Previous Article | Next Article 
Applied and Environmental Microbiology, February 1999, p. 591-598, Vol. 65, No. 2
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Molecular Analysis of Expression of the
Lantibiotic Pep5 Immunity Phenotype
Ulrike
Pag,
Christoph
Heidrich,
Gabriele
Bierbaum, and
Hans-Georg
Sahl*
Institut für Medizinische Mikrobiologie
und Immunologie der Universität Bonn, Bonn, Germany
Received 12 August 1998/Accepted 23 November 1998
 |
ABSTRACT |
The lantibiotic Pep5 is produced by Staphylococcus
epidermidis 5. Within its biosynthetic gene cluster, the immunity
gene pepI, providing producer self-protection, is localized
upstream of the structural gene pepA. Pep5 production and
the immunity phenotype have been found to be tightly coupled (M. Reis,
M. Eschbach-Bludau, M. I. Iglesias-Wind, T. Kupke, and H.-G. Sahl,
Appl. Environ. Microbiol. 60:2876-2883, 1994). To study this
phenomenon, we analyzed pepA and pepI
transcription and translation and constructed a number of strains
containing various fragments of the gene cluster and expressing
different levels of immunity. Complementation of a
pepA-expressing strain with pepI in
trans did not result in phenotypic immunity or production
of PepI. On the other hand, neither pepA nor its product
was found to be involved in immunity, since suppression of the
translation of the pepA mRNA by mutation of the ATG start
codon did not reduce the level of immunity. Moreover, homologous
and heterologous expression of pepI from a xylose-inducible promoter resulted in significant Pep5 insensitivity. Most important for
expression of the immunity phenotype was the stability of pepI transcripts, which in the wild-type strain, is
achieved by an inverted repeat with a free energy of
56.9 kJ/mol,
localized downstream of pepA. We performed site-directed
mutagenesis to study the functional role of PepI and constructed
F13D PepI, I17R PepI, and PepI 1-65; all mutants showed reduced levels
of immunity. Western blot analysis indicated that F13D PepI and PepI
1-65 were not produced correctly or were partially degraded, while I17R PepI apparently was less efficient in providing self-protection than
the wild-type PepI.
 |
INTRODUCTION |
Lantibiotics are antibiotic
peptides that contain the thioether amino acids lanthionine
and/or methyllanthionine (37). The tricyclic peptide Pep5
(38) is produced by Staphylococcus epidermidis 5 and is classified along with nisin (19), subtilin
(18), and epidermin (1) as a type A lantibiotic.
This group of peptides comprises screw-shaped, positively charged,
amphipathic molecules which exert their primary bactericidal action by
the formation of pores in the cytoplasmic membrane of sensitive
bacteria (36). Like all other known lantibiotics Pep5 is
ribosomally synthesized. The biosynthetic gene cluster is located on
the 20-kb plasmid pED503 (14, 22) and consists of the
structural gene pepA as well as the genes encoding proteins
required for posttranslational modification (pepB and
pepC), proteolytic processing (pepP), transport (pepT), and immunity (pepI) (28). The
Pep5 immunity gene pepI codes for a 69-amino acid
peptide, which is characterized by a hydrophobic N-terminal segment and
a strongly hydrophilic C-terminal part. PepI displays a high degree of
similarity (74.2%) to EciI, the epicidin 280 immunity peptide
(20), and confers cross-immunity to epicidin 280, suggesting
a similar molecular self-protection mechanism for both lantibiotics.
The nisin and subtilin immunity proteins NisI and SpaI consist of 245 and 165 amino acids, respectively, and have typical lipoprotein
consensus sequences (23, 26). However, NisI and SpaI share
no sequence homology and do not provide cross-immunity.
An important contribution to producer protection is apparently provided
by dedicated ATP-binding cassette transporter systems. Such
transporters have been identified in the nisin (43),
subtilin (23), epidermin (29), and lacticin 481 (34) gene clusters and typically consist of two or
three separate proteins, LanE, LanF, and/or LanG. NisFEG, SpaFG,
EpiFEG, and LctFEG are thought to be located in the membrane and to act
by exporting the lantibiotic out of the cytoplasmic membrane, thus
keeping the concentration below a critical level (29). In
contrast to these transporters, there are currently no theories that
address how the lipoproteins NisI and SpaI or the small immunity
peptides PepI and EciI could function at the molecular level to reduce
producer strain sensitivity to the respective lantibiotics. However,
PepI and EciI do not seem to be the only members of this unique class
of immunity peptides. Recently, in the gene clusters of the
structurally unrelated lantibiotic lactocin S (44) and the
nonlantibiotic divergicin A (48) two genes were discovered
which code for peptides of similar size, charge distribution, and
significant sequence similarity (20). Particularly the
presence of a related gene in a nonlantibiotic gene cluster suggests
that such an immunity mechanism could be of general importance for
bacteriocins of gram-positive bacteria.
Here, we report the molecular characterization of the Pep5 immunity
system. One striking feature of the Pep5 system is the apparent
coupling of the immunity phenotype with the production of Pep5, which
led us to assume that pepA or its product, i.e., the
unmodified prepeptide or as reported for nisin (25, 26) the
mature lantibiotic, could be involved in the expression of this
phenotype (32). We now demonstrate that pepI is
sufficient for expression of Pep5 immunity. Coupling to Pep5
production is achieved at the transcriptional level through the
stabilization of pepI-containing transcripts by means of an
inverted repeat, which in the wild type, is located downstream of
pepA. The presence of the terminator element rather than its
position in the transcript was found to be important for mRNA
stabilization, allowing the construction of hyperimmune strains and
eventually hyperproducer strains for biotechnological purposes.
 |
MATERIALS AND METHODS |
Bacterial strains and plasmids.
The bacterial strains and
plasmids used are listed in Table 1. All
staphylococcal strains were maintained on blood agar or tryptone soy
agar supplemented with the appropriate antibiotic. Staphylococcus
carnosus TM300 (17) was used for heterologous expression, Escherichia coli BMH 71-18 (carrying
mutS) was used as the host for recombinant DNA. The vector
pALTER-1 (Altered Sites in vitro mutagenesis system; Promega, Madison,
Wis.) was used for site-directed mutagenesis. The E. coli-Staphylococcus shuttle vector pCU1 and the staphylococcal
expression vector pCX15 were kindly provided by R. Rosenstein and F. Götz, Tübingen, Germany.
DNA cloning and sequencing.
Staphylococcal plasmid DNA was
isolated by the method of Feliciello and Chinali (15). Lysis
of staphylococci was achieved by adding 200 µg of lysostaphin per ml
to solution I (50 mM glucose, 10 mM Tris-HCl [pH 8.0], 1 mM EDTA) and
incubating the cells for 30 to 60 min at 37°C. Plasmid DNA of
E. coli was purified with QIAprepspin columns (Qiagen,
Hilden, Germany). E. coli and S. epidermidis 25 were transformed by electroporation (2), and S. carnosus protoplasts were transformed by the method of Götz and Schumacher (17). Double-stranded plasmid DNA was
sequenced on an A.L.F. DNA sequencer (Pharmacia, Uppsala, Sweden) by
the dideoxynucleotide chain termination method (40) with the
AutoRead sequencing kit (Pharmacia). Restriction enzymes and T4 DNA
ligase were supplied by Boehringer (Mannheim, Germany), and synthetic oligonucleotides were obtained from Eurogentec (Seraing, Belgium).
PCR amplification.
For PCR amplification of pepI,
pepA, and the terminator structure, we used pMR2 as a DNA
template, Pwo DNA polymerase (Boehringer) or Goldstar Red DNA
polymerase (Eurogentec), and the following primer pairs:
pepI-SalI 5'
[5'(CAATAATAAATGTCGACTTAGGCCATTTAATTTTTG)3'] and pepI-XbaI 3'
[5'(CATTTTCTAGAATTAATTATTTAAACATACAAAG)3'], pepI-XbaI 5'
[5'(ATTTTCTAGAAGGTATTAAAAAAATTTTAC)3']
and pepI-SalI 3'
[5'(TATAATGTCGACACAATATAGAAAAAAAC)3'],
pepA-EcoRI 5'
[5'(GTTTAAAGAATTCATTATAAAAAATGTATTG)3']
and pepA-XbaI 3'
[5'(GATTACTCTAGATTTTTTCTCCTGCATAC)3'],
and Term-XbaI 5'
[5'(CAGTGTCTAGAAAAGGAAAAAACGGATG)3']
and Term-EcoRI 3'
[5'(TATTTGAATTCCATGCCCAGTGTAATCAC)3']
for amplifying the terminator structure (bold letters indicate
deviations from the original sequence; the generated restriction sites
are underlined). The correct introduction of the mutations was verified
by sequencing the entire PCR product.
Site-directed mutagenesis.
Site-directed mutagenesis of PepI
and PepA was performed with a commercial phagemid system, as previously
described for Pep5 mutant peptides (5). The following
mutagenic oligonucleotides were employed (mismatches are underlined):
5'(CTTTATTTTTTGCTTTAAGAATTTTTATTGTAACTTAT)3' changes Ile17 of PepI into Arg,
5'(AAGAATAAATAGCAACTAAAAAGATAAACTTTAG)3' mutates
Lys65 into a stop codon, and
5'(GTAATTTTAACTTCTTTAGATTTTGCTTTAAGAATTTT)3' was
designed to change Phe13 into Asp. The oligonucleotide
5'(GAGGAGGTGGTTATATGGGAAAAATAACAAAAATT)3' exchanges the Met start codon of PepA for a Gly codon.
RNA isolation and Northern hybridization.
Total RNA was
prepared by using the RNeasy minikit (Qiagen) with the following
modifications for isolation of RNA from staphylococci. The wild-type
strain S. epidermidis 5 and mutants were grown in tryptic
soy broth (Oxoid, Wesel, Germany) to an absorbance at 600 (A600) nm of 1. Cultures (10 ml) were harvested
by centrifugation (5,000 × g for 5 min at 4°C). The
cells were resuspended in 600 µl of Tris-EDTA (pH 8.0) and, after
addition of 0.4 mg of lysostaphin per ml and 32 U of RNAguard
(Pharmacia), were incubated for 15 min at 37°C. After addition of 2.1 ml of lysis buffer RLT (Qiagen), the sample was mixed vigorously and
centrifuged (2 min at 8,000 × g) to remove unlysed
cells. The supernatant was mixed with 1.5 ml of ethanol (100%) and
applied onto a spin column in several centrifugation steps. The
following steps were performed according to the manufacturer's instructions.
Total RNA was denatured with glyoxal-dimethylsulfoxide (
27)
and separated on a 1.2% agarose gel with 10 mM sodium phosphate,
pH 7, as a running buffer. Vacuum blotting was performed with
a Vacu Gene XL
(Pharmacia) within 2.5 h and a suction of 65 cm
of
H
2O.
Expression of pepI from the xylose-inducible pCX15
vector.
For cloning in pCX15, pepI was amplified by PCR
with pMR2 as a template and the following primers:
pepI-BglII 5'
[5'(CTATAAGATCTTCTAAATATATTTAAAAAGGG)3'] and pepI-EcoRI 3'
[3'(CATTTTTTAGAATTCATTATTTAAACATACTAAAG)3'] (nucleotides in bold face are mutations introduced for the
generation of restriction sites, which are underlined). After
sequencing, the 0.284-kb BglII-EcoRI
pepI fragment was cloned in pCX15 that had been restricted
with BamHI and EcoRI.
Staphylococcal recombinant strains were grown in medium without glucose
(10 g of casein hydrolysate, 5 g of yeast extract,
5 g of
NaCl, and 1 g of K
2HPO
4 per liter; pH 7.3)
to an
A600 of
0.5 and induced with 0.5% xylose.
Cells were harvested by centrifugation
and disrupted by intervals of
boiling and ultrasonic treatment.
Intact cells were removed by
centrifugation at 13,500 ×
g for
20 min. The
supernatant was analyzed by sodium dodecyl sulfate
(SDS)-polyacrylamide
gel electrophoresis and immunoblotting with
anti-maltose-binding
protein (MBP)-PepI antiserum (
32).
Preparation of staphylococcal cell fractions.
The
preparation of membrane and soluble cytoplasmic fractions of S. epidermidis 5 and mutants was done by disruption of cells with
glass beads and differential centrifugation, as previously described
(32).
MIC determinations.
The determination of MICs was performed
in a microtiter plate assay with half-concentrated tryptone soy broth,
as described by Bierbaum et al. (5).
 |
RESULTS |
Transcriptional analysis of the Pep5 biosynthetic gene
cluster.
The production of Pep5 is encoded by the 20-kb plasmid
pED503 of the producer strain S. epidermidis 5 (14). The Pep5 biosynthetic gene cluster covers
approximately 7.9 kb and comprises pepTIAPBC. A putative
terminator (
56.9 kJ/mol) that may allow partial readthrough is
located in the short noncoding segment between pepA and
pepP (32). We identified five different mRNA
transcripts within the biosynthetic gene cluster (Fig.
1) by Northern blot analysis. A single
pepA mRNA of 0.3 kb was detected in large amounts. A pepT transcript of 0.9 kb and a transcript of 5.3 kb,
covering pepA and the downstream genes for proteolytical
processing and modification (pepP, pepB, and
pepC), were identified in low concentrations. Two further
transcripts hybridized with the pepI probe. One transcript (0.6 kb) contained the immunity gene pepI and the structural
gene pepA, and the other transcript (1.0 kb) additionally
covered a region upstream of pepI; a small transcript of
approximately 0.3 kb covering only pepI was not detectable.

View larger version (7K):
[in this window]
[in a new window]
|
FIG. 1.
Organization of the Pep5 gene cluster (A) and
transcription products (B). The arrows represent the direction of
transcription relative to the structural gene pepA. The
relative amounts of transcripts as judged from Northern blotting are
indicated by the thicknesses of the lines.
|
|
Is PepA involved in the expression of immunity?
Previous
studies had shown that S. epidermidis 25(pMR9), containing
only pepI of the Pep5 gene cluster, was sensitive to Pep5 to
the same extent as its parent strain, S. epidermidis 25, which had had the Pep5 production plasmid pED503 removed
(32). This was taken to indicate a role for pepA
or its product in the expression of the immunity phenotype. In order to
investigate whether both genes have to be transcribed in
cis, pepI was cut out of pMR9 and cloned
into the staphylococcal vector pT181mcs in S. carnosus TM300, generating pTMR9. We then transferred pTMR9 into S. epidermidis 25(pMR7), which harbors pepA in pCU1 and
accumulates unmodified Pep5 prepeptide but is fully sensitive to Pep5.
The resulting clone showed the same degree of sensitivity to Pep5 as
the plasmidless strain S. epidermidis 25 (MIC, 0.6 µg of
Pep5 per ml), demonstrating that immunity cannot be established by the
complementation of pepA with pepI in
trans.
S. epidermidis 25(pMR2) contained both
pepI
and
pepA in
cis and was as immune as
the wild-type
S. epidermidis 5 (
32) (Table
2). Similar to
S. epidermidis 25(pMR7), this strain produces
the inactive Pep5
prepeptide (Fig.
2). In order to
determine whether
the Pep5 prepeptide is necessary for the expression
of immunity
either in a regulating or direct function, the translation
of
pepA was suppressed by changing the Met start codon into
GGG (Gly).
Site-directed mutagenesis was performed on the 1.39-kb
KpnI fragment
isolated from pMR2 containing
pepI
and
pepA, and subsequently
this fragment was inserted into
pCU1 at the
KpnI site. The resulting
clone,
S. epidermidis 25(pAG5/1), did not produce the Pep5 prepeptide
(Fig.
2) but showed the same degree of insensitivity to Pep5 as
S. epidermidis 25(pMR2), demonstrating that the unmodified Pep5
prepeptide is not taking part in the expression of immunity.

View larger version (75K):
[in this window]
[in a new window]
|
FIG. 2.
Identification of Pep5 prepeptide by Western blot
analysis. Total cell extracts of the respective strains were separated
by SDS-polyacrylamide gel electrophoresis and immunoblotted with
anti-Pep5 leader peptide antiserum. SDS-stable Pep5 prepeptide dimers
and trimers (lanes 2 and 4) have been described previously
(39). Lanes: 1, molecular size marker (numbers to the left
of the gel indicate sizes in kilodaltons); 2, membrane fraction of
S. epidermidis 25(pMR7) used as the standard; 3, S. epidermidis 25(pAG5/1); 4, S. epidermidis 25(pMR7, pTMR9).
|
|
We amplified
pepI by PCR, introducing a
BglII
site and an
EcoRI site, and subsequently cloned the 284-bp
fragment into pCX15
at the
BamHI and
EcoRI
restriction sites. This placed the expression
of
pepI under
the transcriptional control of the
xylA promoter
and the
repressor XylR. The recombinant plasmid, pUP2, was then
transferred
into
S. carnosus and
S. epidermidis 25. After induction
with 0.5% xylose, PepI was detected by
immunoblotting with anti-MBP-PepI
antiserum in both strains (Fig.
3). PepI was visible 2 h after
induction, and the amount of PepI increased with further incubation.
In
the presence of xylose, the sensitivity of both cloning hosts
decreased
from 0.02 to 0.6 µg of Pep5 per ml for
S. carnosus
and
from 0.6 to 7 µg of Pep5 per ml for
S. epidermidis 25. Thus, the
producer self-protection against Pep5
appeared to solely depend
on the functional expression of PepI.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 3.
Detection of PepI in cell extracts of induced
S. carnosus and S. epidermidis cells by
Western blotting. Lanes: 1, molecular size marker (numbers to the left
of the gel indicate sizes in kilodaltons); 2, synthetic PepI (synthetic
PepI was found to form SDS-stable multimers); 3, noninduced
S. carnosus(pUP2); 4 and 5, induced S. carnosus(pUP2) (2 and 19 h after induction with 0.5% xylose,
respectively); 6, noninduced S. epidermidis
25(pUP2); 7 and 8, induced S. epidermidis
25(pUP2) (2 and 19 h after induction with 0.5% xylose,
respectively).
|
|
Role of the inverted repeat downstream of pepA.
To
identify the element that is essential for the self-protection
mechanism, in addition to the immunity gene pepI, we
constructed various gene arrangements (Fig.
4). First, the polarity of the structural
gene was reversed, in order to test whether pepI has to be transcribed together with pepA as one transcript
for the production of a functional mRNA. Both genes were amplified by PCR, introducing SalI-XbaI and
EcoRI-XbaI restriction sites, respectively, and
subsequently both PCR products were subcloned into pCU1 digested with
SalI-EcoRI. The resulting recombinant plasmid
pUP4 contained pepI and, on the complementary strand in a
head-to-tail arrangement, pepA (Fig. 4). This variant strain
was only slightly less insensitive to Pep5 than the wild-type strain.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
pepI-containing S. epidermidis 25 variants and their sensitivities to Pep5. The
arrangement of pepI and pepA and the locations of
the pepA terminator element in different S. epidermidis 25 strains are correlated with their respective
MICs.
|
|
A possible regulating element, which is present in
S. epidermidis 25(pUP4) and in
S. epidermidis
25(pMR2) but is missing in
the sensitive strain
S. epidermidis 25(pMR9), is the inverted
repeat downstream of
pepA (Fig.
5) which allows
partial readthrough.
Since such palindromic structures can
stabilize mRNAs by protecting
them from degradation by
ribonucleases, we amplified the region
downstream of
pepA,
including the terminator, by PCR. The resulting
XbaI-
EcoRI PCR fragment was cloned downstream of
the
SalI-
XbaI
pepI PCR product into
SalI-
EcoRI restricted pCU1. The resulting
plasmid, pUP6, was able to promote significant protection against
Pep5
(Table
2) to
S. epidermidis 25. The
pepI
mRNA seemed to
be stabilized by the terminator, facilitating the
translation
of the transcript into the immunity peptide. We performed
Northern
blot analysis (Fig.
6) to
confirm the mRNA-stabilizing function
of the terminator element. As
already mentioned two
pepI-containing
transcripts of 0.6 and
1.0 kb, respectively, were detected in
the wild-type producer
S. epidermidis 5 (Fig.
6B). In the immune
mutant
S. epidermidis 25(pMR2) only the 0.6-kb
pepI mRNA was produced,
because the respective DNA
region for transcription of the second
pepI mRNA is not
present in this clone. However, the 0.6-kb transcript
was produced in
larger amounts than the wild type, because the
cloning vector pCU1 has
a higher copy number than the wild-type
plasmid pED503, thus
compensating for the missing second
pepI transcript. The
same result was obtained with the mutant harboring
pAG5/1, which
differs from pMR2 only by a mutation of the
pepA start
codon. In the Pep5-sensitive strain
S. epidermidis
25(pMR9)
no stable
pepI transcript, which should have a
size of about 0.3
kb, could be detected. In contrast, a stable 0.3-kb
pepI mRNA
was detected in
S. epidermidis
25(pUP6), in which the terminator
was placed downstream of the
immunity gene, demonstrating the
importance of the terminator for the
stability of the
pepI mRNA.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 5.
Terminator element downstream of pepA. The
terminator downstream of pepA has a calculated free energy
of 56.9 kJ/mol.
|
|

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 6.
Northern blot analysis of pepI transcription.
(A) Lanes: 1, size standard (numbers to the left of the gels indicate
sizes in kilobases); 2, S. epidermidis 25(pUP4); 3, S. epidermidis 25(pUP6); 4, S. epidermidis 25(pUP7); 5, S. epidermidis
25(pAG5/1); 6, S. epidermidis 25(pGB8). A
pepI-specific probe was used for detection. In S. epidermidis 25(pUP7) the identical pattern was obtained with a
pepA-specific probe; additionally, a single pepA
transcript of 0.3 kb was detectable (data not shown). (B) Lanes: 1, size standard; 2, S. epidermidis 25; 3, S. epidermidis 5; 4, S. epidermidis 25(pCU1); 5, S. epidermidis 25(pMR2); 6, S. epidermidis 25(pMR9). A pepI-specific probe was
used for detection. (C) Northern blot analysis of the 1.1 kb
pepI transcript, with a probe that hybridizes with a region
upstream of pepI. Lanes: 1, size standard; 2, S. epidermidis 5; 3, S. epidermidis 25(pGB8).
|
|
We then changed the juxtaposition of
pepI and
pepA, placing the terminator upstream of
pepI.
PCR products of both genes were
ligated to linearized pCU1 in reversed
order relative to the wild
type (pUP7). MIC determination (Table
2)
revealed that the resulting
variant,
S. epidermidis
25(pUP7), was hyperimmune to Pep5 when
compared to the wild-type
producer strain. Also, in this clone
the
pepAI mRNA
signal was detected in significantly increased
amounts (Fig.
6A),
demonstrating the high stability of the transcript.
This result points
to a direct correlation of the amount of
pepI mRNA, the
concentration of PepI, and the level of immunity; this
interpretation is also supported by Northern blot analysis of
S. epidermidis 25(pGB8), which is as
hyperimmune as
S. epidermidis 25(pUP7) (Table
2).
This clone harbors
pepIAPBC and the 5' segment
of
pepT in pCU1. As in the wild-type strain
S. epidermidis 5,
two
pepI transcripts of 0.6 and 1.1 kb,
respectively, could be
detected in
S. epidermidis
25(pGB8); however, these transcripts
were produced in larger
amounts because the copy number of pCU1
was higher than that of the
wild-type plasmid pED503 (Fig.
6A
and
C).
Site-directed mutagenesis of PepI.
PepI is characterized by a
striking charge distribution. Whereas the N-terminal segment contains a
20-amino acid stretch of apolar residues, the C-terminal region is very
hydrophilic, with a net positive charge. These features are shared by
the recently discovered epidicin 280 immunity peptide, EciI, which
confers cross-immunity to Pep5 (20). Interestingly, the
degree of similarity between PepI and EciI is even higher in the
N-terminal region (80%), which was proposed to mediate interactions
with the cytoplasmic membrane (32). The exchange of Ile17,
which is conserved in both peptides, for Arg (pAG1/1) caused a
significant reduction in the level of immunity (Table 2). Nevertheless,
the mutant strain was less sensitive to Pep5 than the cloning host,
S. epidermidis 25. Western blot analysis of membrane
and soluble cell fractions (Fig. 7) did
not indicate that the decreased level of immunity was due to reduced
PepI production or to a reduced association of PepI with the membrane.
With both native PepI and I17R PepI, about one-third of the peptide was
detected in the soluble cytoplasmic fraction and two-thirds was
detected in the membrane fraction. An additional mutation, introduced
in the N-terminal region by exchanging the conserved Phe13 for Asp
(pAG4/1), resulted in partially improved immunity compared to that
caused by the single I17R mutation. By Western blot analysis the
shortened F13D-I17R PepI was detected, indicating a proteolytic
truncation of the peptide. We also introduced a stop codon at position
65 of PepI, thereby deleting the four terminal, charged amino acids,
three of which are not present in EciI. Again, the strain displayed a
significantly decreased level of immunity. The amount of PepI 1-65 was
reduced to a level below the detection limit in Western blots, although
S. epidermidis 25(pAG2/1) was less sensitive than
S. epidermidis 25.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 7.
Western blot analysis of PepI. Immunoblot analyses of
wild-type PepI (lanes 3 and 4), PepI 1-65 (lanes 5 and 6), F13D-I17R
PepI (lanes 7 and 8), and I17R PepI (lanes 9 and 10) in soluble and
membrane cytoplasmic fractions of cell extracts, respectively, are
shown. Standard peptides (sizes are indicated to the left of the gel in
kilodaltons) and synthetic PepI are shown in lanes 1 and 2, respectively.
|
|
 |
DISCUSSION |
An efficient self-protection system is vital for a
bacteriocin-producing bacterial strain. Channel-forming colicins (e.g., colicins A, E1, and B) produced by E. coli are known
to be specifically antagonized by stoichiometric complex
formation with immunity proteins residing in the cytoplasmic membrane
(16, 42, 45). The structural genes are located upstream of
the respective immunity genes, which are transcribed, however, in the
opposite direction (9, 31). In the lantibiotic gene
clusters, specific immunity peptides and/or ATP-binding cassette
transporter systems are encoded (23, 26, 29, 32, 34,
43). Regulation of immunity to nisin, subtilin, and epidermin is
mediated through the two-component regulators NisR-SpaR and
NisK-SpaK and the transcriptional activator EpiQ, respectively
(13, 23, 29). An intact nisin structural gene was found to
be necessary for the expression of full immunity (26), which
was later shown to be due to the fact that mature nisin activates
transcription of the biosynthetic gene cluster via NisR and NisK
(11, 25). Also, disruption of the spaA structural gene, which is the last gene in the spaBTCA operon, resulted
in subtilin-sensitive cells (23). Coordinate
expression of the structural and immunity genes had been established
for Pep5 as well (32) and is shown here to be achieved
through a specific stabilization of the mRNA transcripts. In the
presence of an inverted repeat, which in wild-type S. epidermidis 5 is localized downstream of the structural gene
pepA, pepI transcripts are stable and can be
translated into the immunity peptide.
mRNA stability plays an important role in regulation of bacterial
gene expression. While the majority of ribonucleases are involved in
the maturation of rRNA and tRNA, a few ribonucleases, acting either as
exonucleases or endonucleases, have been shown to be implicated in
mRNA decay. Processive degradation by the 3' exonucleases RNaseII
and polynucleotide phosphorylase is impaired by RNA secondary
structures (4, 30). Similarly, stable pepI transcripts could not be detected when the terminator was missing, while placing the terminator downstream of the immunity gene (pUP6 [Fig. 6]) led to the production of a stable pepI mRNA.
Another example was observed by Klug and Cohen (24),
who found two hairpins at the 3' terminus of the puf operon
of Rhodobacter capsulatus that function in both
transcription termination and stabilization of upstream puf
mRNA sequences. The transcriptional terminator of the crystal
protein gene (cry) from Bacillus thuringiensis versus Kurstaki HD-1 was shown to function as a positive
retroregulator in controlling gene expression in both
Bacillus subtilis and E. coli (47).
The replacement of the penP (penicillinase gene) terminator
with the cry terminator resulted in enhanced mRNA
stability. The stabilizing function of the retroregulator was observed
to be independent of its orientation of insertion with respect to the
target gene. This is also true for the pepA terminator,
since it was able to stabilize the pepI mRNA in spite of
a reversed orientation, as in the case of the mutant pUP4. However, the
pepA inverted repeat lost its function as a transcription
termination element. The terminator function is strongly dependent on a
stretch of at least four U at the 3' end (35), which after
the change of orientation of the pepA repeat, is placed at
the 5' end.
Cloning of the pepA terminator upstream of the immunity gene
(pUP7 [Fig. 6]) resulted in the appearance of a stable
pepAI mRNA and a small (0.3-kb) pepA
transcript (data not shown). Several structural elements, such as 5'
untranslated regions (7, 12) or polypurine sequences
(21), also function as mRNA stabilizers. These probably
act by blocking access of 5' binding endonucleases like RNase E to the
transcript, presumably by stalling ribosomes at the 5' end. In pUP7 an
equivalent structural element, which could explain the high stability
of the transcript comprising pepA and pepI in
this order, is not present at the 5' end of pepA. The
pepA terminator was placed upstream of pepI, but
since it was also localized upstream of the pepI promoter
sequences, it could not be included in a potential pepI
transcript; consequently a small transcript containing only
pepI was not detectable. The presence of a pepAI
mRNA in this construct also suggests that the progressive
degradation in the 5'-to-3' direction does not play a crucial role in
the decay of the pepI transcripts. These transcripts rather
seem to be degraded to a high extent by the endonucleolytic attack of
ribonucleases, which do not necessarily bind to the 5' end of a
transcript but are blocked by intercistronic secondary structures.
Additionally, 3'-to-5' exonucleases may be involved in degradation.
Intercistronic stem-loop structures in the puf operon were
also shown to be involved in stabilizing mRNA (10);
however, these loops influenced only upstream sequences and not, as in
the case of pepI, downstream sequences.
The identification of the stem-loop structure as a stabilizing element
and the apparent correlation between RNA stability, quantity of PepI
produced, and resulting levels of immunity have several interesting
implications for biotechnology and may provide clues to how PepI and
related immunity peptides work. The construction of hyperimmune strains
is a prerequisite for increasing the production rate of bacteriocins.
In this respect, placing bacteriocin structural gene expression under
the control of efficient promoters and increasing mRNA half-life,
by placing the hairpin in appropriate positions, are valuable tools for
increasing the amount of transcript for these genes. Moreover, such
stem loops, which are found in many gene clusters of unmodified and
modified bacteriocins, could be generally useful for enhancing protein
yields, e.g., in heterologous expression hosts such as the food-grade
S. carnosus bacteria used here.
The obvious correlation between the level of immunity and the amount of
PepI may indicate a direct interaction between Pep5 and PepI and
stoichiometric antagonization similar to the mechanism found for the
channel-forming colicins (16, 42, 45). In this case, the
colicins bind specifically to an immunity protein which is anchored
within the cytoplasmic membrane by means of four membrane-spanning
helices. The channel-forming domain interacts with an external loop of
the immunity protein which prevents this domain from folding into a
functional pore. It is tempting to assume by analogy that PepI, as well
as the related peptides encoded by eciI, orf57,
and dviA, could stoichiometrically antagonize Pep5 or the
respective peptide bacteriocins. The N-terminal stretch of hydrophobic
amino acids could provide the membrane anchor, while the C-terminal
segment of PepI could mediate the interaction with Pep5. However, our
mutagenesis results do not necessarily favor such a model. Although the
introduction of an Arg residue in the hydrophobic segment strongly
reduced the level of immunity, the distribution of the mutant peptide
between soluble fractions and membrane-associated fractions was not
changed; even the peptide containing a second charge in this segment
was still mostly associated with the membrane.
Generally, the interpretation of the mutagenesis experiments was
hampered by the lack of a molecular model of the activity of PepI and
related peptides, which in turn seems difficult to establish because of
our limited knowledge of the mode of action of the bacteriocins. While
it is widely accepted that the peptide antibiotics destabilize the
cytoplasmic membrane, it remains largely unclear which molecular
interactions take place at or within a bacterial membrane. Recently, we
were able to demonstrate that, in vivo, nisin and epidermin use the
undecaprenol-bound cell wall precursors, the so-called lipid I and
lipid II, as docking molecules for subsequent pore formation
(8). The high-affinity binding of the lantibiotics to lipids
I and II seems to facilitate energetically the formation of pores and
may explain the high sensitivity of some bacterial species, e.g.,
Micrococcus luteus, which has MICs in the nanomolar range.
Pep5 does not make use of the cell wall precursors (8) and
is not very active against Micrococcus. However,
Staphylococcus simulans and S. carnosus are
sensitive in nanomolar concentrations to this lantibiotic. As such low
MICs are generally not observed with amphipathic peptides and may only be achievable through high-affinity binding to particular components of
bacterial membranes, we are currently trying to identify a docking
molecule for Pep5. Such a concept for the molecular activity of at
least some lantibiotics could not only help to explain the enormous
variation in sensitivities of gram-positive bacteria to different
bacteriocins but may also provide a new role for an immunity peptide,
in that it may function by preventing the molecular target from binding
the lantibiotic.
We currently do not have a satisfactory explanation for the observation
that in the double mutant the immunity was partially restored in spite
of an apparent truncation of the twofold mutated peptide; also, the
instability of PepI after shortening of the C terminus remains to be
explained. PepI was localized outside the cells (32), and it
is conceivable that the mutations interfere with the export of the
peptides, resulting in prolonged exposure to intracellular proteases,
as observed with some altered Pep5 prepeptides (6).
However, the processes that lead to the translocation of PepI across
the membrane are also not understood. Finally, it could also be of
functional importance that the PepI-type immunity peptides seem to be
associated with lantibiotics which are processed inside the cell
(28, 44). It is obvious that many questions about these
peptides remain unanswered and that, in general, producer self-protection of gram-positive bacteria at the molecular level is the
least understood topic in bacteriocin research. Certainly, these
phenomena are of interest for fundamental research and applied disciplines and deserve more attention in the future.
 |
ACKNOWLEDGMENTS |
This work was supported by the Deutsche Forschungsgemeinschaft
(Sa 292/8-1) and the BONFOR-Programm of the Medical Faculty, University
of Bonn.
We thank A. Surovoy and G. Jung for making synthetic PepI available, G. Klemm for help with the figures, and M. Reis-Pauken for valuable discussions.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut
für Medizinische Mikrobiologie und Immunologie der
Universität Bonn, Sigmund-Freud-Str. 25, D-53105 Bonn,
Germany. Phone: 49 228 287 5704. Fax: 49 228 287 4808. E-mail:
sahl{at}mibi03.meb.uni-bonn.de.
Present address: Max-Planck-Institut für
Entwicklungsbiologie, Abteilung Biochemie, Tübingen, Germany.
 |
REFERENCES |
| 1.
|
Allgaier, H.,
G. Jung,
R. G. Werner,
U. Schneider, and H. Zähner.
1986.
Epidermin: sequencing of a heterodet tetracyclic 21-peptide amide antibiotic.
Eur. J. Biochem.
160:9-22[Medline].
|
| 2.
|
Augustin, J., and F. Götz.
1990.
Transformation of Staphylococcus epidermidis and other staphylococcal species with plasmid DNA by electroporation.
FEMS Microbiol. Lett.
66:203-208.
|
| 3.
|
Augustin, J.,
R. Rosenstein,
B. Wieland,
U. Schneider,
N. Schnell,
G. Engelke,
K.-D. Entian, and F. Götz.
1992.
Genetic analysis of epidermin biosynthetic genes and epidermin-negative mutants of Staphylococcus epidermidis.
Eur. J. Biochem.
204:1149-1154[Medline].
|
| 4.
|
Belasco, J. G., and C. F. Higgins.
1988.
Mechanisms of mRNA decay in bacteria: a perspective.
Gene
72:15-23[Medline].
|
| 5.
|
Bierbaum, G.,
M. Reis,
C. Szekat, and H.-G. Sahl.
1994.
Construction of an expression system for engineering of the lantibiotic Pep5.
Appl. Environ. Microbiol.
60:4332-4338[Abstract/Free Full Text].
|
| 6.
|
Bierbaum, G.,
C. Szekat,
M. Josten,
C. Heidrich,
C. Kempter,
G. Jung, and H.-G. Sahl.
1997.
Engineering of a novel thioether bridge and role of modified residues in the lantibiotic Pep5.
Appl. Environ. Microbiol.
62:385-392[Abstract].
|
| 7.
|
Bouvet, P., and J. G. Belasco.
1992.
Control of RNase E-mediated RNA degradation by 5'-terminal base pairing in E. coli.
Nature
360:488-491[Medline].
|
| 8.
|
Brötz, H.,
M. Josten,
I. Wiedemann,
U. Schneider,
F. Götz,
G. Bierbaum, and H.-G. Sahl.
1998.
Role of lipid-bound peptidoglycan precursors in the formation of pores by nisin, epidermin and other lantibiotics.
Mol. Microbiol.
30:317-327[Medline].
|
| 9.
|
Chan, P. T.,
H. Ohmori,
J. Tomizawa, and J. Lebowitz.
1985.
Nucleotide sequence and gene organisation of ColE1 DNA.
J. Biol. Chem.
260:8925-8935[Abstract/Free Full Text].
|
| 10.
|
Chen, C.-Y. A.,
J. T. Beatty,
S. N. Cohen, and J. G. Belasco.
1988.
An intercistronic stem-loop structure functions as an mRNA decay terminator necessary but insufficient for puf mRNA stability.
Cell
52:609-619[Medline].
|
| 11.
|
Dodd, H. M.,
N. Horn,
W. C. Chan,
C. J. Giffard,
B. W. Bycroft,
G. C. K. Roberts, and M. J. Gasson.
1996.
Molecular analysis of the regulation of nisin immunity.
Microbiology
142:2385-2392[Abstract/Free Full Text].
|
| 12.
|
Emory, S. A.,
P. Bouvet, and J. G. Belasco.
1992.
A 5'-terminal stem-loop structure can stabilize mRNA in Escherichia coli.
Genes Dev.
6:135-148[Abstract/Free Full Text].
|
| 13.
|
Engelke, G.,
Z. Gutowski-Eckel,
P. Kiesau,
K. Siegers,
M. Hammelmann, and K.-D. Entian.
1994.
Regulation of nisin biosynthesis and immunity in Lactococcus lactis 6F3.
Appl. Environ. Microbiol.
60:814-825[Abstract/Free Full Text].
|
| 14.
|
Ersfeld-Dreßen, H.,
H.-G. Sahl, and H. Brandis.
1984.
Plasmid involvement in production of and immunity to the staphylococcin-like peptide Pep5.
J. Gen. Microbiol.
130:3029-3035[Abstract/Free Full Text].
|
| 15.
|
Feliciello, I., and G. Chinali.
1993.
A modified alkaline lysis method for the preparation of highly purified plasmid DNA from Escherichia coli.
Anal. Biochem.
212:394-401[Medline].
|
| 16.
|
Geli, V.,
D. Baty,
F. Pattus, and C. Lazdunski.
1989.
Topology and function of the integral membrane protein conferring immunity to colicin A.
Mol. Microbiol.
3:679-687[Medline].
|
| 17.
|
Götz, F., and B. Schumacher.
1987.
Improvements of protoplast transformation in Staphylococcus carnosus.
FEMS Microbiol. Lett.
40:285-288.
|
| 18.
|
Gross, E.,
H. Kiltz, and E. Nebelin.
1973.
Subtilin. VI. Die Struktur des Subtilins.
Hoppe-Seyler's Z. Physiol. Chem.
354:810-812[Medline].
|
| 19.
|
Gross, E., and J. L. Morell.
1971.
The structure of nisin.
J. Am. Chem. Soc.
93:4634-4635[Medline].
|
| 20.
|
Heidrich, C.,
U. Pag,
M. Josten,
J. Metzger,
R. W. Jack,
G. Bierbaum,
G. Jung, and H.-G. Sahl.
1998.
Isolation, characterization, and heterologous expression of the novel lantibiotic epicidin 280 and analysis of its biosynthetic gene cluster.
Appl. Environ. Microbiol.
64:3140-3146[Abstract/Free Full Text].
|
| 21.
|
Hue, K. K.,
S. D. Cohen, and D. H. Bechhofer.
1995.
A polypurine sequence that acts as a 5' mRNA stabilizer in Bacillus subtilis.
J. Bacteriol.
177:3465-3471[Abstract/Free Full Text].
|
| 22.
|
Kaletta, C.,
K.-D. Entian,
R. Kellner,
G. Jung,
M. Reis, and H.-G. Sahl.
1989.
Pep5, a new lantibiotic: structural gene isolation and prepeptide sequence.
Arch. Microbiol.
152:16-19[Medline].
|
| 23.
|
Klein, C., and K.-D. Entian.
1994.
Genes involved in self-protection against the lantibiotic subtilin produced by Bacillus subtilis ATCC 6633.
Appl. Environ. Microbiol.
60:2793-2801[Abstract/Free Full Text].
|
| 24.
|
Klug, G., and S. N. Cohen.
1990.
Combined actions of multiple hairpin loop structures and sites of rate-limiting endonucleolytic cleavage determine differential degradation rates of individual segments within polycistronic puf operon mRNA.
J. Bacteriol.
172:5140-5146[Abstract/Free Full Text].
|
| 25.
|
Kuipers, O. P.,
M. M. Beerthuyzen,
P. G. G. A. de Ruyter,
E. J. Luesink, and W. M. de Vos.
1995.
Autoregulation of nisin biosynthesis in Lactococcus lactis by signal transduction.
J. Biol. Chem.
270:27299-27304[Abstract/Free Full Text].
|
| 26.
|
Kuipers, O. P.,
M. M. Beerthuyzen,
R. J. Siezen, and W. M. de Vos.
1993.
Characterization of the nisin gene cluster nisABTCIPR of Lactococcus lactis: requirement of expression of the nisA and nisI genes for producer immunity.
Eur. J. Biochem.
216:281-291[Medline].
|
| 27.
|
McMaster, G. K., and G. G. Carmichael.
1977.
Analysis of single- and double-stranded nucleic acids on polyacrylamide and agarose gels by using glyoxal and acridine orange.
Proc. Natl. Acad. Sci. USA
74:4835-4838[Abstract/Free Full Text].
|
| 28.
|
Meyer, C.,
G. Bierbaum,
C. Heidrich,
M. Reis,
J. Süling,
M. I. Iglesias-Wind,
C. Kempter,
E. Molitor, and H.-G. Sahl.
1995.
Nucleotide sequence of the lantibiotic Pep5 biosynthetic gene cluster and functional analysis of PepP and PepC.
Eur. J. Biochem.
232:478-489[Medline].
|
| 29.
|
Peschel, A., and F. Götz.
1996.
Analysis of the Staphylococcus epidermidis genes epiF, -E, and -G involved in epidermin immunity.
J. Bacteriol.
178:531-536[Abstract/Free Full Text].
|
| 30.
|
Peterson, C.
1992.
Control of functional mRNA stability in bacteria: multiple mechanisms of nucleolytic and non-nucleolytic inactivation.
Mol. Microbiol.
6:277-282[Medline].
|
| 31.
|
Pugsley, A. P.
1987.
Nucleotide sequencing of the structural gene for colicin N reveals homology between the catalytic, C-terminal domains of colicins A and N.
Mol. Microbiol.
1:317-325[Medline].
|
| 32.
|
Reis, M.,
M. Eschbach-Bludau,
M. I. Iglesias-Wind,
T. Kupke, and H.-G. Sahl.
1994.
Producer immunity towards the lantibiotic Pep5: identification of the immunity gene pepI and localization and functional analysis of its gene product.
Appl. Environ. Microbiol.
60:2876-2883[Abstract/Free Full Text].
|
| 33.
|
Reis, M., and H.-G. Sahl.
1991.
Genetic analysis of the producer self-protection mechanism ("immunity") against Pep5, p. 320-332.
In
G. Jung, and H.-G. Sahl (ed.), Nisin and novel lantibiotics. Escom, Leiden, The Netherlands.
|
| 34.
|
Rince, A.,
A. Dufour,
P. Uguen,
J.-P. Le Pennec, and D. Haras.
1997.
Characterization of the lacticin 481 operon: the Lactococcus lactis genes lctF, lctE, and lctG encode a putative ABC transporter involved in bacteriocin immunity.
Appl. Environ. Microbiol.
63:4252-4260[Abstract].
|
| 35.
|
Rosenberg, M., and D. Court.
1979.
Regulatory sequences involved in the promotion and termination of RNA transcription.
Annu. Rev. Genet.
13:319-353[Medline].
|
| 36.
|
Sahl, H.-G.
1991.
Pore formation in bacterial membranes by cationic lantibiotics, p. 347-358.
In
G. Jung, and H.-G. Sahl (ed.), Nisin and novel lantibiotics. Escom, Leiden, The Netherlands.
|
| 37.
|
Sahl, H.-G., and G. Bierbaum.
1998.
Lantibiotics: biosynthesis and biological activities of uniquely modified peptides from Gram-positive bacteria.
Annu. Rev. Microbiol.
52:41-79[Medline].
|
| 38.
|
Sahl, H.-G., and H. Brandis.
1981.
Production, purification and chemical properties of an antistaphylococcal agent produced by Staphylococcus epidermidis.
J. Gen. Microbiol.
127:377-384[Abstract/Free Full Text].
|
| 39.
|
Sahl, H.-G.,
M. Reis,
M. Eschbach,
C. Szekat,
A. G. Beck-Sickinger,
J. Metzger,
S. Stevanovic, and G. Jung.
1991.
Isolation of Pep5 prepeptides in different stages of modification, p. 332-346.
In
G. Jung, and H.-G. Sahl (ed.), Nisin and novel lantibiotics. Escom, Leiden, The Netherlands.
|
| 40.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 41.
|
Schleifer, K. H., and U. Fischer.
1982.
Description of a new species of the genus Staphylococcus: Staphylococcus carnosus.
Int. J. Syst. Bacteriol.
32:153-156.
|
| 42.
|
Schramm, E.,
T. Ölschläger,
W. Tröger, and V. Braun.
1988.
Sequence, expression and localization of the immunity protein for colicin B.
Mol. Gen. Genet.
21:176-182.
|
| 43.
|
Siegers, K., and K.-D. Entian.
1995.
Genes involved in immunity to the lantibiotic nisin produced by Lactococcus lactis 6F3.
Appl. Environ. Microbiol.
61:1082-1089[Abstract].
|
| 44.
|
Skaugen, M.,
C. I. M. Abildgaard, and I. F. Nes.
1997.
Organization and expression of a gene cluster involved in the biosynthesis of the lantibiotic lactocin S.
Mol. Gen. Genet.
253:674-686[Medline].
|
| 45.
|
Song, H. Y., and W. A. Cramer.
1991.
Membrane topography of ColE1 gene products: the immunity protein.
J. Bacteriol.
173:2935-2943[Abstract/Free Full Text].
|
| 46.
|
Wieland, K.-P.,
B. Wieland, and F. Götz.
1995.
A promoter-screening plasmid and xylose-inducible, glucose-repressible expression vectors for Staphylococcus carnosus.
Gene
158:91-96[Medline].
|
| 47.
|
Wong, H. C., and S. Chang.
1986.
Identification of a positive retroregulator that stabilizes mRNAs in bacteria.
Proc. Natl. Acad. Sci. USA
83:3233-3237[Abstract/Free Full Text].
|
| 48.
|
Worobo, R. W.,
M. J. van Belkum,
M. Sailer,
K. L. Roy,
J. C. Vederas, and M. E. Stiles.
1995.
A signal peptide secretion-dependent bacteriocin from Carnobacterium divergens.
J. Bacteriol.
177:3143-3149[Abstract/Free Full Text].
|
| 49.
|
Yanisch-Perron, C.,
J. Vieira, and J. Messing.
1985.
Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.
Gene
33:103-109[Medline].
|
| 50.
|
Zell, R., and H. Fritz.
1987.
DNA mismatch repair in Escherichia coli counteracting the hydrolytic deamination of 5-methyl-cytosine residues.
EMBO J.
6:1809-1815[Medline].
|
Applied and Environmental Microbiology, February 1999, p. 591-598, Vol. 65, No. 2
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Fernandez, M., Sanchez-Hidalgo, M., Garcia-Quintans, N., Martinez-Bueno, M., Valdivia, E., Lopez, P., Maqueda, M.
(2008). Processing of as-48ABC RNA in AS-48 Enterocin Production by Enterococcus faecalis. J. Bacteriol.
190: 240-250
[Abstract]
[Full Text]
-
Kuipers, A., Wierenga, J., Rink, R., Kluskens, L. D., Driessen, A. J. M., Kuipers, O. P., Moll, G. N.
(2006). Sec-Mediated Transport of Posttranslationally Dehydrated Peptides in Lactococcus lactis. Appl. Environ. Microbiol.
72: 7626-7633
[Abstract]
[Full Text]
-
Cotter, P. D., Draper, L. A., Lawton, E. M., McAuliffe, O., Hill, C., Ross, R. P.
(2006). Overproduction of wild-type and bioengineered derivatives of the lantibiotic lacticin 3147.. Appl. Environ. Microbiol.
72: 4492-4496
[Abstract]
[Full Text]
-
Hoffmann, A., Schneider, T., Pag, U., Sahl, H.-G.
(2004). Localization and Functional Analysis of PepI, the Immunity Peptide of Pep5-Producing Staphylococcus epidermidis Strain 5. Appl. Environ. Microbiol.
70: 3263-3271
[Abstract]
[Full Text]
-
Kemperman, R., Jonker, M., Nauta, A., Kuipers, O. P., Kok, J.
(2003). Functional Analysis of the Gene Cluster Involved in Production of the Bacteriocin Circularin A by Clostridium beijerinckii ATCC 25752. Appl. Environ. Microbiol.
69: 5839-5848
[Abstract]
[Full Text]
-
Bell, G., Gouyon, P.-H.
(2003). Arming the enemy: the evolution of resistance to self-proteins. Microbiology
149: 1367-1375
[Abstract]
[Full Text]
-
Stein, T., Heinzmann, S., Solovieva, I., Entian, K.-D.
(2003). Function of Lactococcus lactis Nisin Immunity Genes nisI and nisFEG after Coordinated Expression in the Surrogate Host Bacillus subtilis. J. Biol. Chem.
278: 89-94
[Abstract]
[Full Text]
-
Scupham, A. J., Dong, Y., Triplett, E. W.
(2002). Role of tfxE, but Not tfxG, in Trifolitoxin Resistance. Appl. Environ. Microbiol.
68: 4334-4340
[Abstract]
[Full Text]
-
Hille, M., Kies, S., Götz, F., Peschel, A.
(2001). Dual Role of GdmH in Producer Immunity and Secretion of the Staphylococcal Lantibiotics Gallidermin and Epidermin. Appl. Environ. Microbiol.
67: 1380-1383
[Abstract]
[Full Text]
-
Altena, K., Guder, A., Cramer, C., Bierbaum, G.
(2000). Biosynthesis of the Lantibiotic Mersacidin: Organization of a Type B Lantibiotic Gene Cluster. Appl. Environ. Microbiol.
66: 2565-2571
[Abstract]
[Full Text]
-
McAuliffe, O., Hill, C., Ross, R. P.
(2000). Identification and overexpression of ltnI, a novel gene which confers immunity to the two-component lantibiotic lacticin 3147. Microbiology
146: 129-138
[Abstract]
[Full Text]