted 0.2 to 1% of
the SSU rRNA). The only
specific probe that resulted in a detectable
signal was probe
S-G-Synm-0126-a-A-19 (0.2 to 1%), indicating
that species of the genus
Syntrophomonas were likely responsible
for butyrate
degradation in the biogas reactor.
Methanosarcinales were
the only other methanogens that were present at detectable
levels
(0.6% ± 0.5%). A probe specific for
Methanosaeta concilii (S-S-M.con-0381-a-A-22) (
45) did not result in a detectable
signal. Even though it is possible that other acetate scavengers
(e.g.,
Methanosaeta spp. not detected by probe
S-S-M.con-0381-a-A-22)
were present in the biogas reactor, it is likely
that
Methanosarcina spp. served as the aceticlastic
methanogens in the biogas reactor.
This result is consistent with
previous studies, which demonstrated
that
Methanosarcina
spp. were almost always found to be the main
acetate utilizers in
Danish biogas plants (
1). The low acetate
level in the
reactor (Table
3) was close to the threshold level
of mesophilic
Methanosarcina spp. (
41), indicating that this
group performed well in this reactor. The low overall levels of
aceticlastic methanogens (
Methanosarcinales) and relatively
high
levels of hydrogenotrophic methanogens
(
Methanomicrobiales) may
also indicate that a syntrophic
relationship between an acetate-oxidizing
organism and a
hydrogenotrophic methanogen was the major route
of acetate degradation
in this biogas
reactor.
The MPN estimates and SMA measurements are summarized in Table
4. In addition, the levels of SSU rRNA
obtained for different
groups that generally correspond to groups
utilizing the different
substrates used in the MPN and activity tests
are also given in
Table
4. The MPN estimates, SMA measurements, and
oligonucleotide
probe hybridization results correlated well. For
example, the
hydrogen and carbon dioxide utilizers (hydrogenotrophic
methanogens)
were found to be the most abundant (or most active)
microorganisms
by all three methods. The SMA values obtained with
butyrate and
propionate as the substrates were similar to the SMA
measurement
obtained with the control system, to which no external
substrate
was added. Since butyrate- and propionate-degrading organisms
have low affinities for their substrates, it is likely that the
butyrate and propionate concentrations in the control system were
close
to their respective substrate saturation constants (
32).
The
relatively low numbers of butyrate-degrading organisms further
imply
that these bacteria have high metabolic rates, which is
in accordance
with the low energy yields that can be obtained
from the oxidation of
VFAs. Finally, it is also possible that
bacteria other than the ones
detected by our probes are responsible
for the transformation of
butyrate in this biogas reactor.
View this table:
[in this window]
[in a new window]
|
TABLE 4.
Results obtained with three different activity tests (MPN
estimates, SMA measurements, and quantitative membrane hybridizations)
for grab samples taken from the full-scale mesophilic biogas reactor in
Hashøj, Denmark
|
|
 |
ACKNOWLEDGMENTS |
We thank Carl Woese for providing the SSU rRNA sequences of
strains FSM2 and FSS7, Katherine D. McMahon for assistance with the
generation of transcripts, and Daniel B. Oerther and Dandan Zheng for
helpful discussions.
This research was funded by grants from the Office of Solid Waste
Research (University of Illinois) to L.R. and from the Danish Science
Committee, Biotechnology Program, to K.H.H. and B.K.A.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Civil and Environmental Engineering, University of Illinois at
Urbana-Champaign, 3221 Newmark Civil Engineering Laboratory, 205 N. Mathews Ave., Urbana, IL 61801. Phone: (217) 333-6964. Fax: (217)
333-6968. E-mail: lraskin{at}uiuc.edu.
 |
REFERENCES |
| 1.
|
Ahring, B. K.
1995.
Methanogenesis in thermophilic biogas reactors.
Antonie Leeuwenhoek
67:91-102.
|
| 2.
|
Ahring, B. K.,
I. Angelidaki, and K. Johansen.
1992.
Anaerobic treatment of manure together with industrial waste.
Water Sci. Technol.
25:311-318.
|
| 3.
|
Ahring, B. K., and P. Westermann.
1987.
Thermophilic anaerobic degradation of butyrate by a butyrate-utilizing bacterium in coculture and triculture with methanogenic bacteria.
Appl. Environ. Microbiol.
53:429-433[Abstract/Free Full Text].
|
| 4.
| Alm, E. W., and D. Stahl. Critical factors
influencing the recovery and integrity of rRNA extracted from
environmental samples: use of an optimized protocol to measure
depth-related biomass distribution in freshwater sediments. Submitted
for publication.
|
| 5.
|
Alm, E. W.,
D. B. Oerther,
N. Larsen,
D. A. Stahl, and L. Raskin.
1996.
The oligonucleotide probe database.
Appl. Environ. Microbiol.
62:3557-3559[Medline].
|
| 6.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[Medline].
|
| 7.
|
Amann, R. I.,
W. Ludwig, and K.-H. Schleifer.
1995.
Phylogenetic identification and in situ detection of individual microbial cells without cultivation.
Microbiol. Rev.
59:143-169[Abstract/Free Full Text].
|
| 8.
|
Angelidaki, I., and B. K. Ahring.
1995.
Establishment and characterization of an anaerobic thermophilic (55°C) enrichment culture degrading long-chain fatty acids.
Appl. Environ. Microbiol.
61:2442-2445[Abstract].
|
| 9.
|
Angelidaki, I.,
S. P. Petersen, and B. K. Ahring.
1990.
Effects of lipids on thermophilic anaerobic digestion and reduction of lipid inhibition upon addition of bentonite.
Appl. Microbiol. Biotechnol.
33:469-472[Medline].
|
| 10.
|
de los Reyes, F. L.,
W. Ritter, and L. Raskin.
1997.
Group-specific small-subunit rRNA hybridization probes to characterize filamentous foaming in activated sludge systems.
Appl. Environ. Microbiol.
63:1107-1117[Abstract].
|
| 11.
|
de los Reyes, M. F.,
F. L. de los Reyes, III,
M. Hernandez, and L. Raskin.
1998.
Quantification of Gordona amarae strains in foaming activated sludge and anaerobic digester systems with oligonucleotide hybridization probes.
Appl. Environ. Microbiol.
64:2503-2512[Abstract/Free Full Text].
|
| 12.
|
Dorsch, M., and E. Stackebrandt.
1992.
Some modifications in the procedure of direct sequencing of PCR amplified 16S rDNA.
J. Microbiol. Methods
16:271-279.
|
| 13.
|
Felsenstein, J.
1981.
Evolutionary trees from DNA sequences: a maximum likelihood approach.
J. Mol. Evol.
17:368-376[Medline].
|
| 14.
|
Gray, N. D.,
R. W. Pickup,
J. G. Jones, and I. M. Head.
1997.
Ecophysiological evidence that Achromatium oxaliferum is responsible for the oxidation of reduced sulfur species to sulfate in a freshwater sediment.
Appl. Environ. Microbiol.
63:1905-1910[Abstract].
|
| 15.
|
Greenberg, A. E.,
L. S. Clesceri, and A. D. Eaton (ed.).
1992.
Standard methods for the examination of water and wastewater, 18th ed.
American Public Health Association, Washington, D.C.
|
| 16.
|
Griffin, M. E.,
K. D. McMahon,
R. I. Mackie, and L. Raskin.
1998.
Methanogenic population dynamics during start-up of anaerobic digesters treating municipal solid waste and biosolids.
Biotechnol. Bioeng.
57:342-355[Medline].
|
| 17.
|
Kane, M. D.,
L. K. Poulsen, and D. A. Stahl.
1993.
Monitoring the enrichment and isolation of sulfate-reducing bacteria by using oligonucleotide hybridization probes designed from environmentally derived 16S rRNA sequences.
Appl. Environ. Microbiol.
59:682-686[Abstract/Free Full Text].
|
| 18.
|
Loakes, D., and D. M. Brown.
1994.
5-Nitroindole as an universal base analogue.
Nucleic Acids Res.
22:4039-4043[Abstract/Free Full Text].
|
| 19.
|
Lorowitz, W. H.,
H. Zhao, and M. P. Bryant.
1989.
Syntrophomonas wolfei subsp. saponavida subsp. nov., a long-chain fatty-acid-degrading, anaerobic, syntrophic bacterium; Syntrophomonas wolfei subsp. wolfei subsp. nov.; and emended descriptions of the genus and species.
Int. J. Syst. Bacteriol.
39:122-126[Abstract/Free Full Text].
|
| 20.
|
Maidak, B. L.,
N. Larsen,
M. J. McCaughey,
R. Overbeek,
G. J. Olsen,
K. Forgel,
J. Blanby, and C. R. Woese.
1997.
The RDP (Ribosomal Database Project).
Nucleic Acids Res.
25:109-111[Abstract/Free Full Text].
|
| 21.
|
McInerney, M. J.,
M. P. Bryant,
R. B. Hespell, and J. W. Costerton.
1981.
Syntrophomonas wolfei gen. nov. sp. nov., an anaerobic, syntrophic, fatty acid-oxidizing bacterium.
Appl. Environ. Microbiol.
41:1029-1039[Abstract/Free Full Text].
|
| 22.
|
McMahon, K. D.,
D. A. Stahl, and L. Raskin.
1998.
A comparison of the use of in vitro-transcribed and native rRNA for the quantification of microorganisms in the environment.
Microb. Ecol.
36:362-371[Medline].
|
| 23.
|
Porter, K. G., and Y. S. Feig.
1980.
The use of DAPI for identifying and counting aquatic microflorae.
Limnol. Oceanogr.
25:943-948.
|
| 24.
|
Postgate, J. R.
1963.
Versatile medium for the enumeration of sulfate-reducing bacteria.
Appl. Microbiol.
11:265-267.
|
| 25.
|
Raskin, L.,
L. K. Poulsen,
D. R. Noguera,
B. E. Rittmann, and D. A. Stahl.
1994.
Quantification of methanogenic groups in anaerobic biological reactors by oligonucleotide probe hybridization.
Appl. Environ. Microbiol.
60:1241-1248[Abstract/Free Full Text].
|
| 26.
|
Raskin, L.,
J. M. Stromley,
B. E. Rittmann, and D. A. Stahl.
1994.
Group-specific 16S rRNA hybridization probes to describe natural communities of methanogens.
Appl. Environ. Microbiol.
60:1232-1240[Abstract/Free Full Text].
|
| 27.
|
Raskin, L.,
D. Zheng,
M. E. Griffin,
P. G. Stroot, and P. Misra.
1995.
Characterization of microbial communities in anaerobic bioreactors using molecular probes.
Antonie Leeuwenhoek
68:297-308.
|
| 28.
|
Raskin, L.,
W. C. Capman,
R. Sharp,
L. K. Poulsen, and D. A. Stahl.
1997.
Molecular ecology of gastrointestinal ecosystems, p. 243-298.
In
R. I. Mackie, B. A. White, and R. E. Isaacson (ed.), Gastrointestinal microbiology, vol. 2. Gastrointestinal microbes and host interactions. Chapman & Hall, New York, N.Y
|
| 29.
|
Roy, F.,
E. Samain,
H. C. Dubourguir, and G. Albagnac.
1986.
Syntrophomonas sapovorans sp. nov., a new obligately proton reducing anaerobe oxidizing saturated and unsaturated long chain fatty acids.
Arch. Microbiol.
145:142-147.
|
| 30.
|
Saunders, N. A.,
T. G. Harrison,
A. Haththotuwa,
N. Kachwalla, and A. G. Taylor.
1990.
A method for typing strains of Legionella pneumophila serogroup 1 by analysis of restriction fragment length polymorphism.
J. Med. Microbiol.
31:45-55[Abstract/Free Full Text].
|
| 31.
|
Schink, B.
1997.
Energetics of syntrophic cooperation in methanogenic degradation.
Microbiol. Mol. Biol. Rev.
61:262-280[Abstract].
|
| 32.
|
Sørensen, A. H., and B. K. Ahring.
1993.
Measurement of the specific methanogenic activity of anaerobic digestor biomass.
Appl. Microbiol. Biotechnol.
40:427-431.
|
| 33.
|
Soto, M.,
R. Méndez, and J. M. Lema.
1993.
Methanogenic and non-methanogenic activity tests. Theoretical basis and experimental set up.
Water Res.
27:1361-1376.
|
| 34.
|
Stahl, D. A.,
B. Flesher,
H. R. Mansfield, and L. Montgomery.
1988.
Use of phylogenetically based hybridization probes for studies of ruminal microbial ecology.
Appl. Environ. Microbiol.
54:1079-1084[Abstract/Free Full Text].
|
| 35.
|
Stahl, D. A., and R. Amann.
1991.
Development and application of nucleic acid probes, p. 205-248.
In
E. Stackebrandt, and M. Goodfellow (ed.), Nucleic acid techniques in bacterial systematics. John Wiley and Sons, Ltd., New York, N.Y
|
| 36.
|
Svetlitshnyi, V.,
F. Rainey, and J. Wiegel.
1996.
Thermosyntropha lipolytica gen. nov., sp. nov., a lipolytic, anaerobic, alkalitolerant, thermophilic bacterium utilizing short- and long-chain fatty acids in syntrophic coculture with a methanogenic archaeum.
Int. J. Syst. Bacteriol.
46:1131-1137[Abstract/Free Full Text].
|
| 37.
|
Tafdrup, S.
1994.
Centralized biogas plants combine agricultural and environmental benefits with energy production.
Water Sci. Technol.
30:133-141.
|
| 38.
|
Thompson, J. D.,
D. G. Higgins, and T. J. Gibson.
1994.
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.
Nucleic Acids Res.
22:4673-4680[Abstract/Free Full Text].
|
| 39.
|
Tijssen, P.
1993.
Hybridization of nucleic acid probes, part I. Theory and nucleic acid preparation, p. 268.
Elsevier Science Publishers B. V., Amsterdam, The Netherlands
|
| 40.
|
Weisburg, W. G.,
S. M. Barns,
D. A. Pelletier, and D. J. Lane.
1991.
16S ribosomal DNA amplification for phylogenetic study.
J. Bacteriol.
173:697-703[Abstract/Free Full Text].
|
| 41.
|
Westermann, P.,
B. K. Ahring, and R. A. Mah.
1989.
Threshold acetate concentrations for acetate catabolism by aceticlastic methanogenic bacteria.
Appl. Environ. Microbiol.
55:514-515[Abstract/Free Full Text].
|
| 42.
|
Zhao, H.,
D. Yang,
C. R. Woese, and M. P. Bryant.
1990.
Assignment of Clostridium bryantii to Syntrophospora bryantii gen. nov., comb. nov. on the basis of a 16S rRNA sequence analysis of its crotonate-grown pure culture.
Int. J. Syst. Bacteriol.
40:40-44[Abstract/Free Full Text].
|
| 43.
|
Zhao, H.,
D. Yang,
C. R. Woese, and M. P. Bryant.
1993.
Assignment of fatty acid- -oxidizing syntrophic bacteria to Syntrophomonadaceae fam. nov. on the basis of 16S rRNA sequence analyses.
Int. J. Syst. Bacteriol.
43:278-286.
|
| 44.
|
Zheng, D.,
E. W. Alm,
D. A. Stahl, and L. Raskin.
1996.
Characterization of universal small-subunit rRNA hybridization probes for quantitative molecular microbial ecology studies.
Appl. Environ. Microbiol.
62:4504-4513[Abstract].
|
| 45.
| Zheng, D., and L. Raskin. Unpublished data.
|
Applied and Environmental Microbiology, November 1999, p. 4767-4774, Vol. 65, No. 11
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Hatamoto, M., Imachi, H., Yashiro, Y., Ohashi, A., Harada, H.
(2008). Detection of Active Butyrate-Degrading Microorganisms in Methanogenic Sludges by RNA-Based Stable Isotope Probing. Appl. Environ. Microbiol.
74: 3610-3614
[Abstract]
[Full Text]
-
Hatamoto, M., Imachi, H., Yashiro, Y., Ohashi, A., Harada, H.
(2007). Diversity of Anaerobic Microorganisms Involved in Long-Chain Fatty Acid Degradation in Methanogenic Sludges as Revealed by RNA-Based Stable Isotope Probing. Appl. Environ. Microbiol.
73: 4119-4127
[Abstract]
[Full Text]
-
Pozhitkov, A. E., Stedtfeld, R. D., Hashsham, S. A., Noble, P. A.
(2007). Revision of the nonequilibrium thermal dissociation and stringent washing approaches for identification of mixed nucleic acid targets by microarrays. Nucleic Acids Res
35: e70-e70
[Abstract]
[Full Text]
-
Hatamoto, M., Imachi, H., Ohashi, A., Harada, H.
(2007). Identification and Cultivation of Anaerobic, Syntrophic Long-Chain Fatty Acid-Degrading Microbes from Mesophilic and Thermophilic Methanogenic Sludges. Appl. Environ. Microbiol.
73: 1332-1340
[Abstract]
[Full Text]
-
Karakashev, D., Batstone, D. J., Angelidaki, I.
(2005). Influence of Environmental Conditions on Methanogenic Compositions in Anaerobic Biogas Reactors. Appl. Environ. Microbiol.
71: 331-338
[Abstract]
[Full Text]
-
Loakes, D.
(2001). SURVEY AND SUMMARY: The applications of universal DNA base analogues. Nucleic Acids Res
29: 2437-2447
[Abstract]
[Full Text]
-
Fernandez, A. S., Hashsham, S. A., Dollhopf, S. L., Raskin, L., Glagoleva, O., Dazzo, F. B., Hickey, R. F., Criddle, C. S., Tiedje, J. M.
(2000). Flexible Community Structure Correlates with Stable Community Function in Methanogenic Bioreactor Communities Perturbed by Glucose. Appl. Environ. Microbiol.
66: 4058-4067
[Abstract]
[Full Text]