Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Iwaki, H. Articles by Lau, P. C. K. Search for Related Content PubMed PubMed Citation Articles by Iwaki, H. Articles by Lau, P. C. K. Agricola Articles by Iwaki, H. Articles by Lau, P. C. K.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, November 1999, p. 5158-5162, Vol. 65, No. 11
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

Identification of a Transcriptional Activator (ChnR) and a 6-Oxohexanoate Dehydrogenase (ChnE) in the Cyclohexanol Catabolic Pathway in Acinetobacter sp. Strain NCIMB 9871 and Localization of the Genes That Encode Them

Hiroaki Iwaki,¹ Yoshie Hasegawa,^1,* Masahiro Teraoka,¹ Tai Tokuyama,¹ Hélène Bergeron,² and Peter C. K. Lau²

Department of Biotechnology, Faculty of Engineering & High Technology Research Center, Kansai University, Suita, Osaka 564-8680, Japan,¹ and Biotechnology Research Institute, National Research Council Canada, Montreal, Quebec H4P 2R2, Canada²

Received 5 March 1999/Accepted 8 August 1999

	ABSTRACT

Top Abstract Text References

We identified chnR, a gene encoding an AraC-XylS type of transcriptional activator that regulates the expression of chnB, the structural gene for cyclohexanone monooxygenase (CHMO) in Acinetobacter sp. strain NCIMB 9871. The gene sequence of chnE, which encodes an NADP⁺-linked 6-oxohexanoate dehydrogenase, the enzyme catalyzing the fifth step of cyclohexanol degradation, was also determined. The gene arrangement is chnB-chnE-chnR. The predicted molecular masses of the three polypeptides were verified by radiolabeling by using the T7 expression system. Inducible expression of cloned chnB in Escherichia coli depended upon the presence of chnR. A transcriptional chnB::lacZ fusion experiment revealed that cyclohexanone induces chnB expression in E. coli, in which a 22-fold increase in activity was observed.

	TEXT

Top Abstract Text References

Acinetobacter sp. strain NCIMB 9871 is capable of utilizing cyclohexanol as a sole carbon source for growth (9). This organism is best known for its production of cyclohexanone 1,2-monooxygenase (CHMO), a 61-kDa monomeric flavoprotein which carries out a formal Baeyer-Villiger reaction that yields chiral products, such as lactones and sulfoxides of exquisite selectivity (22, 23, 28). Although the biochemical pathway for cyclohexanol oxidation in Acinetobacter sp. strain NCIMB 9871 was established in the 1970s (9, 26), the CHMO-encoding gene (6) is the only available cloned entity to date; the complete sequence of this gene is also the only known sequence of a Baeyer-Villiger monooxygenase gene (22, 23, 28). We are interested in isolating and characterizing additional genes of the cyclohexanol degradation (designated chn for cyclohexanol) pathway (Fig. 1) with the goal of determining the regulation of this pathway and its potential for biocatalysis and strain development. Here, we describe the identification of a transcriptional activator, ChnR, which is essential for CHMO expression. Below, the CHMO-encoding gene is referred to as chnB. In addition, we describe the location and sequence of chnE, a gene that encodes 6-oxohexanoate dehydrogenase activity.

View larger version (16K): [in this window] [in a new window]   FIG. 1.   Pathway of degradation of cyclohexanol by Acinetobacter sp. strain NCIMB 9871. ChnA, cyclohexanol dehydrogenase; ChnB, cyclohexanone 1,2-monooxygenase (CHMO); ChnC, -caprolactone hydrolase; ChnD, 6-hydroxyhexanoate dehydrogenase; ChnE, 6-oxohexanoate dehydrogenase. Further oxidation of adipate to acetyl coenzyme A (acetyl-CoA) and succinyl coenzyme A (succinyl-CoA) proceeds via -oxidation. This pathway is abridged from the pathway described in reference 9.

Cloning of a 8.1-kb BamHI fragment containing chnB and additional genes. The bacterial strains and plasmids used in this study are listed in Table 1. Luria-Bertani (LB) medium was used for cultivation of bacteria (8). For LB plates, agar was added at a concentration of 1.5%. Plasmid DNA was isolated by the method of Birnboim and Doly (1). To select for Escherichia coli transformants, ampicillin was added at a concentration of 100 µg/ml. Genomic DNA of Acinetobacter sp. strain NCIMB 9871 was prepared as described by Chen et al. (6) and was digested with BamHI. Southern transfer was carried out by using conventional procedures (19), and Southern blots were probed with a digoxigenin-labeled PCR product that was prepared as follows. The entire chnB coding sequence and 56 bp of the 5' noncoding sequence (6) were amplified by using primers 5'-TGAATAACCAGCACTGCAG-3' and 5'-GGCATTGGCAGGTTGCTT-3'. The amplification conditions were 94°C for 1 min, 50°C for 1 min, and 72°C for 1 min, and 30 cycles were used. The 1.68-kb PCR product was purified from a 0.8% agarose gel and was labeled by using the digoxigenin-11UTP system as recommended by the manufacturer (Boehringer Mannheim GmbH). With Southern exposure, a single hybridizing band at about 8 kb was obtained (data not shown). Subsequently, a purified 7.5- to 8.5-kb size fraction of BamHI-digested Acinetobacter chromosomal DNA from a 0.8% agarose gel was ligated to E. coli plasmid pUC18 (29) which had been linearized by BamHI digestion and had been dephosphorylated by using alkaline phosphatase (New England BioLabs, Beverly, Mass.).

View this table: [in this window] [in a new window]   TABLE 1.   Bacterial strains and plasmids used in this study

Transformation in E. coli XL1-blue (3) and selection by colony hybridization with the chnB probe resulted in isolation of a recombinant plasmid, which was designated pCM100. A restriction map of the DNA insert in plasmid pCM100 is shown in Fig. 2. Derivatives of pCM100 are shown in Table 1 and Fig. 2.

View larger version (16K): [in this window] [in a new window]   FIG. 2.   Restriction and gene map of the DNA insert in plasmid pCM100 and its derivatives. Abbreviations: B, BamHI; Sa, SalI; A, AccI; Sp, SphI; N, NheI; E, EcoRI. The arrows indicate the locations and directions of transcription of the CHMO-encoding gene (chnB), the 6-oxohexanoate dehydrogenase-encoding gene (orf1 or chnE), and a regulatory chnR gene. The ability (+) or inability () of each plasmid to express ChnB activity is indicated.

Inducible expression of chnB in E. coli by cyclohexanone. Cells of E. coli XL1-blue harboring pCM100 were grown in LB medium at 30°C. When the culture reached an optical density at 660 nm of 0.4 to 0.5, cyclohexanone was added to the medium at a final concentration of 5 mM. At various times, cells were harvested by centrifugation, washed in 50 mM sodium-potassium phosphate buffer (pH 7.2), resuspended in 0.04 volume of the same buffer, and sonicated by using four 20-s bursts with a Braun Sonifier 250 apparatus. After centrifugation for 30 min at 18,000 × g and 4°C, the supernatant was used to measure enzyme activity. The ChnB activity was determined at 25°C by measuring the decrease in absorbance at 340 nm in a solution containing 80 µmol of glycine-NaOH (pH 9.0), 1 µmol of cyclohexanone, 0.2 µmol of NADPH, and the crude enzyme. One unit of activity was defined as the amount of enzyme required to convert 1 µmol of cyclohexanone in 1 min. Protein concentrations were determined by the method of Bradford (2).

ChnB activity was observed in cells grown in the presence of cyclohexanone. The highest specific activity was 1.2 U/mg of protein after 10 h of induction, a value that was approximately twice the value obtained for Acinetobacter sp. strain NCIMB 9871 (9).

Concomitant with cyclohexanone induction the ChnB protein was produced. This was shown by the appearance of a 61-kDa protein band in a Coomassie blue-stained sodium dodecyl sulfate-polyacrylamide gel containing a crude lysate prepared from pCM100-containing cells. This molecular mass is consistent with the mass deduced from the chnB sequence (60,773 Da) (6). An amino acid sequence analysis of the 61-kDa protein obtained from a sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel by using an Applied Biosystems model 477A protein sequencer (Perkin-Elmer Japan Co., Ltd., Chiba, Japan) confirmed the first 10 amino acids of the ChnB protein predicted by gene sequencing (SQKMDFDAIV).

The ChnB protein was also produced in cyclohexanone-induced E. coli cells grown at 37°C. However, at this temperature inclusion bodies were formed.

Localization and nucleotide sequence analysis of the chnB regulatory region. A lack of ChnB induction by cyclohexanone in E. coli cells containing pCM102 or pCM103 indicated that the DNA in the AccI-SalI segment of pCM101 was required for chnB expression (Fig. 2). To check for the presence of possible genes, the DNA insert in plasmid pCM101 was sequenced by using an Applied Biosystems model 373A DNA sequencer (Perkin-Elmer Japan Co.). The sequence was analyzed by using GENETYX-Mac software (Software Development Co., Ltd., Tokyo, Japan) and the FASTA program (16) of the Genomunet service (Institute for Chemical Research, Kyoto University).

On the basis of an analysis of the DNA sequence data, we predicted that there are two open reading frames (ORFs) which are 67 bp downstream from the termination codon of chnB and are separated by a 61-bp intergenic sequence (Fig. 2). The previously determined sequence of chnB (CHMO) (6) helped establish the identity and orientation of the accompanying genes. Both ORFs are preceded by an appropriately positioned consensus ribosome-binding site (AGGGA in one ORF and AAGGA in the other ORF). The G+C contents of the ORFs (44.3 and 42.3%, respectively) are typical of Acinetobacter genes (14, 27).

Following the termination codon of chnB a 9-bp inverted repeat sequence (ATATGGGGGGCATCCCCCATAT; the inverted sequences are underlined) was observed. The significance of this finding may be related to the formation of a transcriptional terminator for chnB. Also, a 12-bp imperfect inverted repeat (CTGATTTTCAATAAAGCATCCACTGAAAACCAG; the inverted sequences are underlined) was found following the termination codon of orf2.

Characteristics of ORF1 (ChnE). A comparison of the deduced amino acid sequence of ORF1 (478 amino acids) with sequences in the Swiss Protein database revealed homology to members of the superfamily consisting of NAD(P)⁺-dependent aldehyde dehydrogenases. These enzymes act on a broad variety of aldehyde and semialdehyde substrates by transforming them to carboxylic acids (11). The two highest scores given by a FASTA search (16) were the scores for GABD_Ecoli succinate semialdehyde dehydrogenase (38.5% identity) and SSDH_rat succinate semialdehyde dehydrogenase (38.9% identity).

Not surprisingly, in a dendrogram analysis (data not shown) ORF1 was found to cluster with these sequences together with the lactaldehyde dehydrogenase sequence of E. coli K-12 (sw:alda_ecoli). In the phylogenetic tree consisting of 145 aldehyde dehydrogenases recently compiled by Perozich et al. (17), the ChnE sequence falls in the succinic semialdehyde dehydrogenase class, one of the 14 aldehyde dehydrogenase families classified.

In the ORF1 sequence Cys-284 and the Gly-228-Thr-230-Gly-233 motif are conserved; these are predicted to be the active site residue and the nicotinamide-binding fingerprint sequence, respectively (15).

We verified the molecular mass of the orf1 gene product by performing [³⁵S]methionine labeling with expression of plasmid pT7-coupled T7 RNA polymerase and the promoter system (25). As shown in Fig. 3 (lane 1), the expected molecular mass (52 kDa) was observed with the plasmid construct pT7-(chnB-orf1-orf2). An internal deletion in orf1 resulting from removal of a SphI fragment (plasmid pT7-orf1) (Table 1) reduced the molecular mass to 29 kDa (Fig. 4, lane 3). This value is consistent with the calculated mass of 258 amino acids due to in-frame removal of the encoding SphI fragment.

View larger version (59K): [in this window] [in a new window]   FIG. 3.   Radiolabel identification of polypeptides separated on a 10% polyacrylamide sodium dodecyl sulfate-polyacrylamide electrophoresis gel. Lane 1, pT7-(chnB-orf1-orf2); lane 2, pT7-orf2; lane 3, pT7orf1. Samples were processed as described by Tabor (25). The experimentally determined sizes of ChnB, ChnE, and ChnR, as estimated by using 14C-methylated molecular mass markers (data not shown), are 66, 52, and 34 kDa, respectively. ChnE is truncated ChnE estimated to have a molecular mass of 29 kDa. The question mark indicates an unknown protein band.

Based on the known degradative pathway of cyclohexanol (Fig. 1), ORF1 is most likely 6-oxohexanoate dehydrogenase that carries out conversion of 6-oxohexanoate to adipate. To establish this, the following plasmid construction and enzyme activity analyses were carried out.

Two primers, 5'-CGGAATTCATGAACTATCCAAATATAC-3' and 5'-AAAACTGCAGAATTGGTGTGCCTACGCACACCA-3' (the built-in EcoRI and PstI restriction sites, respectively, are underlined), were synthesized in order to amplify orf1 by using Vent DNA polymerase (New England BioLabs). The amplification conditions were as follows: 30 cycles consisting of 94°C for 1 min, 50°C for 1 min, and 72°C for 1 min. The resulting 1.4-kb DNA fragment was purified from a 0.8% agarose gel, digested with EcoRI and PstI, and cloned into expression plasmid pSD80 (20), which yielded pCM130 (Table 1). The DNA insert in pCM130 was sequenced, and the sequence confirmed that mutations resulting from PCR amplification were not present.

E. coli JM109(pCM130) cells were grown at 30°C in 100 ml of LB medium containing 100 µg of ampicillin per ml. At a cell density of 0.4 to 0.5 U of absorbance at 660 nm, the cells were induced by adding 1.0 mM isopropyl--D-thiogalactopyranoside (IPTG); the induction period was 3 h long. The IPTG-induced cells were harvested by centrifugation, and the pellet was washed in 50 mM phosphate buffer (pH 7.2). After resuspension in 0.04 volume of the same buffer, the cells were sonicated by using four 20-s bursts with a Braun Sonifier 250 apparatus. After centrifugation for 30 min at 18,000 × g and 4°C, a 50-µl aliquot of the supernatant was used to determine 6-oxohexanoate dehydrogenase activity. The assay was carried out as described by Donoghue and Trudgill (9) by measuring the rate of increase in absorbance at 340 nm when 2.0 µmol of adipic semialdehyde methyl ester (Sigma-Aldrich Chemie GmbH) was added to 1 ml (final volume) of a preparation containing 50 µmol of phosphate buffer (pH 7.2), 1.0 µmol of NADP⁺, and crude protein extract. The specific activity of the extract was 0.73 U/mg.

Characteristics of ORF2 (ChnR). ORF2 was predicted to encode a 313-amino-acid protein with a molecular mass of 35,542 Da. In the molecular mass analysis (Fig. 3), both plasmid pT7-(chnB-orf1-orf2) and plasmid pT7-orf2 yielded a 34-kDa protein. Deletion analysis confirmed that ORF2 alone confers the ability to express ChnB activity (Fig. 2). A comparison of the deduced amino acid sequence of ORF2 with sequences in the Swiss Protein database revealed homology to the AraC-XylS family of regulators (10). The level of sequence identity with XylS, an activator of the pWWO-encoded toluene-xylene degradation genes in Pseudomonas putida mt-2 (12, 21), was 30%. Other related proteins are AraC, a regulatory protein for the arabinose operon in E. coli (24) and Salmonella typhimurium (7), and PocR of S. typhimurium (5). Typically present in these proteins is an approximately 99-amino-acid region near the C terminus where a potential helix-turn-helix DNA-binding motif is located along with several highly conserved amino acids (Fig. 4A). The effector binding region is poorly conserved and located at the N terminus in members of this protein family (10). However, with a given effector compound it is possible to find a consensus sequence between the regulator and the detoxifying enzyme. We observed a consensus amino acid sequence between amino acid residues 32 to 56 of ORF2 (designated ChnR) and amino acid residues 67 to 91 of ChnB (Fig. 4B). These peptide regions are possible binding sites for cyclohexanone. Further experiments are required to test this possibility.

View larger version (17K): [in this window] [in a new window]   FIG. 4.   (A) Alignment of portions of the amino acid sequences of ChnR (this study), XylS of P. putida (12, 21), AraC of E. coli (24), and PocR of S. typhimurium (5). The consensus sequence and location of a predicted helix-turn-helix are described in reference 9. (B) Possible effector binding sequences of ChnR and ChnB (CHMO).

Expression of ChnR was sufficient to induce ChnB in E. coli. Two primers were synthesized to amplify 36 bp of the 5' region of chnB plus 537 bp of the 5' noncoding sequence, and the resulting DNA fragment was cloned in the pLacZ plasmid (Table 1), which yielded pCM110. The primers were 5'-GCTCTAGAGGATCCTTCACAGAACATCA-3' and 5'-AAAAGGCCTAATCACGATAGCATCAAAATC-3' (built-in XbaI and StuI restriction sites respectively, are underlined) and were used to facilitate cloning at the compatible sites (XbaI and SmaI) of pLacZ. The amplification conditions were as follows: 30 cycles consisting of 94°C for 1 min, 50°C for 1 min, and 72°C for 1 min. We tested ChnR function in E. coli JM109 by constructing pCM110 containing a chnB::lacZ transcriptional fusion (4). The chnR gene was carried on a pACYC184-based compatible plasmid, pCM120 (Table 1). In the absence of chnR, a low level (<90 U/mg of protein) of -galactosidase expression was observed in both cyclohexanone-induced and noninduced cells. On the other hand, -galactosidase activity was increased approximately 10-fold (to 850 U/mg of protein) in E. coli JM109 cells harboring both pCM110 and pCM120. The presence of cyclohexanone increased the activity by an additional 22-fold (to 18,816 U/mg of protein), and the level of expression accounted for approximately 5.5% of the total cellular protein expression.

Concluding remarks. To the best of our knowledge, ChnR is the first regulatory gene for bacterial degradation of monocyclic cycloparaffin compounds that has been identified. The importance of ChnR in induction of CHMO activity by cyclohexanone was demonstrated. In future experiments we will attempt to elucidate the DNA binding site(s) of ChnR and the effector binding region in ChnR. The presence of a putative terminator sequence after the stop codon of chnB suggests that expression of chnE may not be regulated by ChnR. The fact that the remaining genes in the cyclohexanol degradation pathway appear to be present in three separate operons (13) implies that the regulatory circuit for cyclohexanol degradation is complex.

Nucleotide sequence accession number. The DNA sequence of the 6.2-kb BamHI-SalI fragment encompassing chnB-chnE-chnR has been deposited in the DDBJ, GenBank, and EMBL DNA databases under accession no. AB006902.

	ACKNOWLEDGMENTS

Financial support for this study was provided by Kansai University Research Grants: Grant-in-Aid for Joint Research, 1998.

We thank Joseph Zimmermann for carefully proofreading the manuscript.

	FOOTNOTES

^* Corresponding author. Mailing address: Department of Biotechnology, Faculty of Engineering & High Technology Research Center, Kansai University, Suita, Osaka 564-8680, Japan. Phone: (06) 6368-0909. Fax: (06) 6388-8609. E-mail: yoshie{at}ipcku.kansai-u.ac.jp.

This publication is issued as NRCC number 43271.

	REFERENCES

Top Abstract Text References

1.	Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7:1513-1523[Abstract/Free Full Text].
2.	Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254[Medline].
3.	Bullock, W. O., J. M. Fernandez, and J. M. Short. 1987. XL1-Blue: a high efficiency plasmid transforming recA Escherichia coli strain with -galactosidase selection. BioTechniques 5:376-379.
4.	Casadaban, M. J., A. Martinez-Arias, S. K. Shapira, and J. Chou. 1983. -Galactosidase gene fusions for analyzing gene expression in Escherichia coli and yeast. Methods Enzymol. 100:293-308[Medline].
5.	Chen, P., D. I. Andersson, and J. R. Roth. 1994. The control region of the pdu/cob regulon in Salmonella typhimurium. J. Bacteriol. 176:5474-5482[Abstract/Free Full Text].
6.	Chen, Y.-C. J., O. P. Peoples, and C. T. Walsh. 1988. Acinetobacter cyclohexanone monooxygenase: gene cloning and sequence determination. J. Bacteriol. 170:781-789[Abstract/Free Full Text].
7.	Clarke, P., H.-C. Lin, and G. Wilcox. 1982. The nucleotide sequence of the araC regulatory gene in Salmonella typhimurium LT2. Gene 18:219-226.
8.	Davis, R. W., D. Bosttein, and J. R. Roth. 1980. Advanced bacterial genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y
9.	Donoghue, N. A., and P. W. Trudgill. 1975. The metabolism of cyclohexanol by Acinetobacter NCIB 9871. Eur. J. Biochem. 60:1-7[Medline].
10.	Gallegos, M.-T., R. Schlief, A. Bairoch, K. Hofmann, and J. L. Ramos. 1997. AraC/XylS family of transcriptional regulators. Microbiol. Mol. Biol. Rev. 61:393-410[Abstract].
11.	Hempel, J., H. Nicholas, and R. Lindahl. 1993. Aldehyde dehydrogenases: widespread structural and functional diversity within a shared framework. Protein Sci. 2:1890-1900[Medline].
12.	Inouye, S., A. Nakazawa, and T. Nakazawa. 1986. Nucleotide sequence of the regulatory gene xylS on the Pseudomonas putida TOL plasmid and identification of the protein product. Gene 44:235-242[Medline].
13.	Iwaki, H., Y. Hasegawa, T. Tokuyama, H. Bergeron, and P. C. K. Lau. Unpublished data.
14.	Kowalchuk, G. A., G. B. Hartnett, A. Benson, J. E. Houghton, K.-L. Ngai, and L. N. Ornston. 1994. Contrasting patterns of evolutionary divergence within the Acinetobacter calcoaceticus pca operon. Gene 146:23-30[Medline].
15.	Liu, Z.-J., Y.-J. Sun, J. Rose, Y.-J. Chung, C.-D. Hsiao, W.-R. Chang, I. Kuo, J. Perozich, R. Lindahl, J. Hempel, and B.-C. Wang. 1997. The first structure of an aldehyde dehydrogenase reveals novel interactions between NAD and the Rossmann fold. Nat. Struct. Biol. 4:317-326[Medline].
16.	Pearson, W. R., and D. J. Lipman. 1988. Improved tools for biological sequence comparison. Proc. Natl. Acad. Sci. USA 85:2444-2448[Abstract/Free Full Text].
17.	Perozich, J., H. Nicholas, B.-C. Wang, R. Lindahl, and J. Hempel. 1999. Relationships within the aldehyde dehydrogenase extended family. Protein Sci. 8:137-146[Medline].
18.	Rose, R. E. 1988. The nucleotide sequence of pACYC. Nucleic Acids Res. 16:355[Free Full Text].
19.	Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y
20.	Smith, S. P., K. R. Barber, S. D. Dunn, and G. S. Shaw. 1996. Structural influence of cation binding to recombinant human brain S100b: evidence for calcium-induced exposure of a hydrophobic surface. Biochemistry 35:8805-8814[Medline].
21.	Spooner, R. A., K. Lindsay, and F. C. Franklin. 1986. Genetic, functional and sequence analysis of the xylR and xylS regulatory genes of the TOL plasmid pWWO. J. Gen. Microbiol. 132:1347-1358[Abstract/Free Full Text].
22.	Stewart, J. D. 1998. Cyclohexanone monooxygenase: a useful reagent for asymmetric Baeyer-Villiger reactions. Curr. Org. Chem. 2:195-216.
23.	Stewart, J. D., K. W. Reed, C. A. Martinez, J. Zhu, G. Chen, and M. M. Kayser. 1998. Recombinant Baker's yeast as a whole-cell catalyst for asymmetric Baeyer-Villiger oxidations. J. Am. Chem. Soc. 120:3541-3548.
24.	Stoner, C. M., and R. Schleif. 1982. Is the amino acid but not the nucleotide sequence of the Escherichia coli araC gene conserved? J. Mol. Biol. 154:649-652[Medline].
25.	Tabor, S. 1990. Expression using the T7 RNA polymerase/promoter system, p. 16.2.1-16.2.11. In F. A. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. Greene Publishing and Wiley-Interscience, New York, N.Y
26.	Trudgill, P. W. 1986. Terpenoid metabolism by Pseudomonas, p. 483-525. In J. R. Sokatch (ed.), The bacteria, a treatise on structure and function, vol. X. Academic Press, Inc., New York, N.Y
27.	White, P. J., I. S. Hunter, and C. A. Fewson. 1991. Codon usage in Acinetobacter structural genes, p. 251-257. In K. J. Towner, E. Bergogne-Berezin, and C. A. Fewson (ed.), The biology of Acinetobacter. Plenum Press, New York, N.Y
28.	Willetts, A. 1997. Structural studies and synthetic applications of Baeyer-Villiger monooxygenases. Trends Biotechnol. 15:55-62[Medline].
29.	Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strain: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119[Medline].

---

Applied and Environmental Microbiology, November 1999, p. 5158-5162, Vol. 65, No. 11
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

This article has been cited by other articles:

• Watanabe, S., Kodaki, T., Makino, K. (2006). A Novel {alpha}-Ketoglutaric Semialdehyde Dehydrogenase: EVOLUTIONARY INSIGHT INTO AN ALTERNATIVE PATHWAY OF BACTERIAL L-ARABINOSE METABOLISM. J. Biol. Chem. 281: 28876-28888 [Abstract] [Full Text]  
• Hare, J. M., Perkins, S. N., Gregg-Jolly, L. A. (2006). A Constitutively Expressed, Truncated umuDC Operon Regulates the recA-Dependent DNA Damage Induction of a Gene in Acinetobacter baylyi Strain ADP1.. Appl. Environ. Microbiol. 72: 4036-4043 [Abstract] [Full Text]  
• Iwaki, H., Wang, S., Grosse, S., Bergeron, H., Nagahashi, A., Lertvorachon, J., Yang, J., Konishi, Y., Hasegawa, Y., Lau, P. C. K. (2006). Pseudomonad Cyclopentadecanone Monooxygenase Displaying an Uncommon Spectrum of Baeyer-Villiger Oxidations of Cyclic Ketones. Appl. Environ. Microbiol. 72: 2707-2720 [Abstract] [Full Text]  
• Brzostowicz, P. C., Walters, D. M., Thomas, S. M., Nagarajan, V., Rouviere, P. E. (2003). mRNA Differential Display in a Microbial Enrichment Culture: Simultaneous Identification of Three Cyclohexanone Monooxygenases from Three Species. Appl. Environ. Microbiol. 69: 334-342 [Abstract] [Full Text]  
• Iwaki, H., Hasegawa, Y., Wang, S., Kayser, M. M., Lau, P. C. K. (2002). Cloning and Characterization of a Gene Cluster Involved in Cyclopentanol Metabolism in Comamonas sp. Strain NCIMB 9872 and Biotransformations Effected by Escherichia coli-Expressed Cyclopentanone 1,2-Monooxygenase. Appl. Environ. Microbiol. 68: 5671-5684 [Abstract] [Full Text]  
• Kostichka, K., Thomas, S. M., Gibson, K. J., Nagarajan, V., Cheng, Q. (2001). Cloning and Characterization of a Gene Cluster for Cyclododecanone Oxidation in Rhodococcus ruber SC1. J. Bacteriol. 183: 6478-6486 [Abstract] [Full Text]  
• Cheng, Q., Thomas, S. M., Kostichka, K., Valentine, J. R., Nagarajan, V. (2000). Genetic Analysis of a Gene Cluster for Cyclohexanol Oxidation in Acinetobacter sp. Strain SE19 by In Vitro Transposition. J. Bacteriol. 182: 4744-4751 [Abstract] [Full Text]  
• Brzostowicz, P. C., Gibson, K. L., Thomas, S. M., Blasko, M. S., Rouvière, P. E. (2000). Simultaneous Identification of Two Cyclohexanone Oxidation Genes from an Environmental Brevibacterium Isolate Using mRNA Differential Display. J. Bacteriol. 182: 4241-4248 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Iwaki, H. Articles by Lau, P. C. K. Search for Related Content PubMed PubMed Citation Articles by Iwaki, H. Articles by Lau, P. C. K. Agricola Articles by Iwaki, H. Articles by Lau, P. C. K.