Previous Article | Next Article ![]()
Applied and Environmental Microbiology, November 1999, p. 4837-4847, Vol. 65, No. 11
Institut für Mikrobiologie der
Westfälischen Wilhelms-Universität Münster, D-48149
Münster, Germany
Received 12 May 1999/Accepted 23 August 1999
The gene loci fcs, encoding feruloyl coenzyme A
(feruloyl-CoA) synthetase, ech, encoding enoyl-CoA
hydratase/aldolase, and aat, encoding Vanillin
(4-hydroxy-3-methoxybenzaldehyde) is one of the most important aromatic
flavor compounds used in the food- and perfume-producing industries. "Artificial" or "nature-identical" vanillin
is currently produced from petrochemicals and from lignin
(9), but there is a growing interest in producing
"natural" vanillin by biotransformations (17, 21).
Phenolic stilbenes, eugenol (4-allyl-2-methoxyphenol), ferulic acid
(4-hydroxy-3-methoxycinnamate), and lignin were found to be potential
substrates for these biotransformation processes, since vanillin occurs
as an intermediate in the corresponding degradation routes (8, 37,
44, 45). Only recently, a biotechnological production of vanillin
starting from glucose was proposed (23). A biotransformation
process of eugenol to vanillin, based on a new Pseudomonas
sp. (strain HR199), which was able to produce methoxyphenol type aroma
chemicals from eugenol (32), was developed by Rabenhorst and
Hopp (33).
We are currently investigating the physiological and genetic basis for
this biotransformation (42). Some of the genes which are
essential to the degradation of eugenol by Pseudomonas sp. strain HR199, which proceeds via coniferyl alcohol
(4-hydroxy-3-methoxycinnamyl alcohol), coniferyl aldehyde
(4-hydroxy-3-methoxycinnamyl aldehyde), ferulic acid, vanillin,
vanillic acid (4-hydroxy-3-methoxybenzoate), and protocatechuic acid
(3,4-dihydroxybenzoate) (Fig. 1)
(32), have already been identified. The genes encoding
eugenol hydroxylase (ehyA and ehyB)
(30), coniferyl alcohol dehydrogenase (calA) (20), and coniferyl aldehyde dehydrogenase
(calB) (3) are responsible for the conversion
of eugenol to ferulic acid (Fig. 1). Vanillin dehydrogenase,
encoded by vdh, and vanillate-O-demethylase, encoded by vanA and vanB, catalyze the conversion
of vanillin to protocatechuic acid (29), which is
further metabolized by ortho cleavage (26)
(Fig. 1).
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Biochemical and Genetic Analyses of Ferulic Acid
Catabolism in Pseudomonas sp. Strain HR199
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-ketothiolase,
which are involved in the catabolism of ferulic acid and eugenol in
Pseudomonas sp. strain HR199 (DSM7063), were localized on a
DNA region covered by two EcoRI fragments (E230 and E94),
which were recently cloned from a Pseudomonas sp. strain
HR199 genomic library in the cosmid pVK100. The nucleotide sequences of
parts of fragments E230 and E94 were determined, revealing the
arrangement of the aforementioned genes. To confirm the function of the
structural genes fcs and ech, they were cloned and expressed in Escherichia coli. Recombinant strains
harboring both genes were able to transform ferulic acid to vanillin.
The feruloyl-CoA synthetase and enoyl-CoA hydratase/aldolase activities of the fcs and ech gene products,
respectively, were confirmed by photometric assays and by
high-pressure liquid chromatography analysis. To prove the
essential involvement of the fcs, ech, and
aat genes in the catabolism of ferulic acid and eugenol in Pseudomonas sp. strain HR199, these genes were inactivated
separately by the insertion of omega elements. The corresponding
mutants Pseudomonas sp. strain HRfcs
Gm and
Pseudomonas sp. strain HRech
Km were not able
to grow on ferulic acid or on eugenol, whereas the mutant
Pseudomonas sp. strain HRaat
Km exhibited a
ferulic acid- and eugenol-positive phenotype like the wild type. In
conclusion, the degradation pathway of eugenol via ferulic acid and the
necessity of the activation of ferulic acid to the corresponding CoA
ester was confirmed. The aat gene product was shown not to
be involved in this catabolism, thus excluding a
-oxidation
analogous degradation pathway for ferulic acid. Moreover, the function
of the ech gene product as an enoyl-CoA hydratase/aldolase
suggests that ferulic acid degradation in Pseudomonas sp.
strain HR199 proceeds via a similar pathway to that recently described
for Pseudomonas fluorescens AN103.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (19K):
[in a new window]
FIG. 1.
Proposed route for the catabolism of eugenol in
Pseudomonas sp. strain HR199. Fine arrows indicate
-oxidation analogous to that of fatty acid catabolism. Thick arrows
indicate ferulic acid degradation via vanillin.
In the present study we identified the genes responsible for the bioconversion of ferulic acid to vanillin in Pseudomonas sp. strain HR199. The essential involvement of these genes in ferulic acid and eugenol catabolism was verified by gene disruption and characterization of the corresponding mutants with respect to the catabolism of ferulic acid and eugenol.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Bacterial strains and plasmids.
The strains of
Pseudomonas and Escherichia coli and the plasmids
used in this study are listed in Table 1.
|
Growth of bacteria. Cells of E. coli were grown at 37°C in Luria-Bertani medium (LB) or in M9 mineral salts medium (34). Cells of Pseudomonas strains were grown at 30°C either in a nutrient broth (NB) medium (0.8%, wt/vol; Difco) or in MM (36) or HR-MM (32) mineral salts medium supplemented with carbon sources as indicated below. Ferulic acid, vanillin, vanillic acid, and protocatechuic acid were dissolved in dimethyl sulfoxide and were each added to the medium at final concentrations of 0.1% (wt/vol). Eugenol was directly added to the medium at a final concentration of 0.1% (vol/vol). Tetracycline, kanamycin, and gentamicin were used at final concentrations of 25, 300, and 7.5 µg/ml, respectively, for Pseudomonas strains. Growth of the bacteria was monitored with a Klett-Summerson photometer.
Nitrosoguanidine mutagenesis. The nitrosoguanidine mutagenesis of Pseudomonas sp. strain HR199 was performed as described previously (29).
Qualitative and quantitative determination of catabolic intermediates. Culture supernatants were analyzed for excreted intermediates of eugenol catabolism by liquid chromatography without prior extraction, using a high-performance liquid chromatography (HPLC) apparatus (Fa. Knauer, Berlin, Germany). Separation was carried out by reversed-phase chromatography on Nucleosil-100 C18 (5-µm particle size; 250- by 4.0-mm column) with a gradient of 0.1% (vol/vol) formic acid (eluant A) and acetonitrile (eluant B) in a range of 20 to 100% (vol/vol) eluant B and at a flow rate of 1 ml/min. For quantification, all intermediates were calibrated with external standards. The compounds were identified by their retention times and by the corresponding spectra obtained with a diode array detector (WellChrom Diodenarray-Detektor K-2150; Knauer).
Preparation of the soluble fractions of crude extracts. Cells were disrupted either by a twofold French press passage at 96 MPa or by sonication (1 min/ml of cell suspension with an amplitude of 40 µm) with a Bandelin Sonopuls GM200 ultrasonic disintegrator. Soluble fractions of crude extracts were obtained by centrifugation at 100,000 × g at 4°C for 1 h.
Enzyme assays.
Feruloyl coenzyme A (feruloyl-CoA) synthetase
was assayed spectrophotometrically at 30°C by a modified method
described by Zenk et al. (49). The reaction mixture (1 ml)
contained 100 mM potassium phosphate buffer (pH 7.0), 2.5 mM
MgCl2, 0.7 mM ferulic acid, 2 mM ATP, 0.4 mM CoA, and an
appropriate amount of extract or enzyme. The assay was started by the
addition of ATP, and the initial absorbance increase due to the
formation of feruloyl-CoA (
= 10 cm2
µmol
1) was measured at 345 nm.
-hydroxypropionyl-CoA (HMPHP-CoA). HMPHP-CoA was prepared by the method of Gasson et al.
(16). The conversion of HMPHP-CoA to vanillin was confirmed
by HPLC analysis. Since the concentration of HMPHP-CoA was not
determined, only qualitative determination of enoyl-CoA
hydratase/aldolase activity was performed.
The amount of soluble protein present was determined as described by
Lowry et al. (24).
Electrophoretic methods. Proteins were separated under nondenaturating conditions in 7.4% (wt/vol) polyacrylamide (PAA) gels as described by Stegemann et al. (41) and under denaturating conditions in 11.5% (wt/vol) PAA gels by the method of Laemmli (22) and stained with Serva Blue R.
Isolation and manipulation of DNA. Plasmid DNA and DNA restriction fragments were isolated and analyzed by standard methods described in references compiled in a previous study (28).
Transfer of DNA. Competent cells of E. coli were prepared and transformed by using the CaCl2 procedure as described by Hanahan (18). Conjugations of E. coli S17-1 (donors) harboring hybrid plasmids and of Pseudomonas strains (recipients) were performed on solidified NB medium as described by Friedrich et al. (14), or by a minicomplementation method described previously (29).
Construction of a genomic library of Pseudomonas sp.
strain HR199.
Partially EcoRI-digested genomic DNA of
Pseudomonas sp. strain HR199 was ligated with
EcoRI-linearized cosmid pVK100. The ligation mixture was
packaged in
particles and subsequently transduced into E. coli S17-1. A total of 1,330 transductants were selected on
LB-tetracycline agar plates, and the hybrid cosmids of these strains
were conjugatively transferred to the ferulic acid-negative mutants
SK6167 and SK6202, respectively.
Inactivation of the fcs gene in
Pseudomonas sp. strain HR199 by insertion of the omega
element
Gm.
For the inactivation of the fcs gene by
insertion of
Gm, the hybrid plasmid pSKfcs was digested
with BssHII, to delete a 1,284-bp fragment from the
fcs gene. After removal of the single-stranded ends by mung
bean nuclease treatment, this DNA was ligated with
Gm, which was
recovered from SmaI-digested pSKsym
Gm, whose construction has been described recently (27). E. coli
XL1-Blue was transformed with the ligation mixture, and transformants
harboring the hybrid plasmid pSKfcs
Gm, which conferred
resistance against gentamicin, were obtained. No feruloyl-CoA
synthetase activity could be detected in soluble fractions of the crude
extracts of the corresponding recombinant strains (see Table 2). For
the exchange of the functional fcs gene with the inactivated
gene, fcs
Gm had to be cloned in vector pSUP202, which
could be transferred from E. coli to Pseudomonas sp. strain HR199 by conjugation. Since pSUP202 cannot be replicated in
Pseudomonas strains, it is a suicide plasmid
(39), and the integration of the hybrid plasmid by
homologous recombination can be forced by selection on media containing
antibiotics, the corresponding resistances to which are encoded by
genes borne by the plasmid. The disrupted gene fcs
Gm was
isolated from pSKfcs
Gm after digestion with
PstI and was ligated with PstI-digested pSUP202 DNA. E. coli S17-1 was transformed with the ligation
mixture, and transformants harboring the hybrid plasmid
pSUPfcs
Gm, which conferred resistance to tetracycline and
gentamicin, were obtained. The hybrid plasmid pSUPfcs
Gm
was transferred to Pseudomonas sp. strain HR199 by
conjugation, and selection was performed on solidified H16-MM
containing gentamicin. The obtained transconjugants were tested for
tetracycline resistance (encoded by a vector-borne gene) to distinguish
between an integration of the whole hybrid plasmid into the chromosome
by a single crossover (heterogenotes) or an exchange of the functional
fcs gene with the disrupted gene by a double crossover
(homogenotes), which resulted in a tetracycline-sensitive phenotype.
The exchange of the functional fcs gene with the disrupted gene fcs
Gm in the tetracycline-sensitive mutant
Pseudomonas sp. strain HRfcs
Gm was confirmed
by amplification of the corresponding gene from genomic DNA of this
mutant by PCR with oligonucleotides PCRfcsPU and
PCRfcsPD, which resulted in only one PCR product. The
sequence of the PCR product was determined, revealing the sequence of
fcs
Gm. When genomic DNA of heterogenotic transconjugants were used as template DNA, two PCR products were obtained,
corresponding to the functional fcs gene and the disrupted
fcs gene, respectively.
Inactivation of the ech gene in
Pseudomonas sp. strain HR199 by insertion of the omega
element
Km.
For inactivation of the ech gene by
insertion of
Km, the ech gene was amplified from
PstI-digested genomic DNA of Pseudomonas sp.
strain HR199. To obtain a gene which was flanked by EcoRI sites, the aforementioned oligonucleotide PCRechEU and
the oligonucleotide PCRechED
(5'-AAAGAATTCCCCGCAACATGCCCGCCGCCAGGTAAACG-3'), which was complementary to the nucleotide sequence from bp 364 to 393 downstream of the translational stop codon of ech, were used
as primers in the PCR. The isolated PCR product was digested with EcoRI and ligated to EcoRI-digested pBluescript
SK
. E. coli XL1-Blue was transformed with the
ligation mixture, and transformants harboring the hybrid plasmid
pSKechEE were obtained. pSKechEE was digested
with NruI to delete a region of 486 bp from the
ech gene. The plasmid DNA was ligated with
Km, which was recovered from SmaI-digested pSKsym
Km (27), to
obtain the plasmid pSKech
Km. Subsequently,
ech
Km was recovered from EcoRI-digested pSKech
Km, and the exchange of the functional
ech gene with the inactivated gene ech
Km in
Pseudomonas sp. strain HR199 was performed as described for
the exchange of fcs and fcs
Gm, with the
exceptions that the EcoRI site of pSUP202 was used for
cloning of ech
Km and gentamicin was replaced by kanamycin
in the medium used for selection. The success of the gene replacement
in the tetracycline-sensitive mutant Pseudomonas sp. strain
HRech
Km was confirmed by amplification of the
corresponding gene from genomic DNA of this mutant by PCR and
sequencing of the obtained single PCR product.
Inactivation of the aat gene in
Pseudomonas sp. strain HR199 by insertion of the omega
element
Km.
For the inactivation of the aat gene by
insertion of
Km, the aat gene was amplified from
PstI-digested genomic DNA of Pseudomonas sp.
strain HR199. To obtain a gene which was flanked by EcoRI sites, oligonucleotides PCRaatEU
(5'-AAAGAATTCGGCGGTCGGCGAAAGTTGATGCG-3' [the
restriction enzyme site is underlined]), which corresponded to the
nucleotide sequence from bp 70 to 48 upstream of the translational start codon of aat, and PCRaatED
(5'-AAAGAATTCCCACCAACCCTGACAAGGTATGTACAC-3'), which was complementary to the nucleotide sequence from bp 198 to
224 downstream of the translational stop codon of aat, were used as primers in the PCR. The isolated PCR product was digested with
EcoRI and ligated to EcoRI-digested pBluescript
SK
. E. coli XL1-Blue was transformed with the
ligation mixture, and transformants harboring the hybrid plasmid
pSKaat were obtained. pSKaat was digested with
BssHII, to delete a 59-bp fragment from the aat
gene. After removal of the single-stranded ends by mung bean nuclease
treatment, this DNA was ligated with
Km to obtain plasmid
pSKaat
Km. Subsequently, aat
Km was recovered
from EcoRI-digested pSKaat
Km and the
functional aat gene was exchanged with the inactivated aat
Km gene in Pseudomonas sp. strain HR199 as
described for the exchange of ech and ech
Km.
The success of the gene replacement in the tetracycline-sensitive
Pseudomonas sp. strain HRaat
Km mutant
was confirmed by amplification of the corresponding gene from genomic
DNA of this mutant by PCR and sequencing of the single PCR
product thus obtained.
DNA sequence determination and analysis. DNA sequences were determined by the dideoxy chain termination method (35) with a 4000L DNA sequencer (LI-COR Inc., Biotechnology Division, Lincoln, Neb.). A Thermo Sequenase fluorescence-labelled primer cycle-sequencing kit with 7-deaza-dGTP (Amersham Life Science, Little Chalfont, United Kingdom) was used as specified by the manufacturer, together with synthetic fluorescence-labelled oligonucleotides as primers. The primer-hopping strategy was used (43). Nucleotide and amino acid sequences were analyzed with the Genetics Computer Group sequence analysis software package (GCG package, version 6.2, June 1990) as described by Devereux et al. (11).
Chemicals. Restriction endonucleases, T4 DNA ligase, lambda DNA, and enzymes or substrates used in the enzyme assays were obtained from C. F. Boehringer & Soehne (Mannheim, Germany) or from GIBCO/BRL-Bethesda Research Laboratories GmbH (Eggenstein, Germany). Agarose type NA was purchased from Pharmacia-LKB (Uppsala, Sweden). Radioisotopes were from Amersham/Buchler (Braunschweig, Germany). Synthetic oligonucleotides were purchased from MWG-Biotech (Ebersberg, Germany). All other chemicals were from Haarmann & Reimer (Holzminden, Germany), E. Merck AG (Darmstadt, Germany), Fluka Chemie (Buchs, Switzerland), Serva Feinbiochemica (Heidelberg, Germany), or Sigma Chemie (Deisenhofen, Germany).
Nucleotide sequence accession number. The nucleotide and amino acid sequence data reported in this paper have been submitted to the EMBL, GenBank, and DDBJ nucleotide sequence databases and are listed under accession no. AJ238746.
| |
RESULTS |
|---|
|
|
|---|
Cloning of the genes involved in the ferulic acid degradation pathway. Pseudomonas sp. strain HR199 is able to utilize ferulic acid as the sole carbon source for growth. For identification of the genes, which are involved in the catabolism of ferulic acid, mutants that were unable to grow on ferulic acid but retained the ability to grow on vanillic acid or protocatechuic acid were isolated after nitrosoguanidine mutagenesis. Two of these mutants (SK6167 and SK6202) were chosen as recipients for a genomic library of Pseudomonas sp. strain HR199. Mutant SK6202 was complemented by the hybrid cosmid pE207 harboring a 23-kbp EcoRI fragment (E230), which had recently been identified in a genomic library of Pseudomonas sp. strain HR199 (29). Mutant SK6167 was complemented by the hybrid cosmid pE5-1, which also complemented a coniferyl alcohol dehydrogenase-deficient mutant SK6164, as revealed during our investigations of the eugenol catabolism of Pseudomonas sp. strain HR199 (20). This hybrid cosmid harbored five EcoRI fragments of 1.2, 1.8, 3.0, 5.8, and 9.4 kbp (E12, E18, E30, E58, and E94, respectively).
Subcloning of ech, fcs, and aat. A physical map of E230 was obtained recently (29). This fragment harbored the vanillin catabolism genes vanA, vanB, and vdh, encoding the subunits of vanillate-O-demethylase (vanA and vanB) and vanillin dehydrogenase (vdh) (29) (Fig. 2). The amino acid sequence deduced from an open reading frame (ORF2) identified upstream of vdh showed significant homologies to enoyl-CoA hydratases (29).
Fragment E230 was isolated from EcoRI-digested plasmid pSKE230 and was digested with HindIII. The resulting 11.2-kbp (H110) and 5.0-kbp (H50) HindIII fragments and also the 1.5-kbp (EH15) and 3.5-kbp (HE35) HindIII-EcoRI fragments were cloned in pHP1014 (Fig. 2). After conjugative transfer of the resulting plasmids from corresponding E. coli S17-1 strains to the ferulic acid-negative mutant SK6202, complementation was achieved only with fragment HE35, harboring the vdh gene and ORF2, now designated ech. Since mutant SK6202 was able to grow on vanillin, like the wild type, this mutant most probably lacked the functional gene product of ech.
|
, resulting in plasmid pSKE94, and a
physical map of this fragment was obtained (Fig. 2). pSKE94 was
digested with HindIII and SalI, and the
resulting subfragments of E94 were cloned in pHP1014. By conjugative
transfer of the resulting plasmids to mutant SK6167, the complementing
region was assigned to a 3.7-kbp (ES37)
EcoRI-SalI subfragment and an 1.9-kbp (EH19)
EcoRI-HindIII subfragment of E94 (Fig. 2).
Nucleotide sequence of fragment ES37.
The nucleotide sequence
of the entire fragment ES37, which contained the sequence of fragment
EH19, was determined (Fig. 2). Fragment EH19 was almost covered
by one open reading frame of 1,770 bp (ORF1), whose putative
translational product exhibited significant homologies to thiokinases
from various sources (Fig. 3). Since the ferulic
acid-negative mutant SK6167 was complemented by fragment EH19, it most
probably lacked a functional gene product of ORF1. Due to the
aforementioned homologies and the proposed degradation mechanism via a
-oxidation analogous mechanism, ORF1 was designated fcs,
which most probably encodes a feruloyl-CoA synthetase. The
NH2-terminus-encoding part of the fcs gene was not located on fragment EH19 but on the adjacent EcoRI
fragment, E230. That both fragments were directly linked, as shown in
Fig. 2, was confirmed by using PCR with oligonucleotides
PCRfcsPU
(5'-AAACTGCAGTCGAGCATCGATTGAGCACTTTACCCAGC-3') and PCRfcsPD
(5'-AAACTGCAGGCCGCGACACACAGCACGTGATCAG-3'), by
hybridization to E230 and E94, respectively, and by using genomic DNA
of Pseudomonas sp. strain HR199 as template DNA. The
translational stop codon of fcs overlapped with the GTG
start codon of a second open reading frame of 1,296 bp, which was
referred to as aat, since its putative translational product
exhibited significant homologies to
-ketothiolases from various
sources. Typical Shine-Dalgarno sequences (GGAGGT and GAGG,
respectively) preceded the translational start codons of
fcs and aat at distances of 9 or 7 nucleotides,
respectively.
|
Putative functions of the ech, fcs, and aat gene products. The amino acid sequences deduced from ech, fcs, and aat were compared with those collected in GenBank. With the ech gene product, the highest homology was found to the enoyl-SCoA hydratase/lyase of P. fluorescens AN103 (88% identity in a 276-aa overlap) (16). With the fcs gene product, the highest homology was found to the long-chain acyl-CoA synthetase 2 of human liver (36% identity in a 114-aa overlap) (2). The relationship of the feruloyl-CoA synthetase from Pseudomonas sp. strain HR199 to enzymes of the thiokinase family is shown in Fig. 3. With the aat gene product, the highest homology was found to the mitochondrial 3-ketoacyl-CoA thiolase of human liver (35% identity in a 399-aa overlap) (1).
Heterologous expression of ech and fcs in
E. coli.
The ech gene was amplified in a PCR with
PstI-digested genomic DNA of Pseudomonas sp.
strain HR199 as the template DNA, together with the primers
PCRechEU
(5'-AAAGAATTCGCCTGGCGACGAAAGGGCGGCAGGC-3'), which corresponded to the nucleotide sequence from bp 242 to
217 upstream of the translational start codon of ech, and
PCRechHD (5'-AA AAAGCTTCCCCGGCGCATTTATCAGCGCTTGTAGGT CTGC-3'),
which was complementary to the nucleotide sequence
comprising the last 19 bp of the ech gene and an additional
14 bp downstream of the translational stop codon of ech.
Since the upstream primer exhibited an EcoRI site
(underlined) and the downstream primer exhibited a
HindIII site (underlined), the obtained 1.1-kbp PCR
product was cloned in pBluescript SK
with the
ech gene colinear to and downstream of the lacZ
promoter. The resulting hybrid plasmid, pSKechE/H, conferred
enoyl-CoA hydratase/aldolase activity to recombinant strains of
E. coli XL1-Blue, which was revealed by the enzyme assay
described in Materials and Methods.
. The resulting hybrid plasmid pSKfcs, with
the fcs gene colinear to and downstream of the
lacZ promoter, conferred feruloyl-CoA synthetase activity to
recombinant strains of E. coli XL1-Blue (Table
2).
|
Biotransformation of ferulic acid to vanillin by coexpression of
the fcs and ech genes in E. coli.
Since the expression of fcs enabled the corresponding
E. coli strains to convert ferulic acid to
feruloyl-CoA and the expression of ech led to the
conversion of
4-hydroxy-3-methoxyphenyl-
-hydroxypropionyl-CoA to vanillin,
coexpression of these genes should enable E. coli to convert
ferulic acid to vanillin.
-D-thiogalactopyranoside (IPTG). Cells were harvested by centrifugation, washed twice in 100 mM
potassium phosphate buffer (pH 7.0), and resuspended in 50 ml of HR-MM
containing 3.7 mM ferulic acid. With resting cells of E. coli XL1-Blue harboring pSKechE/Hfcs,
conversion rates up to 0.037 µmol of ferulic acid to 0.022 µmol of
vanillin per min per ml of culture were readily obtained. The course of
this biotransformation is summarized in Fig.
4. Beside vanillin, vanillyl alcohol was detected in the medium as a result of a reduction of vanillin by the
E. coli cells. This reduction was also observed in a control experiment, when cells of E. coli XL1-Blue harboring only
the vector pBluescript SK
were incubated in HR-MM in the
presence of 2 mM vanillin (data not shown in detail).
|
Characterization of the Pseudomonas sp. strain
HRfcs
Gm, HRech
Km, and
HRaat
Km mutants.
The phenotypes of the
Pseudomonas sp. strain HRfcs
Gm,
HRech
Km, and HRaat
Km mutants on
solidified MM with eugenol, ferulic acid, vanillin, vanillic
acid, and gluconate as the sole carbon source, respectively, were
investigated. The HRfcs
Gm and HRech
Km mutants were not able to grow on eugenol or ferulic acid, but they
retained the ability to grow on vanillin or vanillic acid, thus
exhibiting the same phenotype as the nitrosoguanidine-induced mutants
SK6167 and SK6202 of Pseudomonas sp. strain
HR199. In contrast, no difference from the phenotype of the wild-type
Pseudomonas sp. strain HR199 was detected with the
mutant Pseudomonas sp. strain HRaat
Km.
Gm,
HRech
Km, and HRaat
Km were precultured overnight in HR-MM containing 0.5% (wt/vol) sodium gluconate as the
carbon source. The cells were harvested, washed twice with MM, and used
for inoculation of 50 ml of HR-MM containing about 6.5 mM eugenol as
the carbon source in 250-ml Klett flasks. The cultures were
incubated for 24 h at 30°C, and 1-ml samples were taken and
analyzed by HPLC for the appearance or disappearance of catabolic
intermediates. Cells of Pseudomonas sp. strain HR199 were
incubated in the same way and used as a control. In cultures of the
wild type, the intermediates coniferyl alcohol, coniferyl aldehyde,
ferulic acid, and vanillic acid were obtained (Fig. 5A). Similar results were obtained with
Pseudomonas sp. strain HRaat
Km (Fig. 5D). In
cultures of Pseudomonas sp. strain HRfcs
Gm, only a slight decrease in the eugenol concentration from 6.1 to 5.4 mM
within 24 h was observed, but no intermediates were detectable (Fig. 5B). Interestingly, Pseudomonas sp. strain
HRech
Km differed significantly from
Pseudomonas sp. strain HRfcs
Gm, since eugenol was completely consumed by this mutant. Coniferyl alcohol
accumulated to a maximum concentration of 3 mM after about 18 h
and was then completely converted to ferulic acid (Fig. 5C). After
40 h, ferulic acid was detected as the only product at a
concentration of 5.9 mM, which was not further metabolized even after
72 h (data not shown in detail). Thus, eugenol was converted to
ferulic acid by this mutant with a molar yield of about 97%.
|
Km was confirmed
by the enzyme assay for enoyl-CoA hydratase/aldolase activity described
in Materials and Methods. The mutants Pseudomonas sp. strain
HRfcs
Gm, HRech
Km, and
HRaat
Km were also investigated with respect to
feruloyl-CoA synthetase activity. The mutants and the wild-type
Pseudomonas sp. strain HR199 were grown in HR-MM containing
0.5% (wt/vol) gluconate and 0.1% (vol/vol) eugenol. Cells were
harvested in the late exponential growth phase, and the corresponding
soluble fractions of crude extracts were analyzed for feruloyl-CoA
synthetase activity (Table 2). No feruloyl-CoA synthetase activity
was detectable in extracts of Pseudomonas sp. strain
HRfcs
Gm, whereas disruption of the ech and
aat genes apparently had no influence on the feruloyl-CoA synthetase activity (Table 2).
| |
DISCUSSION |
|---|
|
|
|---|
Pseudomonas sp. strain HR199 is able to utilize eugenol
and ferulic acid as the sole carbon source for growth. The genes, which
are essential in ferulic acid catabolism, were identified on DNA
fragments E230 and E94, which had been cloned recently in studies of
the catabolism of eugenol (20, 29). The fcs and
aat genes, which encoded proteins with homologies to
thiokinases and
-ketothiolases, respectively (this study), were
localized in the immediate neighborhood of the ech and
vdh genes, encoding an enoyl-CoA hydratase-homologous
protein and a vanillin dehydrogenase, respectively (29).
Moreover, fcs and aat are most probably
constituents of one operon, since the translational start codon of
aat overlapped with the translational stop codon of
fcs. All these data suggested that ferulic acid degradation
in Pseudomonas sp. strain HR199 is initiated by the
activation of ferulic acid to feruloyl-CoA, followed by a
-oxidation
mechanism analogous to the
-oxidation pathway of fatty acid
catabolism (Fig. 1), which had been previously proposed for the
degradation of substituted cinnamic acids in plants (47).
This pathway would include the thioclastic cleavage of
4-hydroxy-3-methoxyphenyl-
-ketopropionyl-CoA to yield
acetyl-CoA and vanillyl-CoA, catalyzed by the aat gene
product (
-ketothiolase). However, genes encoding a
4-hydroxy-3-methoxyphenyl-
-hydroxypropionyl-CoA dehydrogenase
or a vanillyl-CoA hydrolase were not identified in
Pseudomonas sp. strain HR199.
The identity of the fcs gene product as a feruloyl-CoA synthetase was concluded from a comparison of its amino acid sequence with those of fatty acid-CoA synthetases. FCS showed significant homologies to these CoA ligases and also possessed an amino acid sequence (aa 190 to 199) proposed to be involved in acyl-adenylate formation (5), which is typical for this kind of enzymes. This assumption was confirmed by expression of this gene in E. coli. Feruloyl-CoA synthetase activity was detected by a spectrophotometric assay, and the formation of feruloyl-CoA was directly indicated by HPLC analysis. Thus, this is the first report of the cloning and molecular characterization of a bacterial fcs gene, encoding a feruloyl-CoA synthetase.
During our investigations of the eugenol catabolism of Pseudomonas sp. strain HR199, Gasson et al. reported the isolation and characterization of a gene of the enoyl-SCoA hydratase/isomerase superfamily from Pseudomonas fluorescens AN103, which encoded an enzyme for the hydration and nonoxidative cleavage of feruloyl-SCoA to vanillin and acetyl-SCoA (16). From amino acid sequence comparison, it was obvious that the ech gene product of Pseudomonas sp. strain HR199 had the same function as the enzyme reported by Gasson et al. This assumption was confirmed by expression of the ech gene in E. coli and detection of enoyl-CoA hydratase/aldolase activity for the obtained gene product. Recently, Venturi et al. reported the identification of two proteins designated Fca and Vdh and asserted that these two proteins were responsible for the conversion of ferulic acid to vanillic acid in Pseudomonas putida WCS358 (46). However, they did not provide any evidence that Fca catalyzed the direct cleavage of ferulic acid to acetate and vanillin. Moreover, the high homology of Fca to the enoyl-CoA hydratase/aldolase of Pseudomonas sp. strain HR199 and the similar arrangement of the fca and vdh genes in P. putida WCS358 and ech and vdh in Pseudomonas sp. strain HR199 (29) suggest that Fca also represents an enoyl-CoA hydratase/aldolase rather than a ferulic acid deacetylase. In conclusion, ferulic acid degradation in Pseudomonas sp. strain HR199, as in P. putida WCS358 and Pseudomonas fluorescens AN103, proceeds via feruloyl-CoA, which is hydrated and cleaved by the action of the ech gene product (Fig. 1). This conclusion was also confirmed by the coexpression of the fcs and ech genes from Pseudomonas sp. strain HR199 in E. coli. Corresponding recombinant strains were able to convert ferulic acid to vanillin. The conversion rate obtained was in a biotechnologically interesting range; however, the coformation of vanillyl alcohol, which could be regarded as a detoxification reaction, might cause problems in such a process.
To confirm the essential involvement of fcs and
ech in ferulic acid catabolism and to investigate the role
of the aat gene, these genes were inactivated by disruption.
These experiments clearly demonstrated that the activation of ferulic
acid to the corresponding CoA thioester is absolutely necessary for the
catabolism of this aromatic compound. Also, mutants with an inactivated
ech gene were not able to grow on ferulic acid, confirming
the involvement of the enoyl-CoA hydratase/aldolase in this catabolism.
Although aat is most probably cotranscribed with
fcs, the encoded
-ketothiolase seems not to be involved
in the ferulic acid degradation pathway, since the mutant
Pseudomonas sp. strain HRaat
Km, with a
defective aat gene, exhibited the same phenotype as the wild
type. Thus, the presence of the aat gene and the
arrangements of fcs and aat might reflect an
evolutionary relic, as a result of gene duplication and diversification.
If this CoA-dependent, non-
-oxidative mechanism of ferulic acid
cleavage, which was already proposed by Lute (25) and was first published by Gasson et al. (16), is generally realized in bacteria or if
-oxidation-like mechanisms and direct nonoxidative deacetylation mechanisms can be confirmed at the genetic level, they
will be the subject of further studies.
| |
ACKNOWLEDGMENTS |
|---|
The synthesis of 4-hydroxy-3-methoxyphenyl-
-hydroxypropionate
methylester by Dirk Fabritius and his assistance during the synthesis
of 4-hydroxy-3-methoxyphenyl-
-hydroxypropionyl-CoA are gratefully acknowledged.
H.P. and A.S. are indebted to Haarmann & Reimer GmbH for providing a collaborative research grant.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Institut für Mikrobiologie, Westfälische Wilhelms-Universität Münster, Corrensstraße 3, D-48149 Münster, Germany. Phone: 49-251-8339829. Fax: 49-251-8338388. E-mail: priefer{at}uni-muenster.de.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Abe, H., A. Ohtake, S. Yamamoto, Y. Satoh, M. Takayanagi, Y. Amaya, M. Takiguchi, H. Sakuraba, Y. Suzuki, M. Mori, and H. Niimi. 1993. Cloning and sequence analysis of a full length cDNA encoding human mitochondrial 3-oxoacyl-CoA thiolase. Biochim. Biophys. Acta 1216:304-306[Medline]. |
| 2. |
Abe, T.,
T. Fujino,
R. Fukuyama,
S. Minoshima,
N. Shimizu,
H. Toh,
H. Suzuki, and T. Yamamoto.
1992.
Human long-chain acyl-CoA synthetase: structure and chromosomal location.
J. Biochem.
111:123-128 |
| 3. |
Achterholt, S.,
H. Priefert, and A. Steinbüchel.
1998.
Purification and characterization of the coniferyl aldehyde dehydrogenase from Pseudomonas sp. strain HR199 and molecular characterization of the gene.
J. Bacteriol.
180:4387-4391 |
| 4. | An, J. H., and Y. S. Kim. 1998. A gene cluster encoding malonyl-CoA decarboxylase (MatA), malonyl-CoA synthetase (MatB) and a putative dicarboxylate carrier protein (MatC) in Rhizobium trifolii: cloning, sequencing, and expression of the enzymes in Escherichia coli. Eur. J. Biochem. 257:395-402[Medline]. |
| 5. | Babbitt, P. C., G. L. Kenyon, B. M. Martin, H. Charest, and M. Slyvestre. 1992. Ancestry of the 4-chlorobenzoate dehalogenase: analysis of amino acid sequence identities among families of acyl:adenyl ligases, enoyl-CoA hydratases/isomerases, and acyl-CoA thioesterases. Biochemistry 31:5594-5604[Medline]. |
| 6. | Bibb, M. J., P. R. Findlay, and M. W. Johnson. 1984. The relationship between base composition and codon usage in bacterial genes and its use for the simple and reliable identification of protein-coding sequences. Gene 30:157-166[Medline]. |
| 7. | Bullock, W. O., J. M. Fernandez, and J. M. Stuart. 1987. XL1-Blue: a high efficiency plasmid transforming recA Escherichia coli strain with beta-galactosidase selection. BioTechniques 5:376-379. |
| 8. | Chen, C. L., H. M. Chang, and T. Kirk. 1982. Aromatic acids produced during degradation of lignin in spruce wood by Phanerochaete chrysosporium. Holzforschung 36:3-9. |
| 9. | Clark, G. S. 1990. Vanillin. Perfum. Flavor 15:45-54. |
| 10. | Cole, S. T., R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V. Gordon, K. Eiglmeier, S. Gas, C. E. Barry III, F. Tekaia, K. Badcock, D. Basham, D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T. Feltwell, S. Gentles, N. Hamlin, S. Holroyd, T. Hornsby, K. Jagels, A. Krogh, J. McLean, S. Moule, L. Murphy, S. Oliver, J. Osborne, M. A. Quail, M. A. Rajandream, J. Rogers, S. Rutter, K. Seeger, S. Skelton, S. Squares, R. Sqares, J. E. Sulston, K. Taylor, S. Whitehead, and B. G. Barrell. 1998. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature (London) 393:537-544[Medline]. |
| 11. | Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395. |
| 12. |
DeWet, J. R.,
K. V. Wood,
M. DeLuca,
D. R. Helinski, and S. Subramani.
1987.
Firefly luciferase gene: structure and expression in mammalian cells.
Mol. Cell. Biol.
7:725-737 |
| 13. |
Egland, P. G.,
J. Gibson, and C. S. Harwood.
1995.
Benzoate-coenzyme A ligase, encoded by badA, is one of three ligases able to catalyze benzoyl-coenzyme A formation during anaerobic growth of Rhodopseudomonas palustris on benzoate.
J. Bacteriol.
177:6545-6551 |
| 14. |
Friedrich, B.,
C. Hogrefe, and H. G. Schlegel.
1981.
Naturally occurring genetic transfer of hydrogen-oxidizing ability between strains of Alcaligenes eutrophus.
J. Bacteriol.
147:198-205 |
| 15. | Fulda, M., E. Heinz, and F. P. Wolter. 1994. The fadD gene of Escherichia coli K12 is located close to rnd at 39.6 min of the chromosomal map and is a new member of the AMP-binding protein family. Mol. Gen. Genet. 242:241-249[Medline]. |
| 16. |
Gasson, M. J.,
Y. Kitamura,
W. R. McLauchlan,
A. Narbad,
A. J. Parr,
E. L. H. Parsons,
J. Payne,
M. J. C. Rhodes, and N. J. Walton.
1998.
Metabolism of ferulic acid to vanillin. A bacterial gene of the enoyl-SCoA hydratase/isomerase superfamily encodes an enzyme for the hydration and cleavage of a hydroxycinnamic acid SCoA thioester.
J. Biol. Chem.
273:4163-4170 |
| 17. | Hagedorn, S., and B. Kaphammer. 1994. Microbial biocatalysis in the generation of flavor and fragrance chemicals. Annu. Rev. Microbiol. 48:773-800[Medline]. |
| 18. | Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580[Medline]. |
| 19. | Knauf, V. C., and E. W. Nester. 1982. Wide host range cloning vectors: a cosmid clone bank of an Agrobacterium Ti plasmid. Plasmid 8:45-54[Medline]. |
| 20. | Kresse, A. U., J. Overhage, H. Priefert, and A. Steinbüchel. Unpublished results. |
| 21. | Krings, U., and R. G. Berger. 1998. Biotechnological production of flavours and fragrances. Appl. Microbiol. Biotechnol. 49:1-8[Medline]. |
| 22. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685[Medline]. |
| 23. | Li, K., and J. W. Frost. 1998. Synthesis of vanillin from glucose. J. Am. Chem. Soc. 120:10545-10546. |
| 24. |
Lowry, O. H.,
N. J. Rosebrough,
A. L. Farr, and R. J. Randall.
1951.
Protein measurement with the Folin phenol reagent.
J. Biol. Chem.
193:265-275 |
| 25. | Lute, J. R. 1986. The pathway of phenylpropanoid degradation in Pseudomonas putida MT-2. Ph.D. thesis. The University of Michigan |
| 26. |
Overhage, J.,
A. U. Kresse,
H. Priefert,
H. Sommer,
G. Krammer,
J. Rabenhorst, and A. Steinbüchel.
1999.
Molecular characterization of the genes pcaG and pcaH, encoding protocatechuate 3,4-dioxygenase, which are essential for vanillin catabolism in Pseudomonas sp. strain HR199.
Appl. Environ. Microbiol.
65:951-960 |
| 27. | Overhage, J., H. Priefert, J. Rabenhorst, and A. Steinbüchel. Biotransformation of eugenol to vanillin by a mutant of Pseudomonas sp. strain HR199 constructed by disruption of the vanillin dehydrogenase (vdh) gene. Appl. Microbiol. Biotechnol., in press. |
| 28. |
Priefert, H.,
S. Hein,
N. Krüger,
K. Zeh,
B. Schmidt, and A. Steinbüchel.
1991.
Identification and molecular characterization of the Alcaligenes eutrophus H16 aco operon genes involved in acetoin catabolism.
J. Bacteriol.
173:4056-4071 |
| 29. |
Priefert, H.,
J. Rabenhorst, and A. Steinbüchel.
1997.
Molecular characterization of genes of Pseudomonas sp. strain HR199 involved in bioconversion of vanillin to protocatechuate.
J. Bacteriol.
179:2595-2607 |
| 30. | Priefert, H., J. Overhage, and A. Steinbüchel. Identification and molecular characterization of the eugenol hydroxylase genes (ehyA/ehyB) of Pseudomonas sp. strain HR199. Arch. Microbiol., in press. |
| 31. |
Pries, A.,
H. Priefert,
N. Krüger, and A. Steinbüchel.
1991.
Identification and characterization of two Alcaligenes eutrophus gene loci relevant to the poly( -hydroxybutyric acid)-leaky phenotype which exhibit homology to ptsH and ptsI of Escherichia coli.
J. Bacteriol.
173:5843-5853 |
| 32. | Rabenhorst, J. 1996. Production of methoxyphenol type natural aroma chemicals by biotransformation of eugenol with a new Pseudomonas sp. Appl. Microbiol. Biotechnol. 46:470-474. |
| 33. | Rabenhorst, J., and R. Hopp. 1990. Verfahren zur Herstellung von natürlichem Vanillin. European patent 0 405 197 A1 |
| 34. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y |
| 35. |
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467 |
| 36. | Schlegel, H. G., H. Kaltwasser, and G. Gottschalk. 1961. Ein Submersverfahren zur Kultur wasserstoffoxidierender Bakterien: wachstumsphysiologische Untersuchungen. Arch. Mikrobiol. 38:209-222[Medline]. |
| 37. | Shiotsu, Y., M. Samejima, N. Habu, and T. Yoshimoto. 1989. Enzymatic conversion of stilbenes from the inner back of Picea glehnii into aromatic aldehydes. Mukuzai Gakkaishi 35:826-831. |
| 38. | Simon, R., U. Priefer, and A. Pühler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria. Bio/Technology 1:784-791. |
| 39. | Simon, R., U. Priefer, and A. Pühler. 1983. Vector plasmids for in vivo and in vitro manipulations of Gram negative bacteria, p. 98-106. In A. Pühler (ed.), Molecular genetics of the bacteria-plant interaction. Springer-Verlag KG, Berlin, Germany |
| 40. | Smith, D. R., and K. Robison. Unpublished results. |
| 41. | Stegemann, H., H. Francksen, and V. Macko. 1973. Potato proteins: genetic and physiological changes, evaluated by one or two-dimensional PAA-geltechniques. Z. Naturforsch. Sect. C 28:722-732. |
| 42. | Steinbüchel, A., H. Priefert, and J. Rabenhorst. 1998. Syntheseenzyme für die Herstellung von Coniferylalkohol, Coniferylaldehyd, Ferulasäure, Vanillin und Vanillinsäure und deren Verwendung. European patent 0 845 532 A2 |
| 43. | Strauss, E. C., J. A. Kobori, G. Siu, and L. E. Hood. 1986. Specific-primer-directed DNA sequencing. Anal. Biochem. 154:353-360[Medline]. |
| 44. | Tadasa, K., and H. Kayahara. 1983. Initial steps of eugenol degradation pathway of a microorganism. Agric. Biol. Chem. 47:2639-2640. |
| 45. | Toms, A., and J. M. Wood. 1970. The degradation of trans-ferulic acid by Pseudomonas acidovorans. Biochemistry 9:337-343[Medline]. |
| 46. |
Venturi, V.,
F. Zennaro,
G. Degrassi,
B. C. Okeke, and C. V. Bruschi.
1998.
Genetics of ferulic acid bioconversion to protocatechuic acid in plant-growth-promoting Pseudomonas putida WCS358.
Microbiology
144:965-973 |
| 47. | Vollmer, K. O., H. J. Reisener, and H. Grisebach. 1965. The formation of acetic acid from p-hydroxycinnamic acid during its degradation to p-hydroxybenzoic acid in wheat shoots. Biochem. Biophys. Res. Commun. 21:221-225[Medline]. |
| 48. |
Wilbur, W. J., and D. J. Lipman.
1983.
Rapid similarity searches of nucleic acid and protein data banks.
Proc. Natl. Acad. Sci. USA
80:726-730 |
| 49. | Zenk, M. H., B. Ulbrich, J. Busse, and J. Stöckigt. 1980. Procedure for the enzymatic synthesis and isolation of cinnamoyl-CoA thiolesters using a bacterial system. Anal. Biochem. 101:182-187[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»