Previous Article | Next Article ![]()
Applied and Environmental Microbiology, December 1999, p. 5619-5623, Vol. 65, No. 12
Institute of Biotechnology, Swiss Federal
Institute of Technology Zurich, 8093 Zurich,
Switzerland,1 and Centro Nacional de
Biotecnologia, Campus de Cantoblanco, 28049 Madrid,
Spain2
Received 19 July 1999/Accepted 29 September 1999
Recombinant strains of Pseudomonas putida KT2440
carrying genetic expression cassettes with xylene oxygenase- and
styrene monooxygenase-encoding genes on their chromosomes could be
induced in shaking-flask experiments to specific activities that
rivaled those of multicopy-plasmid-based Escherichia coli
recombinants. Such strains maintained the introduced styrene oxidation
activity in continuous two-liquid-phase cultures for at least 100 generations, although at a lower level than in the shaking-flask
experiments. The data suggest that placement of target genes on the
chromosome might be a suitable route for the construction of
segregationally stable and highly active whole-cell biocatalysts.
Biotransformations provide access to
asymmetric oxidations which are difficult to achieve by purely chemical
methods (1, 35). The required reduced cofactors can best be
generated in whole-cell biocatalysts, and we have described
Escherichia coli recombinants that synthesize
Pseudomonas monooxygenases for the production of
(S)-styrene oxide, a potentially important chiral building
block in organic synthesis, from styrene in two-liquid-phase fed-batch
processes (23, 26, 41). The corresponding genes were
expressed via pBR322-derived multicopy plasmid vectors based on the
alk regulatory system of Pseudomonas oleovorans
(23, 26), where the positive regulator protein AlkS
activates transcription from the cognate promoter alkBp
(Fig. 1A) (39). A continuous production process would eliminate periods of low productivity and
prevent the drop in the number of viable cells (and consequently a drop
in volumetric productivities) when a two-liquid-phase culture enters
stationary phase (9, 10). Continuous cultures frequently suffer from limited genetic stability of highly active biocatalysts (10, 11, 13, 19, 43). Plasmid-located recombinant genes in
growing cells can be subject to structural or segregational instability. A number of possible solutions for segregational instability have been proposed (2, 12, 17, 21, 27). One way
to eliminate the possibility of segregational instability completely
might be to place the recombinant genes on the chromosome of a suitable
host strain, for example via mini-Tn5 transposons (16). As the transposase is lost during transposition with
this system, the recombinant gene remains stably integrated, which has
made this system a very attractive model system for engineering microorganisms for environmental, medical, and metabolic engineering applications (4, 8, 20, 28, 30, 36-38). Furthermore, tools
to efficiently remove (antibiotic) selection markers (18), thereby facilitating commercial utilization of the resulting strain and
biomass disposal, are available. Since such recombinants carry only one
to a few gene copies (14), it remains to be shown whether such strains
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Engineering of a Stable Whole-Cell Biocatalyst
Capable of (S)-Styrene Oxide Formation for Continuous
Two-Liquid-Phase Applications
![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References
lacking the opportunity to capitalize on gene dosage effects
produce sufficient activities for practical application as
biocatalysts in the production of fine chemicals. In this report, we
investigated whether placing genetic cassettes that contain the
elements of the alk regulatory system together with
monooxygenase genes onto the chromosome of E. coli JM101 or
P. putida KT2440 led to stable whole-cell biocatalysts with
high specific activities.

View larger version (23K):
[in a new window]
FIG. 1.
Function of the alk regulatory system and
structure of the genetic elements used in this study. (A) The regulator
protein AlkS is activated by interaction with DCPK or
n-octane and initiates transcription from alkBp.
(B) NotI fragments of plasmids pSPZ2MA, pSPZ2AB, and pSPZ2E
for the synthesis of xylene oxygenase, styrene monooxygenase, and
catechol-2,3-dioxygenase, respectively. The drawing is to scale.
Asterisks indicate that the wild-type gene has been engineered to
eliminate internal NdeI sites. Arrows indicate heterologous
promoters, and triangles within boxes indicate homologous promoters.
T4t, phage T4 transcriptional terminator. (C) Plasmids that
received the NotI cassettes shown in panel B. The drawing in
the upper part is to the same scale as in panel B. The open arrow
indicates the direction of transcription of the promoterless
xylE gene. The two cassettes shown are inserted in the
SfiI site of the basic vector and give rise to the two
mini-transposon delivery plasmids pJMS11 and pUT-Km. The grey boxes
represent the two res sequences that are the substrate of
the RP4 resolvase. The mini-transposon is defined by the I and O ends
(black boxes).
Analysis of E. coli mini-Tn5 mutants.
The 6.4-kb NotI fragment of pSPZ2MA containing alkS*
alkBp-xylM*A (the asterisks indicate genes where internal
NdeI sites have been removed) (Fig. 1B) (26) was
transferred to the mini-Tn5 delivery plasmid pJMS11 (Fig.
1C) (24), and the resulting mini-transposon was delivered to
E. coli JM101 cells (31) by a triparental mating with E. coli HB101(RK600) as the helper as described
previously (18). We could readily isolate strains that were
resistant to kanamycin but sensitive to ampicillin, indicating true
transposition events (7). The transconjugants were grown in
100 ml of M9* mineral medium supplemented with 100 µl of US* trace
element solution, 100 µl of a 1% (wt/vol) thiamine hydrochloride
solution, and 0.5% (wt/vol) glucose as the carbon source as described
previously (26). The cultures were induced at an optical
density at 450 nm of around 0.4 by the addition of 0.05% (vol/vol)
dicyclopropylketone (DCPK; Aldrich, Buchs, Switzerland) and at regular
intervals subjected to a whole-cell styrene oxide formation assay as
described previously (25). However, we failed to detect any
styrene oxide formation activity with these strains in our assay
(detection limit, 0.1 U · g of cells [dry
weight]
1, 1 U being defined as the enzymatic activity
that forms 1 µmol of styrene oxide in 1 min. Previous attempts to
produce xylene oxygenase in E. coli JM101 from the
pBR322-derived expression plasmid pSPZ3 had resulted in maximum
specific activities of 91 U · g of cells (dry
weight)
1 (26), suggesting that the
>900-fold-reduced level of specific activity in the present experiment
might be
at least in part
a function of the vastly lower gene dosage
in the E. coli transconjugant.
Efficient alk-based expression of oxygenases in
E. coli depends on copy number.
To investigate the
reduced level of activity, we constructed a 5.1-kb genetic cassette
that was identical to the one described above but that carried
xylE* instead of xylM*A (Fig. 1B), so that transconjugant strains would produce catechol-2,3-dioxygenase, which is
easy to assay in vitro even in small amounts (22). To obtain
an xylE gene devoid of internal NdeI sites but
with an NdeI site on the start codon which was compatible
with sites in the alk-based expression plasmids
(26), we performed a first PCR with one primer that annealed
at the 5' end of the gene and introduced the NdeI site on
the start codon together with a new BamHI site further
upstream (5'
CATGAGGATCCAAGAGGTGACCATATGAACAAAGGTG 3', where the BamHI site is underlined, the
NdeI site is in italics, and the xylE start codon
is in boldface type) and with a second primer that primed inside
xylE and thereby silently mutated the internal
NdeI site (5' GGCACAGCCATACGCCATCAGATC
3', where the mutagenic nucleotide is underlined). The resulting
300-bp fragment served as the first primer of a second PCR, which was
performed together with a primer that annealed at the end of the
xylE gene and introduced an EcoRI site (5'
AAAAAAGAATTCCCATCAGGTCAGCACGGTCATGAATCG 3', where the EcoRI site is underlined and the
xylE stop codon is in boldface type). The resulting 940-bp
fragment was digested with BamHI and EcoRI and
inserted into pSPZ1(+), reexcised as an NdeI/AscI
fragment, and inserted into pSPZ2Not along the lines outlined earlier
(26). In the resulting plasmid, pSPZ2E, the xylE*
gene was available as a NotI-flanked alkS*
alkBp-xylE* cassette analogous to the one carrying
xylM*A (Fig. 1B). This cassette was transferred to pUT-Km
(Fig. 1C) (6) for mini-transposon delivery and to pVLT31N
(Fig. 1C) for expression from a multicopy number plasmid. Plasmid
pVLT31N is a derivative of the broad-host-range vector pVLT31
(5), in which an additional NotI site was
introduced by digesting pVLT31 with HpaI and SmaI
and ligating the resulting fragment to an octameric DNA linker with the
NotI recognition sequence. This process also led to the loss
of the lacIq Ptac
expression system present on pVLT31. E. coli JM101 transconjugants carrying the xylE* mini-transposon on the
chromosome were readily isolated, grown in mineral medium with glucose
as the carbon source as described above, and harvested 4 h after induction. All strains tested produced catechol-2,3-dioxygenase to
levels measurable in cell extracts, up to a maximum of 0.9 U · mg of protein
1. E. coli JM101 transformants
carrying the xylE* cassette in multicopy numbers on pVLT31N
were grown in parallel in the presence of 12.5 µg of
tetracycline · ml
1 and produced after induction of
catechol-2,3-dioxygenase activity to 72 U · mg of
protein
1 in cell extracts. This result suggested that in
E. coli the specific activities of recombinant strains
carrying our genetic cassettes were indeed a function of gene dosage,
although the ratio of in vitro activities found for the
catechol-2,3-dioxygenase was on the order of 80, which does not fully
explain our inability to obtain E. coli transconjugants with
xylene oxygenase activity. Interestingly, the ratio of activities is
around four times the estimated ratio of gene copy numbers;
RSF1010-based plasmids are usually present in a copy number of 20 (15), whereas mini-transposons are likely to insert only
once into the chromosome (14).
Analysis of P. putida mini-Tn5
mutants.
In wild-type P. oleovorans GPo1, the
alk regulatory system is located on the low-copy-number
catabolic OCT plasmid and membrane-located AlkB protein is still
synthesized to 2% of total cell protein after induction
(34). This result raised the possibility that in
Pseudomonas strains alk-based monocopy constructs
give significantly more active strains. We used the NotI
cassettes of pSPZ2MA and pSPZ2AB (a 6.1-kb cassette carrying the genes
of the styrene monooxygenase of Pseudomonas sp. strain
VLB120 [Fig. 1B]) (23) on pJMS11 to construct P. putida KT2440 transconjugants. On pJMS11, the selection markers of
the mini-transposons are flanked by res sites that are the
substrate of the RP4 resolvase. After successful construction and
analysis of the biocatalyst (see Fig. 3A), they can be easily excised
by expressing the resolvase gene from a suicide plasmid (18). The transconjugants were used in shaking-flask
experiments as described above but with 0.5% (wt/vol) citrate as the
carbon source. P. putida SMA, a P. putida KT2440
derivative with alkS* alkBp-xylM*A in the chromosome,
synthesized xylene oxygenase to levels of 41 U · g of cells (dry
weight)
1 (Fig. 2B).
P. putida SAB, with alkS* alkBp-styAB in the
chromosome, synthesized styrene monooxygenase to specific activities of
86 U · g of cells (dry weight)
1 (Fig. 2C), which
was even more than the 70 U · g of cells (dry weight)
1 found for E. coli JM101 recombinants
expressing the styrene monooxygenase genes from the same cassette on
the multicopy plasmid pSPZ10 (23). The same activities were
also achieved with the strains P. putida SMA
and P. putida SAB
, which differed from their parent strains only in
that they had the transposon selection markers (the kanamycin resistance gene and the xylE gene) removed by expressing the
RP4 resolvase gene from a suicide plasmid as described previously (reference 18 and data not shown). To investigate
whether these numbers could be increased by increasing the copy number
of the genetic cassettes, analogous to the situation in E. coli, we inserted the NotI cassettes with the genes for
styrene monooxygenase and xylene oxygenase into pVLT31N. The resulting
plasmids were conjugated into P. putida SMA and P. putida SAB with E. coli S17-1
pir as the host
(33), after control experiments with the plasmids in unmodified P. putida KT2440 had shown that both plasmids
were functional (data not shown). Generally, the maximum specific
activities of the resulting strains were not higher (Fig. 2B and C).
These results were in agreement with data reported by Yuste et al., who
obtained similar results with an alkBp-lacZ fusion
(42). Remarkably, although the specific activities did not
change significantly upon provision of the cassettes in multiple
copies, the growth behavior of the strains did: strains carrying the
cassettes in multiple copies grew more slowly, while the strains
carrying only the chromosomal copy showed that induction had only a
little influence on growth (Fig. 2). Although this leaves unresolved
the issue of the maximum achievable rate of styrene oxide formation in
Pseudomonas and the nature of the bottleneck in the
development of specific activity, the results indicate that by choosing
a host different from E. coli, it is indeed possible with an
alk-based regulatory system to construct a whole-cell
biocatalyst that carries only one copy of the target genes and can
still synthesize the encoded enzyme to a high specific activity. The
results do not indicate whether the higher activities are due to an
increased specific activities of the Pseudomonas-derived
monooxygenases in a recombinant Pseudomonas host or due to
an increased amount of formed protein, for example, because
transcription from the alkBp promoter is more efficient in a
P. putida than in an E. coli host.
|
Continuous two-liquid-phase cultivation with P. putida
SMA.
To obtain a first indication of whether the potential for
activity and stability could be realized with our transconjugants, we
performed a continuous two-liquid-phase culture with P. putida SMA (Fig. 3B). We preferred
to use this strain for the experiment at this stage over P. putida SMA
as it still allowed rapid identification of cells
deriving from the inoculum due to the presence of the two selection
markers. The details of the reactor system have been described
previously (26). In short, a 3-liter stirred tank reactor
with the temperature (30°C), pH (7.1, titration with 30% phosphoric
acid and 4 M sodium hydroxide), and stirring speed (1,500 rounds per
min) regulated and the airflow manually adjusted to 1 liter per min was
placed on a balance (Bioengineering, Wald, Switzerland) which regulated
an effluent pump that was activated above a predefined weight of the
reactor. This pump then removed liquid from the reactor at around
10-fold the rate of the medium feed, leading to an oscillation in
weight (and consequently of the dilution rate) of around 40 g
(4%). A stationary-phase P. putida SMA preculture in 100 ml
of M9* mineral medium supplemented with US* trace elements and 0.5%
(wt/vol) citrate was pumped into the reactor, which contained 900 ml of
M9* mineral medium with 2 ml of US* solution per liter and 0.5%
citrate. The working volume was fixed to 1 liter, and mineral medium of
identical composition was fed into the reactor at a dilution rate of
0.2 h
1. After 50 h, we started an organic feed that
pumped an organic phase consisting of 1% (vol/vol of organic phase)
n-octane (Acros, Geel, Belgium) as the inducer of the
alk regulatory system and 1% (vol/vol of organic phase)
styrene (99%; Fluka, Buchs, Switzerland) as the substrate for the
xylene oxygenase dissolved in AL240 (Chemische Fabrik Schweizerhall,
Schweizerhall, Switzerland) as the carrier solvent at a dilution rate
of 0.02 h
1. AL240 is a mixture of iso-, cyclo-, and
linear alkanes with a chain length of at least 13 carbon atoms and has
no effect on bacterial growth (32). The aqueous feed was
reduced to 0.18 h
1, and the weight limits for the
effluent pump where adjusted accordingly. This led after equilibration
to a volume portion of the organic phase of 10%. Analysis of the
liquid phases in the reactor has been described previously
(26). In the presence of the organic phase, the dry weight
of cells stabilized at around 1.2 g per liter of aqueous phase,
and styrene oxide accumulated in the organic phase to around 16 mM,
which translated into a styrene oxide formation rate of 6 U per liter
(liquid volume) or 5 U · g of cells (dry weight)
1
(Fig. 3). The activity was maintained until the end of the experiment 100 generations (350 h) after induction. However, this number was
significantly smaller than the values obtained in the shaking-flask experiments or than the ca. 30 U · g of cells (dry
weight)
1 that has been obtained with a pBR322-derived
expression system in E. coli recombinants in
two-liquid-phase fed-batch experiments (26). To investigate
whether the smaller specific activities in the continuous culture were
obtained with cells that had lost the ability to synthesize xylene
monooxygenase to the high levels observed in the shaking-flask
experiments, we removed aqueous phase from the reactor at three time
points (50, 136, and 325 h after induction) and plated it on
Luria-Bertani agar plates. Sets of five of the resulting colonies
served as the starting cultures of new shaking-flask cultures in
mineral medium with citrate as the carbon source as described above. In
all three cases, the accumulated averaged specific activities 4 h
after induction were within 10% of that of the original strain
(results not shown), indicating that the relatively low activities were not due to genetic instability.
|
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Institut für Biotechnologie, ETH Zürich, Hönggerberg HPT, CH-8093 Zürich, Switzerland. Phone: 41-1-633 32 86. Fax: 41-1-633 10 51. E-mail: bw{at}biotech.biol.ethz.ch.
Present address: DSM Biotech GmbH, Jülich, Germany.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Besse, P., and H. Veschambre. 1994. Chemical and biological synthesis of chiral epoxides. Tetrahedron 50:8885-8927. |
| 2. | Cheng, C., Y. L. Huang, and S.-T. Yang. 1997. A novel feeding strategy for enhanced plasmid stability and protein production in recombinant yeast fedbatch fermentation. Biotechnol. Bioeng. 56:23-31. |
| 3. | de Bont, J. A. M. 1998. Solvent-tolerant bacteria in biocatalysis. Trends Biotechnol. 16:493-499. |
| 4. | de Lorenzo, V. 1994. Designing microbial systems for gene expression in the field. Trends Biotechnol. 12:365-371[Medline]. |
| 5. | de Lorenzo, V., L. Eltis, B. Kessler, and K. N. Timmis. 1993. Analysis of Pseudomonas gene products using lacIq/Ptrp-lac plasmids and transposons that confer conditional phenotypes. Gene 123:17-24[Medline]. |
| 6. |
de Lorenzo, V.,
M. Herrero,
U. Jakubzik, and K. N. Timmis.
1990.
Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in gram-negative eubacteria.
J. Bacteriol.
172:6568-6572 |
| 7. | de Lorenzo, V., and K. N. Timmis. 1994. Analysis and construction of stable phenotypes in Gram-negative bacteria with Tn5- and Tn10-derived minitransposons. Methods Enzymol. 235:386-405[Medline]. |
| 8. | Erb, R. W., C. A. Eichner, I. Wagner-Döbler, and K. N. Timmis. 1997. Bioprotection of microbial communities from toxic phenol mixtures by a genetically designed pseudomonad. Nat. Biotechnol. 15:378-382[Medline]. |
| 9. | Favre-Bulle, O., T. Schouten, J. Kingma, and B. Witholt. 1991. Bioconversion of n-octane to octanoic acid by a recombinant Escherichia coli cultured in a two-liquid phase bioreactor. Bio/Technology 9:367-371[Medline]. |
| 10. | Favre-Bulle, O., E. Weenink, T. Vos, H. Preusting, and B. Witholt. 1993. Continuous bioconversion of n-octane to octanoic acid by recombinant Escherichia coli (alk+) growing in a two-liquid-phase chemostat. Biotechnol. Bioeng. 41:263-272. |
| 11. | Friehs, K., and K. F. Reardon. 1993. Parameters influencing the productivity of recombinant E. coli cultivations. Adv. Biochem. Eng. 48:53-77. |
| 12. | Gerdes, K. 1988. The parB (hok/sok) locus of plasmid R1: a general purpose plasmid stabilization system. Bio/Technology 6:1402-1405. |
| 13. | Glick, B. R., and G. K. Whitney. 1987. Factors affecting the expression of foreign proteins in Escherichia coli. J. Ind. Microbiol. 1:277-282. |
| 14. | Hansen, L. H., S. J. Sørensen, and L. B. Jensen. 1997. Chromosomal insertion of the entire Escherichia coli lactose operon, into two strains of Pseudomonas, using a modified mini-Tn5 delivery system. Gene 186:167-173[Medline]. |
| 15. | Hashimoto-Gotoh, T., F. C. H. Franklin, A. Nordheim, and K. N. Timmis. 1981. Specific-purpose plasmid cloning vectors. I. Low copy number, temperature sensitive, mobilization-defective pSC101-derived containment vectors. Gene 16:227-235[Medline]. |
| 16. |
Herrero, M.,
V. de Lorenzo, and K. N. Timmis.
1990.
Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable chromosomal insertion of foreign genes in gram-negative bacteria.
J. Bacteriol.
172:6557-6567 |
| 17. | Kidwell, J., D. Kolibachuk, and D. Dennis. 1996. High-level expression of lacZ under control of the tac or trp promoter using runaway replication vectors in Escherichia coli. Biotechnol. Bioeng. 50:108-114. |
| 18. |
Kristensen, C. S.,
L. Eberl,
J. M. Sánchez-Romero,
M. Givskov,
S. Molin, and V. de Lorenzo.
1995.
Site-specific deletions of chromosomally located DNA segments with the multimer resolution system of broad-host-range plasmid RP4.
J. Bacteriol.
177:52-58 |
| 19. | Kumar, P. K. R., H.-E. Maschke, K. Friehs, and K. Schügerl. 1991. Strategies for improving plasmid stability in genetically modified bacteria in bioreactors. Trends Biotechnol. 9:279-284[Medline]. |
| 20. | Munthali, M. T., K. N. Timmis, and E. Díaz. 1996. Restricting the dispersal of recombinant DNA: design of a contained biological catalyst. Bio/Technology 14:189-191[Medline]. |
| 21. | Nakayama, K., S. M. Kelly, and R. Curtis. 1988. Construction of an asd+ expression cloning vector: stable maintenance and high level expression of cloned genes in a Salmonella vaccine strain. Bio/Technology 6:693-697. |
| 22. | Nozaki, M. 1970. Metapyrocatechase (Pseudomonas). Methods Enzymol. 17:522-525. |
| 23. | Panke, S., M. G. Wubbolts, A. Schmid, and B. Witholt. Production of enantiopure styrene oxide by recombinant Escherichia coli synthesizing a two-component styrene monooxygenase. Submitted for publication. |
| 24. |
Panke, S.,
J. M. Sánchez-Romero, and V. de Lorenzo.
1998.
Engineering quasi-natural Pseudomonas putida strains for metabolism of toluene through an ortho-cleavage degradation pathway.
Appl. Environ. Microbiol.
64:748-751 |
| 25. |
Panke, S.,
B. Witholt,
A. Schmid, and M. G. Wubbolts.
1998.
Towards a biocatalyst for (S)-styrene oxide production: characterization of the styrene degradation pathway of Pseudomonas sp. strain VLB120.
Appl. Environ. Microbiol.
64:2032-2043 |
| 26. |
Panke, S.,
B. Witholt, and M. G. Wubbolts.
1999.
An alkane-responsive expression system for the production of fine chemicals.
Appl. Environ. Microbiol.
65:2324-2332 |
| 27. | Porter, R. D., S. Black, S. Pannuri, and A. Carlson. 1990. Use of the Escherichia coli ssb gene to prevent bioreactor takeover by plasmidless cells. Bio/Technology 8:47-51[Medline]. |
| 28. |
Prieto, M. A.,
M. B. Kellerhals,
G. B. Bozzato,
D. Radnovic,
B. Witholt, and B. Kessler.
1999.
Engineering of stable recombinant bacteria for production of chiral medium-chain-length poly-3-hydroxyalkanoates.
Appl. Environ. Microbiol.
65:3265-3271 |
| 29. | Rajagopal, A. N. 1996. Growth of gram-negative bacteria in the presence of organic solvents. Enzyme Microb. Technol. 19:606-613. |
| 30. | Ronchell, M. C., C. Ramos, L. B. Jensen, S. Molin, and J. L. Ramos. 1995. Construction and behavior of biologically contained bacteria for environmental applications in bioremediation. Appl. Environ. Microbiol. 61:2990-2994[Abstract]. |
| 31. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y |
| 32. | Schmid, A., B. Sonnleitner, and B. Witholt. 1998. Medium chain length alkane solvent-cell transfer rates in two-liquid phase, Pseudomonas oleovorans cultures. Biotechnol. Bioeng. 60:10-23[Medline]. |
| 33. | Simon, R., U. Priefer, and A. Pühler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria. Bio/Technology 1:784-791. |
| 34. | Staijen, I. E., V. Hatzimanikatis, and B. Witholt. 1997. The AlkB monooxygenase of Pseudomonas oleovorans: synthesis, stability and level in recombinant Escherichia coli and the native host. Eur. J. Biochem. 244:462-470[Medline]. |
| 35. | Stephenson, G. R. 1996. Asymmetric oxidation, p. 367-391. In G. R. Stephenson (ed.), Advanced asymmetric synthesis. Chapman & Hall, London, United Kingdom |
| 36. | Suarez, A., A. Güttler, M. Strätz, L. H. Staendner, K. N. Timmis, and C. A. Gúzman. 1997. Green fluorescent protein-based reporter systems for genetic analysis of bacteria including monocopy applications. Gene 196:69-74[Medline]. |
| 37. | Suarez, A., L. H. Staendner, M. Rohde, G. Piatti, K. N. Timmis, and C. A. Guzman. 1997. Stable expression of pertussis toxin in Bordetella bronchiseptica under the control of a tightly regulated promoter. Appl. Environ. Microbiol. 63:122-127[Abstract]. |
| 38. | Tzachaschel, B. D., C. A. Gúzman, K. N. Timmis, and V. de Lorenzo. 1996. An Escherichia coli hemolysin transport-system based vector for the export of polypeptides: export of Shiga-like toxin IIeB subunit by Salmonella typhimurium aroA. Nat. Biotechnol. 14:765-769[Medline]. |
| 39. | van Beilen, J. B., M. G. Wubbolts, and B. Witholt. 1994. Genetics of alkane oxidation by Pseudomonas oleovorans. Biodegradation 5:161-174[Medline]. |
| 40. | Vermuë, M., J. Sikkema, A. Verheul, R. Bakker, and J. Tramper. 1993. Toxicity of homologous series of organic solvents for the Gram-positive bacteria Arthrobacter and Nocardia sp. and the gram-negative bacteria Acinetobacter and Pseudomonas sp. Enzyme Microb. Technol. 42:747-758. |
| 41. | Wubbolts, M. G., O. Favre-Bulle, and B. Witholt. 1996. Biosynthesis of synthons in two-liquid-phase media. Biotechnol. Bioeng. 52:301-308. |
| 42. |
Yuste, L.,
I. Canosa, and F. Rojo.
1998.
Carbon-source-dependent expression of the PalkB promoter from the Pseudomonas oleovorans alkane degradation pathway.
J. Bacteriol.
180:5218-5226 |
| 43. | Zabriskie, D. W., and E. J. Arcuri. 1986. Factors influencing productivity of fermentations employing recombinant microorganisms. Enzyme Microb. Technol. 8:706-717. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»