Previous Article | Next Article ![]()
Applied and Environmental Microbiology, December 1999, p. 5252-5256, Vol. 65, No. 12
Mycotoxin Research Unit, USDA/ARS National
Center for Agricultural Utilization Research, Peoria, Illinois
61604,1 and Department of Chemistry,
University of Maryland, College Park, Maryland 207422
Received 10 March 1999/Accepted 10 September 1999
We screened a Fusarium sporotrichioides NRRL 3299 cDNA
expression library in a toxin-sensitive Saccharomyces
cerevisiae strain lacking a functional PDR5 gene.
Fourteen yeast transformants were identified as resistant to the
trichothecene 4,15-diacetoxyscirpenol, and each carried a cDNA encoding
the trichothecene 3-O-acetyltransferase that is the
F. sporotrichioides homolog of the Fusarium
graminearum TRI101 gene. Mutants of F. sporotrichioides NRRL 3299 produced by disruption of
TRI101 were altered in their abilities to synthesize T-2
toxin and accumulated isotrichodermol and small amounts of 3,15-didecalonectrin and 3-decalonectrin, trichothecenes that are not
observed in cultures of the parent strain. Our results indicate that
TRI101 converts isotrichodermol to isotrichodermin and is required for
the biosynthesis of T-2 toxin.
Trichothecenes are sesquiterpene
epoxide mycotoxins produced by species of Fusarium,
Trichothecium, and Myrothecium that act as potent
inhibitors of eukaryotic protein synthesis (21). The broad
spectrum of trichothecene toxicity probably is due to their ability to
interact with highly conserved elements of the protein-synthetic apparatus. While trichothecene vertebrate toxicity has been the focus
of numerous studies due to the frequent occurrence of trichothecenes in
agricultural products, the observed phytotoxicity of trichothecenes has
stimulated research into the role these toxins may play in plant
diseases caused by some Fusarium species (4, 6, 11, 24).
The biosynthesis of the trichothecene T-2 toxin in Fusarium
sporotrichioides has been studied with the aid of mutant strains blocked at specific steps in the trichothecene pathway (5, 12,
18-20). Many of the trichothecene pathway genes in F. sporotrichioides (12) are localized in a gene cluster
of at least nine genes including genes for P450 oxygenases (1,
9), an acetyltransferase (19), a transcription factor
required for pathway gene expression (25), and a toxin
efflux pump (2).
Trichothecenes are antibiotics, and their biosynthesis likely requires
special adaptations by the producing organisms for self-protection.
Antibiotic-producing microorganisms use various mechanisms for
self-protection including alteration of target proteins, pumps to
reduce the intracellular concentration of the antibiotic, and
metabolism to reduce toxicity (3). Trichothecene 3-O-acetyltransferase (TRI101) catalyzes the conversion of
toxic Fusarium trichothecenes to less-toxic products and
has, therefore, been proposed as a metabolic self-protection mechanism
in Fusarium graminearum (13). TRI101
is not tightly linked to other trichothecene biosynthetic genes in
either F. graminearum or F. sporotrichioides (13-15). The enzyme encoded by TRI101 can modify
a number of trichothecenes and, when expressed in
Schizosaccharomyces pombe, confers resistance to
trichothecenes (13). It was suggested that TRI101
acetylation, rather than modification or replacement of target
ribosomes, is the primary defense mechanism against 3-hydroxylated
trichothecenes in Fusarium and that a mutation resulting in
a loss of TRI101 would be lethal (13).
Our objectives in this study were to determine (i) if inactivation of
TRI101 was lethal and (ii) if TRI101 functions in
both Fusarium self-protection against trichothecenes and
trichothecene biosynthesis. We found that disruption of
TRI101 was not lethal and that TRI101 deletion
mutants accumulated isotrichodermol, a 3-hydroxytrichothecene. These
mutants could both germinate and grow in the presence of
isotrichodermol and other 3-hydroxytrichothecenes. These results show
that although expression of TRI101 in Saccharomyces cerevisiae and S. pombe increased their resistance to
trichothecenes, TRI101 is not an essential self-defense
mechanism for F. sporotrichioides. Our results also show
that TRI101 is an essential trichothecene-biosynthetic gene
and are consistent with the hypothesis that much of the T-2 toxin
pathway is via 3-acetylated intermediates.
Strains.
F. sporotrichioides NRRL 3299 was obtained
from the USDA Agricultural Research Service Culture Collection at the
National Center for Agricultural Utilization Research, Peoria, Ill.,
and maintained on V-8 juice agar slants (29). F. sporotrichioides FsTri101-3D contains disrupted sequences for
TRI101 as described below. S. cerevisiae RW2802
(PDR5 leu2 ura3-52 met5) and JG436 (pdr5::Tn5 leu2 ura3-35 met5) were obtained from
J. Golin, The Catholic University of America (22).
Media and culture conditions.
All Fusarium
cultures were grown initially on V-8 juice agar plates under an
alternating cycle of 12 h of light at 25°C and 12 h of dark
at 22°C. Conidia were washed from the plates and grown in YPG medium
(0.3% yeast extract, 1% peptone, 2% glucose) for DNA isolation or in
GYEP medium (5% glucose, 0.1% yeast extract, 0.1% peptone) for toxin
production (33). For yeast transformations, cells were grown
on YPD (1% yeast extract, 2% peptone, 2% glucose) plates for 1 to 3 days; otherwise, cultures were maintained on glucose minimal media with
appropriate supplements (1 g of leucine, 0.2 g of uracil, and
0.2 g of methionine/liter). For feeding studies, yeasts were grown
in Ygal (1% yeast extract, 2% peptone, 2% galactose) to induce
plasmid expression.
Physical analyses.
Gas chromatography (GC) measurements were
made by flame ionization detection with a Hewlett-Packard 5890 gas
chromatograph fitted with a 30-m fused-silica capillary column (DB1;
0.25 µm; J&W Scientific Co., Palo Alto, Calif.). For routine
screening of the trichothecene toxin phenotype, the column was held at
120°C at injection, then heated to 210°C at 15°C/min and held for
1 min, and then heated to 260°C at 5°C/min and held for 8 min.
Low-resolution mass spectra were obtained by GC-mass spectrometry (MS)
with a Hewlett-Packard 5891 mass-selective detector fitted with a DB-5 MS column (15-m by 0.25-mm film thickness).
DNA and RNA manipulations.
The cDNA expression library was
constructed with mRNA from an F. sporotrichioides NRRL 3299 culture grown for 23 h in GYEP. cDNA was cloned into the yeast
expression vector pYES2 (Invitrogen, Carlsbad, Calif.). Plasmid
preparation methods were as previously described (2). A
cosmid library of F. sporotrichioides NRRL 3299 genomic DNA
was made in the SuperCos1 vector (Stratagene, La Jolla, Calif.) in
accordance with the manufacturer's instructions and was screened with
a 32P-labeled probe corresponding to the TRI101
coding region. DNA labeling was performed with the Prime-a-Gene kit
(Stratagene). Sequencing was performed with the DYEdeoxy sequencing kit
(Applied Biosystems, Foster City, Calif.). Southern hybridizations were performed as described by Sambrook et al. (26).
Gene disruption and transformations.
To disrupt
TRI101 we subcloned a PCR (Pfu polymerase;
Stratagene) fragment of about 5 kb from cosmid 5-1 that contains
TRI101 into plasmid pBluescript II SK(+) (Stratagene)
digested with BamHI/Ecl 136 to form
pTriR-2. A chimeric hygromycin B phosphotransferase gene
(hyg) containing promoter 1 from Cochliobolus
heterostrophus (32) was cloned into the unique
NcoI site located 90 bp downstream of the ATG start site in
TRI101. The resulting plasmid, pTriR-3 (Fig.
1), was used to transform F. sporotrichioides as previously described (25). The PCR
analysis employed primers 955 (5'
GCGCTGCAGATCAAAATGGCCGAACAAGC 3'), 957 (5'
GTTTCCTTCGCTGATGCC 3'), 997 (5'
GGCGGTACCACAGAAAAGAGTAAAAGG 3'), 1134 (5'
GTCGATCGATACGCACGC 3'), and 1135 (5' CTGGTCGTTGTATGTAGCC 3'). The underlined sequence in 955 indicates an added
PstI site, and that in 997 indicates an added
KpnI site. These primers have complementary sequences that
are located both inside and outside the TRI101 sequences
present in plasmid pTriR-3 (Fig. 1). In the Southern
analysis, genomic DNA of transformants was digested with BamHI/XbaI and hybridized to a
32P-labeled probe consisting of the TRI101
coding regions.
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Disruption of TRI101, the Gene Encoding
Trichothecene 3-O-Acetyltransferase, from
Fusarium sporotrichioides
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (24K):
[in a new window]
FIG. 1.
Disruption vector for gene disruption of
TRI101. B, BamHI site; K, KpnI site;
N, NdeI site; ATG, start codon of TRI101. Numbers
reference primers used in PCR analysis. pTriR-3 is the
chimeric plasmid. The middle diagram indicates the wild-type DNA with
the crossover events; the bottom diagram indicates a gene replacement
to form the gene disruption.
Germination and growth on toxin-containing media. To determine what effect the loss of TRI101 had on the growth of F. sporotrichioides in the presence of toxin, YPG agar plates containing 4,15-diacetoxyscirpenol (4,15-DAS) or T-2 toxin at 0, 100, 500, or 1,000 µg/ml were inoculated with a dilution containing approximately 10 spores of F. sporotrichioides NRRL 3299 or mutant strain FsTri101-3D. Plates were incubated at 28°C.
Trichothecene toxin assays. Liquid cultures of F. sporotrichioides were harvested after 7 days, extracted with ethyl acetate, and analyzed by gas-liquid chromatography (GLC) as described previously (19). Trichothecene concentrations were determined from the appropriate standard curves. Compound identifications were confirmed by GC-MS. For deoxynivalenol assays, trimethylsilyl ether derivatives were prepared with Tri-Sil TBT (Pierce, Rockford, Ill.).
Extraction and isolation of trichothecenes. We isolated trichothecenes produced by the mutant strain from liquid shake cultures of F. sporotrichioides FsTri101-3D grown for 7 days at 28°C and 200 rpm on YPD (1 liter in 2-liter Erlenmeyer flasks). Cultures were extracted twice with 600 ml of ethyl acetate, and the combined extracts were concentrated under reduced pressure. The syrup was separated on a silica gel column eluted with dichloromethane-methanol (95:5). Twelve 40-ml fractions were collected, and separation was monitored by thin-layer chromatography and GLC. Fractions 4 to 6 contained isotrichodermol. Fractions 8 to 10 contained 3,15-didecalonectrin.
Trichothecene standards. 4,15-DAS was isolated from F. sporotrichioides 1716cos9-1 (12); 15-monoacetoxyscirpenol was prepared by treating 4,15-DAS with 0.1 N NaOH; 3,4,15-triacetoxyscirpenol (3,4,15-TAS) was prepared from 4,15-DAS treated with acetic anhydride in pyridine. Isotrichodermin, 8-hydroxyisotrichodermin, and 8-hydroxyisotrichodermol were isolated from F. sporotrichioides mutant Allb (18); isotrichodermol was prepared by hydrolysis of isotrichodermin with 0.1 N NaOH. Deoxynivalenol and 15-acetyldeoxynivalenol were isolated from Gibberella zeae 3639 (24) grown on cornmeal. T-2 toxin was isolated from F. sporotrichioides NRRL 3299. 15-Decalonectrin and 3,15-didecalonectrin were isolated from F. sporotrichioides mutant strain O2 (19). All standards were greater than 95% pure as determined by GLC.
Whole-cell feeding experiments. Liquid cultures of F. sporotrichioides FsTri101-3D were inoculated with conidia washed from the V-8 plates, at a starting density of 5 × 104 conidia/ml in 10 ml of GYEP medium in a 50-ml Erlenmeyer flask, and incubated on a gyratory shaker (200 rpm) at 28°C. After 24 h, a 25 mM stock solution of the trichothecene in acetone was added to the culture to a final concentration of 250 µM (1% acetone). Six substrates were tested: 4,15-DAS, 3,4,15-TAS, isotrichodermin, 15-decalonectrin, 3,15-didecalonectrin, and 8-hydroxyisotrichodermin. Control cultures had acetone added to a final concentration of 1% acetone. Cultures were incubated on a rotary shaker (200 rpm) at 28°C for up to six additional days and then were extracted with ethyl acetate and analyzed by GLC.
Liquid yeast cultures were inoculated with a loop of yeast cells from a minimal medium plate. For feeding studies, yeast was grown on supplemented minimal media for 2 days and centrifuged (1,600 × g, 5 min), and the pellet was resuspended in Ygal to induce plasmid expression. Cultures were normalized for optical density. After 2 h, the cultures were amended with a solution of the trichothecene (1 mg/10 ml of medium) in acetone (final concentration of 1% acetone). Six substrates were tested: 4,15-DAS, isotrichodermol, 15-monoacetoxyscirpenol, T-2 toxin, deoxynivalenol, and 15-decalonectrin. Cultures were incubated on a rotary shaker (200 rpm) at 28°C for up to five additional days and then were extracted with ethyl acetate and analyzed by GLC.Cell-free system. Cell extracts of F. sporotrichioides NRRL 3299 and FsTri101-3D were made from liquid GYEP cultures incubated for 42 h on a gyratory shaker (200 rpm) at 28°C in the dark. Cultures were vacuum filtered, washed with nitrogen, and extracted with 3.5 ml of 10 mM potassium phosphate buffer (pH 7.0) containing 1 mM 2-mercaptoethanol. The extract was centrifuged at 3,000 × g for 10 min at 4°C, and the supernatant was decanted and centrifuged at 3,000 × g for an additional 5 min. Assays were run at 30°C and were initiated by the addition of 100 µl of the cell extract to a reaction mixture containing 250 µl of potassium phosphate buffer (pH 7.5), 10 µl of the trichothecene substrate in acetone (1 mg/50 µl of acetone), 100 µl of 20 mM MgSO4, and 50 µl of acetyl coenzyme A (Sigma, St. Louis, Mo.) in water (25 mg/200 µl). Controls contained an additional 100 µl of potassium phosphate buffer in place of the cell extract. Immediately after addition of the cell extract and at 1, 2, and 4 h following addition, 100-µl aliquots of the reaction mixture were transferred to a glass vial containing 60 µl of ethanol. The samples were dried under a stream of nitrogen, redissolved in 50 µl of ethyl acetate or methanol, and analyzed by GLC. Six substrates were tested: isotrichodermol, 4,15-DAS, 15-monoacetoxyscirpenol, deoxynivalenol, 15-acetyldeoxynivalenol, and T-2 toxin.
Isolation of TRI101. Trichothecene-sensitive S. cerevisiae JG436 was used as a host for the expression of an F. sporotrichioides cDNA library. The increased trichothecene sensitivity of yeast strain JG436 results from the absence of a functional pleiotropic drug resistance gene, PDR5 (22). cDNA library construction employed the yeast expression vector pYES2 and mRNA harvested under growth conditions supporting maximum levels of trichothecene pathway gene expression. Following the initial transformation of JG436, cells were plated under plasmid selection conditions and the transformants were pooled. Dilutions of the transformant pools were then selected for resistance to trichothecenes by plating them onto media containing 4,15-DAS. Of the 45 resistant colonies isolated, 16 were analyzed further. Plasmids rescued from these transformants could retransform JG436 to the trichothecene resistance phenotype. Of the 16 analyzed clones, 14 contained the same cDNA.
Nucleotide sequence accession number. The nucleotide sequence of TRI101 has been submitted to GenBank under accession no. AF127176.
| |
RESULTS |
|---|
|
|
|---|
TRI101 expression in yeast. Analysis of trichothecenes from liquid cultures of yeast transformed with TRI101 amended with 4,15-DAS indicated that about 50% of the 4,15-DAS was converted to 3,4,15-TAS in 3 days. Based on the proposed pathway for biosynthesis of T-2 toxin (5), we think that isotrichodermol is the likely substrate for TRI101 in the T-2 toxin pathway. Isotrichodermol is the first intermediate in Fusarium pathways to possess the trichothecene core structure and also has a C-3 hydroxyl group.
Whole-yeast cell-feeding experiments using isotrichodermol as a precursor indicated that nontransformed yeast converted only a very small amount to the acetylated product isotrichodermin. Yeast transformed with TRI101 showed complete conversion to isotrichodermin within 44 h. Conversion of other 3-O-hydroxyl trichothecenes to their 3-O-acetyl analogs was slower. Conversion rates for all trichothecene substrates were improved in yeast expressing both TRI101 and the trichothecene efflux pump TRI12. TRI12 has been reported to increase conversion rates when paired with TRI3 in yeast (2).Characterization of TRI101. Analysis of the cDNA and corresponding genomic sequences for TRI101 indicated that the coding region consists of 1,380 bp with no introns and that TRI101 encodes a protein of 459 amino acids. A putative TRI6 binding site with the sequence TNAGGCCT (10, 25) is located 315 bp upstream of the start codon. Cosmid clones containing TRI101 do not appear to overlap cosmids carrying the other described trichothecene pathway genes, in agreement with published reports indicating TRI101 is not closely linked to the pathway gene cluster (13, 14).
Disruption of TRI101. Disruption of TRI101 was accomplished via transformation of wild-type strain F. sporotrichioides NRRL 3299 with plasmid pTriR-3, which included the entire TRI101 coding region into which the chimeric hyg gene had been inserted. Four of sixteen transformants, e.g., FsTri101-3D, were identified as TRI101 disruptants by PCR analysis with primers 955 or 1134 paired with 957, 997, or 1135 (Fig. 1). The single fragment amplified from FsTri101-3D genomic DNA with each primer combination was 2.5 kb larger than the single product amplified from genomic DNA of the wild-type progenitor strain. The increased size of FsTri101-3D PCR products is consistent with disruption of TRI101 via two homologous recombination events between pTriR-3 and chromosomal TRI101 sequences, since the hyg gene is 2.5 kb (Fig. 1). If pTriR-3 had integrated ectopically or via a single homologous recombination event, PCR with primer pairs 955 and 957 would have yielded two amplification products: a 2.0-kb fragment corresponding to the native TRI101 and a 2.7-kb fragment corresponding to the hyg-interrupted TRI101 in pTriR-3. The PCR results were confirmed via Southern hybridization with BamHI/XbaI-digested genomic DNA hybridized to a probe consisting of the TRI101 coding region (data not shown). In the TRI101-disrupted strains the hybridizing band was 2.5 kb larger than the hybridizing band from the wild-type progenitor strain.
Spores of transformant FsTri101-3D were able to germinate and grow on media amended with 4,15-DAS or T-2 toxin. Its radial growth was only slightly reduced at the higher concentrations of 4,15-DAS or T-2 toxin (500 to 1,000 µg/ml) in comparison to growth on media without toxins, although the transformant had more aerial growth in the presence of higher concentrations of toxin. F. sporotrichioides NRRL 3299 produces a number of closely related trichothecenes in liquid cultures of GYEP medium. Culture filtrates typically contain T-2 toxin, neosolaniol, propylneosolaniol, butylneosolaniol, and 4,15-DAS as well as the modified trichothecene apotrichodiol. In these mixtures, T-2 toxin usually constitutes 60 to 80% of the total trichothecenes (100 to 250 µg/ml) produced by 7-day-old shake cultures. Culture filtrates from transformant FsTri101-3D had no detectable levels of the trichothecenes normally produced by the parent strain, although apotrichodiol was still detected. However, three novel peaks were present in the GLC traces of FsTri101-3D liquid culture extracts (Fig. 2).
|
| |
DISCUSSION |
|---|
|
|
|---|
The sequence of TRI101 from F. sporotrichioides NRRL 3299 has 94% similarity to the sequence from the previously reported TRI101 (14), resulting in a 93% protein similarity. No sequence similarities between TRI101 and the several fungal O-acetyltransferases that have significant similarity to each other were detected (8, 16, 17). Although TRI101 also appears unrelated to TRI3 (13), a trichothecene 15-O-acetyltransferase encoded by a gene that resides within the pathway gene cluster (19), both TRI3 and TRI101 share distinct motifs with a group of plant acyltransferases and their genes may be part of an extended acyltransferase gene family. TRI101 is similar in size to these plant acyltransferases and is conserved in both sequence and position for two motifs thought to be involved in catalysis (30).
The regulation of TRI101 in the presence of exogenously added trichothecenes is rapid and unlike that of other trichothecene biosynthetic genes (13). However, there is a putative TRI6 binding site (TNAGGCCT) (10) located in the TRI101 promoter region, which suggests that TRI101 may be regulated by the pathway transcription factor TRI6.
Disruption of the TRI101 gene in F. sporotrichioides confirms that it encodes an enzyme essential for T-2 toxin biosynthesis. A role for TRI101 as a self-protection mechanism in Fusarium was proposed (13) based on the fact that acetylation, like other modifications of the C-3 hydroxyl group of trichothecenes, significantly reduces their toxicity (13, 28). Although we found that yeasts transformed with TRI101 have increased tolerance of 4,15-DAS, the loss of TRI101 in F. sporotrichioides does not result in a significant inhibition of growth on trichothecene-containing media. Therefore, F. sporotrichioides most likely has additional self-protection mechanisms such as the toxin efflux pump encoded by TRI12 (2).
The possibility that multiple 3-O-acetyltransferases are present in Fusarium species has been proposed (14). No residual trichothecene 3-O-acetyltransferase activity was detected in mycelial extracts of the TRI101 disruptant strain, arguing against the possibility that TRI101 activity was still expressed in this mutant or that other trichothecene 3-O-acetyltransferases were expressed in F. sporotrichioides.
Mutants lacking a functional TRI101 produced an altered profile of trichothecenes. Specifically, no T-2 toxin was synthesized and isotrichodermol accumulated as the major trichothecene component. Isotrichodermol accumulation suggests that 3-O-acetylation is required for the subsequent C-15 oxygenation step to occur. Formation of small amounts of 3,15-didecalonectrin and 3-decalonectrin may be due to the presence of relatively high concentrations of isotrichodermol and the ability of the TRI11-encoded C-15 monooxygenase (1) and the TRI3-encoded C-15 acetyltransferase (19) to accept isotrichodermol and didecalonectrin as substrates under these conditions. We think that TRI101 acts as an integral biosynthetic enzyme and that while C-3 acetylation of other trichothecenes may occur, conversion of isotrichodermol to isotrichodermin is the primary biosynthetic reaction catalyzed by TRI101.
The disruptant strain FsTri101-3D can convert isotrichodermin and 15-decalonectrin, both of which have a C-3 acetyl, to T-2 toxin, suggesting that biosynthetic steps after that performed by the TRI101 product are not affected by the disruption reported. Our results are consistent with the hypothesis that most of the F. sporotrichioides trichothecene biosynthetic pathway is via intermediates with a C-3 acetyl protecting group. Mutants with disrupted TRI3 and TRI11 accumulate 15-decalonectrin and isotrichodermin, respectively, indicating that trichothecenes with an acetyl group at C-3 accumulate as predicted. 3,4,15-TAS was not converted to T-2 toxin by the disrupted strain FsTri101-3D, which suggests that there may be deacetylation and reacetylation required at C-3 in the later steps of biosynthesis.
Accepting TRI101 as part of an intracellular protection mechanism implies the existence of an extracellular esterase to activate trichothecenes. In cultures of mutants that accumulate trichothecenes with a C-3 acetyl group, e.g., 15-decalonectrin or isotrichodermin, these acetylated compounds are slowly deacetylated. Four esterases that may remove acetyl groups from various positions of the trichothecene skeleton are known (23). Kimura et al. (14) reported that there was no conversion to an acetylated product when T-2 toxin was added to F. sporotrichioides cultures, although crude extracts of recombinant TRI101 from Escherichia coli and from F. graminearum cultures both could convert T-2 toxin to 3-acetyl T-2 toxin. They interpreted this observation as evidence that TRI101 was not strongly induced by T-2 toxin. An alternate hypothesis is that competing esterases mask TRI101 expression by removing the C-3 acetyl group in the final steps in T-2 toxin biosynthesis. This hypothesis is supported by our results with several trichothecenes containing a C-3 acetyl group. When these compounds were added to cultures of the disruptant strain FsTri101-3D, deacetylation did not appear to be blocked and deacetylated products were recovered.
The presence of a 3-hydroxyl group differentiates Fusarium trichothecenes from most other fungal trichothecenes. Even though the early enzymes and regulatory mechanisms for the biosynthesis of macrocyclic trichothecenes in Myrothecium roridum are related to their counterparts in Fusarium trichothecene pathways (31), macrocyclic trichothecenes do not contain a 3-hydroxyl group. Therefore, identification of isotrichodermol as the primary TRI101 substrate makes this enzyme essential for biosynthesis of the most toxic Fusarium trichothecenes. TRI101 therefore appears to be a critical and unique enzyme in the Fusarium trichothecene biosynthetic pathway.
| |
ACKNOWLEDGMENTS |
|---|
We thank Kim MacDonald and Marcie Moore for technical assistance and Benoit St.-Pierre and Vince DeLuca for helpful discussions.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: USDA/ARS/NCAUR, 1815 N. University, Peoria, IL 61604. Phone: (309) 681-6381. Fax: (309) 681-6627. E-mail: mccormsp{at}mail.ncaur.usda.gov.
Present address: Novartis Agribusiness Biotechnology Research,
Inc., Research Triangle Park, NC 27709.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Alexander, N. J.,
T. M. Hohn, and S. P. McCormick.
1998.
The TRI11 gene of Fusarium sporotrichioides encodes a cytochrome P-450 monooxygenase required for C-15 hydroxylation in trichothecene biosynthesis.
Appl. Environ. Microbiol.
64:221-225 |
| 2. | Alexander, N. J., S. P. McCormick, and T. M. Hohn. 1999. TRI12, a trichothecene efflux pump from Fusarium sporotrichioides: gene isolation and expression in yeast. Mol. Gen. Genet. 261:977-984[Medline]. |
| 3. | Cundliffe, E. 1989. How antibiotic-producing organisms avoid suicide. Annu. Rev. Microbiol. 43:207-233[Medline]. |
| 4. | Desjardins, A. E., and T. M. Hohn. 1997. Mycotoxins in plant pathogenesis. Mol. Plant-Microbe Interact. 10:147-152. |
| 5. |
Desjardins, A. E.,
T. M. Hohn, and S. P. McCormick.
1993.
Trichothecene biosynthesis in Fusarium species: chemistry, genetics, and significance.
Microbiol. Rev.
57:595-604 |
| 6. | Desjardins, A. E., R. H. Proctor, G. Bai, S. P. McCormick, G. Shaner, G. Buechley, and T. M. Hohn. 1996. Reduced virulence of trichothecene-nonproducing mutants of Gibberella zeae in wheat field tests. Mol. Plant-Microbe Interact. 9:775-781. |
| 7. |
Gietz, R. D.,
A. St. Jean,
R. A. Woods, and R. H. Schiestl.
1992.
Improved method for high efficiency transformation of intact yeast cells.
Nucleic Acids Res.
20:1425 |
| 8. | Goyon, C., G. Faugeron, and J.-L. Rossignol. 1988. Molecular cloning and characteristics of the met2 gene from Ascobolus immersus. Gene 63:297-308[Medline]. |
| 9. | Hohn, T. M., A. E. Desjardins, and S. P. McCormick. 1995. The Tri4 of Fusarium sporotrichioides encodes a cytochrome P450 monooxygenase involved in trichothecene biosynthesis. Mol. Gen. Genet. 248:95-102[Medline]. |
| 10. | Hohn, T. M., R. Krishna, and R. H. Proctor. 1999. Characterization of a transcriptional activator controlling trichothecene toxin biosynthesis. Fungal Genet. Biol. 26:224-235[Medline]. |
| 11. | Hohn, T. M., S. P. McCormick, N. J. Alexander, A. E. Desjardins, and R. H. Proctor. 1998. Function and biosynthesis of trichothecenes produced by Fusarium species, p. 17-24. In K. Kohmoto, and O. C. Yoder (ed.), Molecular genetics of host-specific toxins in plant disease. Kluwer Academic Publishers, Dordrecht, The Netherlands |
| 12. | Hohn, T. M., S. P. McCormick, and A. E. Desjardins. 1993. Evidence for a gene cluster involving trichothecene pathway biosynthetic genes in Fusarium sporotrichioides. Curr. Genet. 24:291-295[Medline]. |
| 13. |
Kimura, M.,
I. Kaneko,
M. Komiyama,
A. Takatsuki,
H. Koshino,
K. Yoneyama, and I. Yamaguchi.
1998.
Trichothecene 3-O-acetyltransferase protects both the producing organism and transformed yeast from related mycotoxins. Cloning and characterization of Tri101.
J. Biol. Chem.
273:1654-1661 |
| 14. | Kimura, M., G. Matsumoto, Y. Shingu, K. Yoneyama, and I. Yamaguchi. 1998. The mystery of the trichothecene 3-O-acetyltransferase gene. Analysis of the region around Tri101 and characterization of its homologue from Fusarium sporotrichioides. FEBS Lett. 435:163-168[Medline]. |
| 15. | Kimura, M., Y. Shingu, K. Yoneyama, and I. Yamaguchi. 1998. Features of Tri101, the trichothecene 3-O-acetyltransferase gene, related to the self-defense mechanism in Fusarium graminearum. Biosci. Biotechnol. Biochem. 62:1033-1036[Medline]. |
| 16. | Langin, T., G. Faugeron, C. Goyon, A. Nicolas, and J.-L. Rossignol. 1986. The MET2 gene of Saccharomyces cerevisiae: molecular cloning and nucleotide sequence. Gene 49:283-293[Medline]. |
| 17. | Mathison, L., C. Soliday, T. Stephan, T. Aldrich, and J. Rambosek. 1993. Cloning, characterization, and use in strain improvement of the Cephalosporium acremonium gene cefG encoding acetyl transferase. Curr. Genet. 23:33-41[Medline]. |
| 18. | McCormick, S. P., and T. M. Hohn. 1997. Accumulation of trichothecenes in liquid cultures of a Fusarium sporotrichioides mutant lacking a functional trichothecene C-15 hydroxylase. Appl. Environ. Microbiol. 63:1685-1688[Abstract]. |
| 19. | McCormick, S. P., T. M. Hohn, and A. E. Desjardins. 1996. Isolation and characterization of Tri3, a gene encoding 15-O-acetyltransferase from Fusarium sporotrichioides. Appl. Environ. Microbiol. 62:353-359[Abstract]. |
| 20. |
McCormick, S. P.,
S. L. Taylor,
R. D. Plattner, and M. N. Beremand.
1990.
Bioconversion of possible T-2 toxin precursors by a mutant strain of Fusarium sporotrichioides NRRL 3299.
Appl. Environ. Microbiol.
56:702-706 |
| 21. | McLaughlin, C. S., M. H. Vaughn, J. M. Campbell, C. M. Wei, and M. E. Stafford. 1977. Inhibition of protein synthesis by trichothecenes, p. 263-273. In J. V. Rodricks, C. W. Hesseltine, and M. A. Mehlman (ed.), Mycotoxins in human and animal health. Pathotoxin Publishers, Park Forest, Ill |
| 22. | Meyers, S., W. Schaur, E. Balzi, M. Wagner, A. Goffeau, and J. Golin. 1992. Interaction of the pleiotropic drug resistance genes PDR1 and PDR5. Curr. Genet. 21:431-436[Medline]. |
| 23. | Park, J. J., and F. S. Chu. 1996. Immunochemical studies of an esterase from Fusarium sporotrichioides. Food Agric. Immunol. 8:41-49. |
| 24. | Proctor, R. H., T. M. Hohn, and S. P. McCormick. 1995. Reduced virulence of Gibberella zeae caused by disruption of a trichothecene toxin biosynthetic gene. Mol. Plant-Microbe Interact. 8:593-601[Medline]. |
| 25. | Proctor, R. H., T. M. Hohn, S. P. McCormick, and A. E. Desjardins. 1995. Tri6 encodes an unusual zinc finger protein involved in regulation of trichothecene biosynthesis in Fusarium sporotrichioides. Appl. Environ. Microbiol. 61:1923-1930[Abstract]. |
| 26. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y |
| 27. | Shiestl, R. H., and R. D. Geitz. 1989. High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr. Genet. 16:339-346[Medline]. |
| 28. | Shima, J., S. Takase, U. Takahashi, Y. Iwai, H. Fujimoto, M. Yamazaki, and K. Ochi. 1997. Novel detoxification of the trichothecene mycotoxin deoxynivalenol by a soil bacterium isolated by enrichment culture. Appl. Environ. Microbiol. 63:3825-3830[Abstract]. |
| 29. | Stevens, R. R. 1974. Mycology guidebook, p. 703. University of Washington Press, Seattle |
| 30. | St. Pierre, B., P. Laflamme, A.-M. Alarco, and V. DeLuca. 1998. The terminal O-acetyltransferase involved in vindoline biosynthesis defines a new class of proteins responsible for coenzyme A-dependent acyl transfer. Plant J. 14:703-713[Medline]. |
| 31. | Trapp, S. C., T. M. Hohn, S. P. McCormick, and B. B. Jarvis. 1998. Characterization of the gene cluster for biosynthesis of macrocyclic trichothecenes in Myrothecium roridum. Mol. Gen. Genet. 257:421-432[Medline]. |
| 32. |
Turgeon, B. G.,
R. C. Garber, and O. C. Yoder.
1987.
Development of a fungal transformation system based on selection of sequences with promoter activity.
Mol. Cell. Biol.
7:3297-3305 |
| 33. | Ueno, Y., M. Sawano, and K. Ishii. 1975. Production of trichothecene mycotoxins by Fusarium species in shake culture. Appl. Microbiol. 30:4-9[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | Microbiol. Mol. Biol. Rev. | Eukaryot. Cell | All ASM Journals |
|---|