Previous Article | Next Article 
Applied and Environmental Microbiology, February 1999, p. 795-801, Vol. 65, No. 2
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Changes in Bacterial and Eukaryotic Community
Structure after Mass Lysis of Filamentous Cyanobacteria
Associated with Viruses
Erik J.
van
Hannen,*
Gabriel
Zwart,
Miranda P.
van Agterveld,
Herman J.
Gons,
Jeannine
Ebert, and
Hendrikus J.
Laanbroek
Department of Microbial Ecology, Centre for
Limnology, Netherlands Institute of Ecology, 3600 BG Maarssen, The
Netherlands
Received 5 October 1998/Accepted 19 November 1998
 |
ABSTRACT |
During an experiment in two laboratory-scale enclosures filled with
lake water (130 liters each) we noticed the almost-complete lysis of
the cyanobacterial population. Based on electron microscopic observations of viral particles inside cyanobacterial filaments and
counts of virus-like particles, we concluded that a viral lysis of the
filamentous cyanobacteria had taken place. Denaturing gradient gel
electrophoresis (DGGE) of 16S ribosomal DNA fragments qualitatively
monitored the removal of the cyanobacterial species from the community
and the appearance of newly emerging bacterial species. The majority of
these bacteria were related to the Cytophagales and
actinomycetes, bacterial divisions known to contain species capable of
degrading complex organic molecules. A few days after the cyanobacteria
started to lyse, a rotifer species became dominant in the DGGE profile
of the eukaryotic community. Since rotifers play an important role in
the carbon transfer between the microbial loop and higher trophic
levels, these observations confirm the role of viruses in channeling
carbon through food webs. Multidimensional scaling analysis of the DGGE
profiles showed large changes in the structures of both the bacterial
and eukaryotic communities at the time of lysis. These changes were
remarkably similar in the two enclosures, indicating that such
community structure changes are not random but occur according to a
fixed pattern. Our findings strongly support the idea that viruses can
structure microbial communities.
 |
INTRODUCTION |
Photosynthetically derived organic
carbon is one of the major energy sources for heterotrophic bacteria in
oceans and lakes (3, 6, 16). This organic carbon is made
available to the bacteria through various pathways. Exudation by
phototrophs and excretion by their grazers provide rather constant
release of carbon. The decline of phytoplankton blooms releases
dissolved organic carbon in a short time, which can be rapidly used by
heterotrophic bacteria (4, 13, 20, 51). To study the growth
of heterotrophic bacteria on exudates released by cyanobacteria, we
conducted experiments in laboratory-scale enclosures (LSEs) filled with
lake water. However, 15 days after the experiments started nearly all
filamentous cyanobacteria lysed. Electron microscopic observations of
viruses inside filaments of cyanobacteria and counts of virus-like
particles indicated a viral lysis event.
Cell lysis is a major cause of phytoplankton bloom decline (13,
51), and many studies have shown the importance of viruses in phytoplankton mortality (12, 20, 44, 48, 49). These viruses are considered to be important members of the microbial loop
(5, 8, 49). High viral abundance and decay rates suggest
considerable viral activity (10), which is also indicated by
observations of microbial cells containing mature viral particles (42). It has been calculated that 10 to 20% of the marine
bacterial community is lysed by viruses on a daily basis
(47). Approximately the same mortality was found in a
freshwater study (23). Hence, viral lysis is a significant
factor in controlling bacterial and primary production (23, 33,
49, 54) and carbon and nutrient flow within the microbial loop
(9, 34).
Besides controlling carbon production, viruses are also thought to
structure microbial communities (25). Similar to the size-selective grazing of bacterivores (30), viral host
specificity could be a very strong structuring force of microbial
communities. The lysis and removal of species from the microbial
community and the consecutive nutrient release may give other species
the opportunity to proliferate. To test the hypothesis that viruses could structure the microbial community, we used denaturing gradient gel electrophoresis (DGGE) (19) to follow the changes in the structure of both the bacterial and eukaryotic communities before and
after the lysis event. DGGE analysis of 16S and 18S ribosomal DNA
(rDNA) fragments circumvents the problem of underestimating microbial
diversity due to noncultivable microorganisms. This molecular
technique has been used extensively to profile natural bacterial
diversity (18, 36, 50), and statistical analysis of the DGGE
patterns can reveal relative changes in the microbial community
structure (52, 53).
 |
MATERIALS AND METHODS |
Experimental design.
Two LSEs, especially designed to mimic
the physical environment of Lake Loosdrecht, The Netherlands
(46), were each filled with 130 liters of Lake Loosdrecht
water sampled on 26 November 1996. Lake Loosdrecht is a shallow
eutrophic lake dominated by filamentous cyanobacteria. The water
temperature at the time of sampling was 3.6°C. The temperature was
raised to 20°C within 1 day. Both LSEs were supplied with medium at a
dilution rate of 0.05 day
1. The incident irradiance was
50 W · m
2 during a 16-h light period. The LSEs
were stirred continuously to assure complete mixing. After 1 week of
adaptation, both LSEs received elevated light levels of 150 W · m
2 during 4 h around the midpoint of the light
period. In one system (LSE 1), stirring was halted during this
high-light period. Elevated light levels were used to trigger exudate production.
Chl-a, virus-like particles, and numbers of
bacteria.
Chlorophyll a (Chl-a)
concentrations were measured after hot-ethanol extraction
(35). Virus-like particles were enumerated by YOPRO staining
(24). Bacteria were counted by DAPI
(4',6-diamidino-2-phenylindole) staining (41).
DNA extraction, PCR, and DGGE.
DNA was released from the
cells by mechanical force (bead beating) concomitant with phenol
extraction and ethanol precipitation (57). PCR primers
against the V2 region were used for the amplification of the 16S rRNA
gene. The PCR primers were F357GC
(5'-CGCCCG CCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCCCCTACGGGAGGC AGCAG-3'),
which contains a GC-rich clamp and is specific for most
Bacteria, and R518 (5'-ATTACCGCGGCTGCTGG-3'),
which is specific for most Bacteria,
Archaea, and Eucarya (36). PCR
amplification was performed in a 50-µl volume containing
approximately 100 ng of template DNA, 10 mM Tris-HCl (pH 8.3), 50 mM
KCl, 0.01% (wt/vol) gelatin, 1.5 mM MgCl2, 0.5 µM (each)
primer, 200 µM (each) deoxynucleotide, 400 ng of bovine serum
albumin, and 2.5 U of Taq DNA polymerase (Boehringer
Mannheim, Mannheim, Germany). PCR cycling was performed with a
Perkin-Elmer 480 thermocycler. The temperature-cycling conditions were
as follows. After a preincubation at 94°C for 5 min, a total of 25 cycles were performed at 94°C for 1 min, TA
for 1 min, and 72°C for 1 min. In the first 20 cycles,
TA decreased by 1°C, stepwise, each two
cycles, from 65°C in the first cycle to 56°C in the 20th. In the
last five cycles, TA was 55°C. Cycling was
followed by 5 min of incubation at 72°C. The primers for the amplification of the 18S rRNA gene were F1427GC
(5'-CGCCCGCCGCGCC CCGCGCCCGGCCCGCCGCCCCCGCCCCTCTGTGATGCCCTTAGATGT TCTGGG-3')
and R1616 (5'-GCGGTGTGTACAAAGGGCAGGG-3'). Both primers
are specific for eukaryotic aquatic microorganisms (53). The
temperature-cycling conditions were as follows: one preincubation step
at 94°C for 5 min followed by 25 cycles of 94°C for 1 min, 52°C
for 1 min, and 72°C for 1 min and then a final extension step of
72°C for 5 min. The reaction conditions were as described above.
DGGE was performed as described previously (36, 53).
Briefly, similarly sized PCR products were separated on a 1.5-mm-thick vertical gel containing 8% (wt/vol) polyacrylamide
(acrylamide-bisacrylamide, 37.5:1) and a linear gradient of the
denaturants urea and formamide, increasing from 35% at the top of the
gel to 55% at the bottom for the separation of the 16S rDNA fragment
and from 30 to 55% for the separation of the 18S rDNA fragment. Here,
100% denaturant is defined as 7 M urea and 40% (vol/vol) formamide.
Equal amounts of PCR products were applied to the DGGE gel. The
concentrations of PCR products were estimated by separation on 2.0%
agarose gels, staining with ethidium bromide (see below), and analysis
of digitized images with ImageQuant software (Molecular Dynamics Ltd.,
Kemsing, England). Fifty microliters of the sample with the largest
amount of PCR product was loaded on the DGGE gel. All other samples
were loaded in amounts relative to this sample. Electrophoresis was performed at 60°C in a buffer containing 40 mM Tris, 40 mM acetic acid, and 1 mM EDTA at pH 7.6 (0.5× TAE), and 75 V of electricity was applied to the submerged gel for 16 h. Nucleic acids were visualized by staining them for 1 h in 0.5× TAE buffer containing 0.5 mg of ethidium bromide liter
1 followed by destaining
for 5 min in demineralized water and photographing the gel with a
charge-coupled device camera (The Imager; Appligene, Illkirch, France).
Digitized images were inverted with Photostyler software (Aldus
Corporation, Seattle, Wash.). The contrast and gray balance of the
entire image were adjusted to reduce background.
DGGE marker sequences.
Sequences obtained from a clone
library of the 16S rRNA genes from Lake Loosdrecht (56) were
used to construct a marker for DGGE analysis. Cyanobacterial sequences
in this clone library were aligned against the most similar sequences
from the EMBL database (see below).
Sequencing of excised DGGE bands.
Nucleotide sequences of
DGGE bands of interest were obtained either by direct sequencing of DNA
from excised DGGE bands (18S rDNA) or by sequencing the excised
fragment (16S rDNA) ligated in a pGEM-T vector (Promega, Madison, Wis.)
and were transfected through heat shock to Epicurian Coli XL1-Blue MRF'
supercompetent Escherichia coli cells (Stratagene, La Jolla,
Calif.). Ligation, transformation, and sequencing procedures for the
16S rDNA fragment have been described previously (56). To
obtain sequences from the 18S rDNA fragments, a small block of gel from
the middle of the target band was excised from the DGGE gel with a
surgical knife and placed into a 2-ml screw-cap tube. To extract the
DNA from the gel, 0.5 ml of TE (10 mM Tris, pH 7.6, 1 mM EDTA) was added to the tube together with 0.5 g of zirconium beads (0.1-mm diameter). The tubes were then vigorously shaken (5,000 rpm) on a Mini
Beadbeater (Biospec Products, Bartlesville, Okla.) for 2 min with
intermittent cooling on ice. The released DNA fragment was then
amplified in 25 cycles of PCR with eukaryote-specific primers
previously described (53). The reverse primer was extended at the 5' site by the vector-specific M13 forward sequence, yielding 5'-TGTAAAACGACGGCCAGTGCGGTGTGTACAAAGGGCAGGG. Amplification
primers and primer-dimers were removed with the Wizard PCR Preps direct purification system (Promega) according to the manufacturer's instructions. The PCR products were then cycle sequenced with a Texas
red-labeled M13 forward primer (5'-TGTAAAACGACGGCCA) and Thermosequenase (Amersham, Little Chalfont, United Kingdom). Fragment separation, detection, and base calling were done with a Vistra DNA
sequencer 725 (Amersham).
DGGE pattern analysis.
The DGGE banding patterns were
converted to a binary matrix to make the data accessible to statistical
analysis (53). The presence or absence of a nucleic acid
band at the same height in each lane was marked with a 1 or 0, respectively. Since microorganisms can have multiple copies of their
rRNA gene, care should be taken with the interpretation of the number
of species present in a DGGE pattern. We therefore refer to a band as a
sequence type rather than a species. Gel images were enlarged two times
to facilitate band detection. From this binary matrix, a distance
matrix was calculated (37). The distance matrix was then
analyzed by nonmetric multidimensional scaling (NMDS). This analysis
constructs a map showing the relationships among a number of
observations given only a table of distances between them. The data is
presented in a Euclidean plane such that highly similar measurements
are plotted close together. Such a graphical representation is much easier to interpret than the original table of distances. The dimensions (axes) in the map have no special significance and can be
rotated or mirrored without influencing the relative distances between
the points. As a measure of the goodness of fit of the reproduced
distances to the observed distances, the stress value is used. When
stress values are <0.1, the NMDS plot is considered to be an
acceptable representation of the original data. Interpretation of the
NMDS plot can be achieved by explaining single dimensions or by finding
structures or patterns in the multidimensional space (7,
31). Applied to DGGE data, the NMDS map shows every banding pattern
the community structure at a particular point in time
as one
dated point, and by connecting consecutive points, relative changes in
the community structure can be visualized and interpreted. NMDS has
been proven to be useful as a tool for analysis of genetic structures
(32, 52).
Sequence analysis.
The partial 16S and 18S rRNA gene
sequences recovered from the two LSEs were screened against GenBank and
EMBL sequences
with BLAST (1) (http://www.ncbi.nlm.nih.gov/cgi-bin/BLAST/nph-blast?Jform=0). The
sequences with the highest similarities were then used in a similarity
index calculation. Gaps and ambiguities were not included in this
calculation. The sequences were aligned by the DCSE program
(15).
Nucleotide sequence accession numbers.
All partial sequences
from excised bands have been deposited in the EMBL database. Eukaryotic
sequences have been deposited under accession no. AJ009546 to AJ009554.
Bacterial sequences have been deposited under accession no. AJ009642 to
AJ009654.
 |
RESULTS |
Cyanobacterial lysis.
During the first 15 days of the
experiment the Chl-a concentration increased almost
threefold for LSE 1 and fourfold for LSE 2, indicating an actively
growing cyanobacterial community (Table 1). Microscopic observations showed that
more than 95% of the cyanobacterial population consisted of
Oscillatoria c.f. limnetica and
Prochlorothrix hollandica. However, 15 days after the
experiment started, a decrease in Chl-a occurred in both
LSEs: within 4 days, levels dropped to 10% of the maximum levels.
Parallel to this decrease in Chl-a, we noticed an increase
in virus-like particles and numbers of bacteria (Table 1). Electron
microscopic observations showed lambda-like phages in the culture
medium, attached to filaments of cyanobacteria and densely packed
inside lysed cyanobacterial filaments.
Bacterial community structure.
Analysis of the 16S
rRNA-defined community revealed that most of the identified bands
related to cyanobacteria had disappeared from the DGGE pattern in both
LSEs (Fig. 1). Bands related to cyanobacteria were identified by comparison with clone sequences, obtained from Lake Loosdrecht (Table 2),
from the marker lanes. At the beginning of the experiment, 35% of the
DGGE bands were related to cyanobacteria. Most of these bands decreased
in intensity from day 10 on, except for the LD18 band, which increased
in intensity until day 15 before it diminished from the pattern. On day
27, the LD18 band was the only band related to cyanobacteria that could be detected. Until day 15, the number of sequence types as
detected by DGGE remained almost constant (Fig.
2). After the lysis event (day 15), many
new sequence types were appearing in the DGGE patterns of both LSEs.
Twelve of these new bands were excised from the gel and sequenced to
obtain phylogenetic information. Four of the bands (bands 1, 2, 4, and
7) appeared to be related to the Cytophagales, three (bands
3, 5, and 6) appeared to be related to the
-Proteobacteria, three (bands 10, 11, and 12) appeared to
be related to the actinomycetes, and two (bands 8 and 9) appeared to be
related to the
-Proteobacteria (Table
3). Analysis of the DGGE patterns by NMDS
(Fig. 3) showed a relatively constant
bacterial community structure for LSE 1 until day 15. From day 15 to
day 20, the community structure showed large changes. Thereafter,
changes were relatively small again. The community structure of LSE 2 remained constant until day 17, and then a major change occurred
between days 17 and 20. During the last 7 days, changes in the
community structure were relatively small again.

View larger version (108K):
[in this window]
[in a new window]
|
FIG. 1.
Negative image of an ethidium bromide-stained DGGE
pattern of the bacterial community structures of LSEs 1 and 2. The
numbers at the top of the image indicate days from the start of the
experiment. The numbered white circles refer to the excised and
sequenced bands explained in Table 3. Lane M, marker lane containing
the clones from the Lake Loosdrecht clone library. Clones related to
cyanobacteria are indicated by "LD" and are elucidated in Table
2.
|
|

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 2.
Numbers of bacterial sequence types detected by DGGE
analysis during the course of the experiment.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
NMDS map showing the changes in the structures of the
bacterial communities during the lysis event. The numbers inside the
symbols refer to the days of the experiment.
|
|
Eukaryotic community structure.
The DGGE analysis of the 18S
rDNA fragments of both LSEs showed no notable change in the banding
pattern until day 17. The DGGE patterns of both LSEs on day 20, and the
DGGE pattern of LSE 2 on day 21, were completely dominated by a single
band (Fig. 4). Excision and sequence
analysis showed that this band (excised bands 6 and 7) represented a
rotifer-like sequence. Rotifer abundance was estimated on days 17, 20, 21, and 27. In LSE 1 the densities were 1 × 104,
3.1 × 104, 1.7 × 104, and 0.1 × 104 individuals · liter
1,
respectively. In LSE2 the numbers were 0.1 × 104,
4 × 104, 7 × 104, and 0.8 × 104 individuals · liter
1,
respectively. Other dominant bands that appeared after the lysis event
were excised from the gel and sequenced. Their similarities to the
closest sequences in the EMBL database are shown in Table 4. Three of these bands (1, 3, and 4)
showed very low similarity (<90%) to known eukaryotic sequences. Band
2 was related to the Ciliophora. Bands 6, 7, and 9 were very closely
related (>99%) to the rotifer Brachionus plicatilis, and
band 8 was related to an Arthropoda sequence.

View larger version (141K):
[in this window]
[in a new window]
|
FIG. 4.
Negative image of an ethidium bromide-stained DGGE gel
of the eukaryotic community structures of LSEs 1 and 2. The numbers at
the top of the image indicate the days from the start of the
experiment. The numbered white circles refer to the excised and
sequenced bands elucidated in Table 4.
|
|
Analysis of the eukaryotic DGGE patterns by NMDS revealed that only
small changes occurred in the eukaryotic microbial community
during the
first 20 days of the experiment (Fig.
5).
Five days
after the lysis event a major change in the eukaryotic
communities
of both LSEs was observed. Thereafter, the community
structure
returned to a state approximately similar to that preceding
the
lysis event.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 5.
NMDS map showing the changes in the structures of the
eukaryotic communities during the lysis event. The numbers inside the
symbols refer to the days of the experiment.
|
|
 |
DISCUSSION |
Quantitative versus qualitative DGGE.
The PCR-based methods we
used in this study merely give a qualitative view of the changes in
both the bacterial and eukaryotic community structures after the viral
lysis event. Many studies have shown that these methods are prone to
give a quantitatively incorrect view of the microbial community
(17, 22, 27, 39, 45). An example is the apparently
increasing dominance of the Oscillatoria agardhii-related
band (LD18) during the first 16 days of the experiment. Microscopic
estimations revealed that O. agardhii contributed less than
1% to the total cyanobacterial biomass. Another example is the
complete dominance of the eukaryotic DGGE patterns by a single rotifer
band. Since rotifers are metazoa, every individual contributes many
cells, and thus many copies of their rRNA gene, to the PCR. Unless
multicellular species can be removed from the sample, eukaryotic DGGE
patterns have to be interpreted cautiously. To exclude these errors, we
did not use the intensities of the DGGE bands as a measure of
abundance. Instead, we reduced the information to simply presence or
absence of a sequence type. Thus, only the complete removal or new
emergence of sequence types would be detected by NMDS.
Viruses as structuring forces.
We started an experiment to
follow the growth of heterotrophic bacteria on exudates of
cyanobacteria. However, all filamentous cyanobacteria lysed, and we
were able to monitor the appearance of previously undetected bacterial
and eukaryotic species on the released carbon. From counts of
virus-like particles and observations of numerous free virus particles
and viruses attached to filaments of cyanobacteria, we concluded that
there had been a massive viral outbreak. The increased numbers of
bacteria (Table 1), the disappearance of the bands related to
cyanobacteria from the DGGE patterns (Fig. 1), and the increase in
bacterial richness (Fig. 2) suggest a change in the bacterial community
structure driven by the viral outbreak. This alleged viral control was
also shown by the NMDS analysis of the DGGE patterns (Fig. 3), where
notable changes in the banding patterns and thus in the community
structure were observed during the lysis in both LSEs. This structuring
capability of natural viruses was also shown by monitoring the removal
of a specific bacterium that was introduced to a microcosm
(25). Although the largest changes in the community
structure occurred during the lysis of the cyanobacterial populations,
small changes in the community structure before and after the lysis of
cyanobacteria were apparent. These changes could have been caused by
the increase in temperature at the start of the experiment or by the
selectivity of the culture medium.
Bacterial community structure.
We not only showed the removal
of specific members of the microbial community, but we also detected
their replacement by other species. Sequence analysis of the most
dominant emerging bands showed that the majority of the newly appearing
bacteria belonged to the Cytophagales (bands 1, 2, 4, and 7)
and the actinomycetes (bands 10, 11, and 12) (Table 3). Apparently,
these bacteria can respond rapidly to the dissolved organic matter
released due to the lysis. The Cytophagales are common soil
and water bacteria (14) and are well known for their
capability to degrade large complex carbohydrates (43). The
actinomycetes are also found in freshwater habitats, where they may
play an active role in the decomposition of chitin, cellulose, and
proteins (26, 28, 29). One sequence (bands 5 and 6, which
have identical positions in the gel) was related to the
-Proteobacteria and was 100% identical to that of an
unknown bacterium isolated from the surface of a copper pipe used in a
potable-water system (11). One sequence (bands 8, 9) was
related to the
-Proteobacteria. Both of these
- and
-Proteobacteria are commonly found in freshwater
environments (38).
Some bands that appeared at the same position in the DGGE
patterns of LSEs 1 and 2 were excised from both patterns and sequenced
to validate the identity of the sequences they exhibited. From
bands 5 and 6, we did retrieve almost-identical sequences (98.2%).
However, from bands 8 and 9 we retrieved different sequences.
Additional sequencing of one more clone from each band revealed
that of
the four sequences obtained from bands 8 and 9, three
sequences were
nearly identical (99.4 to 100%) and one sequence
(band 8a) was only
91.7% similar to the other sequences (bands
8b and 9). Apparently,
these two sequence types were not resolved
by
DGGE.
Eukaryotic community structure.
While the bacterial community
showed almost-immediate changes after the lysis event, the eukaryotic
community did not react until 5 days later. At that time, the pattern
was completely dominated by a single band representing a rotifer-like
sequence. After this apparent rotifer dominance, the community returned
to a structure similar to that before the lysis. We found high numbers
of rotifers in both LSEs, up to 7 × 104
liter
1. While these numbers are commonly found in
laboratory cultures, where densities can exceed 106
liter
1 (55), the maximum natural abundance is
at least four times lower (21). These rotifers feed on
bacteria, phytoplankton, and protozoa (reference 3
and references therein), and the microbial loop after lysis apparently
channeled the food for the rapid growth of these rotifer species.
Rotifers are considered to be an important link between the microbial
loop and higher trophic levels (2, 40). The observed rotifer
proliferation suggests that viral lysis can increase the carbon flow to
the higher trophic levels, at least in freshwater systems like Lake Loosdrecht, where rotifers can rapidly reach high densities
(21). Besides this rotifer-related band, we found one
ciliate-related band and five bands that represented sequences with low
similarities (<94%) to the limited number of known eukaryotic
sequences in the EMBL sequence database. This low similarity may be
partly caused by the direct sequencing of excised DGGE bands. We found that this method often yields ambiguous sequences.
Conclusions.
The combination of a molecular profiling
technique and an ordination method allowed the investigation of the
impact of a viral lysis event on the structures of both the bacterial
and the eukaryotic communities. Shortly after the cyanobacteria started
to lyse, previously undetected bacterial sequence types were emerging
in the DGGE profiles. The majority of these sequence types were related to bacterial species that are capable of degrading complex carbons. A
few days later, a rotifer species profited from the lysis event and
became dominant. Since rotifers are important links between the
microbial loop and the classical food chain, this dominance after the
viral outbreak could indicate the importance of viruses in channeling
carbon through food webs.
The NMDS analysis of DGGE patterns seems to provide us with an
interpretable, albeit qualitative, picture of the changes that
occurred
after the lysis of the cyanobacterial population. The
NMDS analysis
showed that the changes in the structures of both
the bacterial and
eukaryotic communities were remarkably similar
in both LSEs (Fig.
3 and
5). This supports the notion that changes
in community structure
following changes in environmental conditions
are not random and that
these changing conditions act as governing
forces of the microbial
community
structure.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Dept. of
Microbial Ecology, Netherlands Institute of Ecology, Centre for
Limnology, P.O. Box 1299, 3600 BG Maarssen, The Netherlands. Phone: 31 (0)294 239315. Fax: 31 (0)294 232224. E-mail:
vanhannen{at}cl.nioo.knaw.nl.
Publication no. 2483 of the Netherlands Institute of Ecology,
Centre for Limnology.
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[Medline].
|
| 2.
|
Arndt, H.
1993.
Rotifers as predators on components of the microbial web (bacteria, heterotrophic flagellates, ciliates) a review.
Hydrobiologia
255/256:231-246.
|
| 3.
|
Azam, F.,
T. Fenchel,
J. G. Field,
J. S. Gray,
L. A. Meyer-Reil, and F. Thingstad.
1983.
The ecological role of water-column microbes in the sea.
Mar. Ecol. Prog. Ser.
10:257-263.
|
| 4.
|
Baldi, F.,
A. Minacci,
A. Saliot,
L. Mejanelle,
P. Mozetic,
V. Turk, and A. Malej.
1997.
Cell lysis and release of particulate polysaccharides in extensive marine mucilage assessed by lipid biomarkers and molecular probes.
Mar. Ecol. Prog. Ser.
153:45-57.
|
| 5.
|
Bergh, O.,
K. Y. Børsheim,
G. Bratbak, and M. Heldal.
1989.
High abundance of viruses found in aquatic environments.
Nature
340:467-468[Medline].
|
| 6.
|
Bird, D. F., and J. Kalff.
1984.
Empirical relationships between bacterial abundance and chlorophyll concentrations in fresh and marine waters.
Can. J. Fish. Aquat. Sci.
41:1015-1023.
|
| 7.
|
Borg, I., and J. Lingoes.
1987.
Multidimensional similarity structure analysis.
Springer-Verlag, New York, N.Y.
|
| 8.
|
Bratbak, G.,
M. Heldal,
S. Norland, and T. F. Thingstad.
1990.
Viruses as partners in spring bloom microbial trophodynamics.
Appl. Environ. Microbiol.
56:1400-1405[Abstract/Free Full Text].
|
| 9.
|
Bratbak, G.,
M. Heldal,
T. F. Thingstad,
B. Riemann, and O. H. Haslund.
1992.
Incorporation of viruses into the budget of microbial C-transfer. A first approach.
Mar. Ecol. Prog. Ser.
83:273-280.
|
| 10.
|
Bratbak, G.,
T. F. Thingstad, and M. Heldal.
1994.
Viruses and the microbial loop.
Microb. Ecol.
28:209-221.
|
| 11.
| Bremer, P. Unpublished data.
|
| 12.
|
Brussaard, C. P. D.,
R. S. Kempers,
A. J. Kop,
R. Riegman, and M. Heldal.
1996.
Virus-like particles in a summer bloom of Emiliania huxleyi in the North Sea.
Aquat. Microb. Ecol.
10:105-113.
|
| 13.
|
Brussaard, C. P. D.,
R. Riegman,
A. A. M. Noordeloos,
G. C. Cadee,
H. Witte,
A. J. Kop,
G. Nieuwland,
F. C. Vanduyl, and R. Bak.
1995.
Effects of grazing, sedimentation and phytoplankton cell lysis on the structure of a coastal pelagic food web.
Mar. Ecol. Prog. Ser.
123:259-271.
|
| 14.
|
Christensen, P. J.
1977.
The history, biology and taxonomy of the cytophaga group.
Can. J. Microbiol.
23:1599-1653[Medline].
|
| 15.
|
De Rijk, P., and R. De Wachter.
1993.
DCSE, an interactive tool for sequence alignment and secondary structure research.
Comput. Appl. Biosci.
9:735-740[Abstract/Free Full Text].
|
| 16.
|
Egli, T.
1995.
The ecological and physiological significance of the growth of heterotrophic microorganisms with mixtures of substrates.
Adv. Microb. Ecol.
14:305-386.
|
| 17.
|
Farrelly, V.,
F. A. Rainey, and E. Stackebrandt.
1992.
Effect of genome size and rrn gene copy number on PCR amplification of 16S rRNA genes from a mixture of bacterial species.
Appl. Environ. Microbiol.
61:2798-2801[Abstract].
|
| 18.
|
Ferris, M. J.,
S. C. Nold,
N. P. Revsbech, and D. M. Ward.
1997.
Population structure and physiological changes within a hot spring microbial community following disturbance.
Appl. Environ. Microbiol.
63:1367-1374[Abstract].
|
| 19.
|
Fisher, S. G., and L. S. Lerman.
1979.
Length-independent separation of DNA restriction fragments in two dimensional gel electrophoresis.
Cell
16:191-200[Medline].
|
| 20.
|
Gobler, C. J.,
D. A. Hutchins,
N. S. Fisher,
E. M. Cosper, and S. A. Sanudowilhelmy.
1997.
Release and bioavailability of C, N, P, Se, and Fe following viral lysis of a marine chrysophyte.
Limnol. Oceanogr.
42:1492-1504.
|
| 21.
|
Gulati, R. D.,
A. L. Ooms-Wilms,
O. F. R. Van Tongeren,
G. Postema, and K. Siewertsen.
1992.
The dynamics and role of limnetic zooplankton in Loosdrecht Lakes (The Netherlands).
Hydrobiologia
233:69-86.
|
| 22.
|
Hansen, M. C.,
T. Tolker-Nielsen,
M. Givskov, and S. Molin.
1998.
Biased 16S rDNA PCR amplification caused by interference from DNA flanking the template region.
FEMS Microbiol. Ecol.
26:141-149.
|
| 23.
|
Hennes, K. P., and M. Simon.
1995.
Significance of bacteriophages for controlling bacterioplankton growth in a mesotrophic lake.
Appl. Environ. Microbiol.
61:333-340[Abstract].
|
| 24.
|
Hennes, K. P., and C. A. Suttle.
1995.
Direct counts of viruses in natural waters and laboratory cultures by epifluorescence microscopy.
Limnol. Oceanogr.
40:1050-1055.
|
| 25.
|
Hennes, K. P.,
C. A. Suttle, and A. M. Chan.
1995.
Fluorescently labeled virus probes show that natural virus populations can control the structure of marine microbial communities.
Appl. Environ. Microbiol.
61:3623-3627[Abstract].
|
| 26.
|
Jiang, C. L., and H. L. Xu.
1996.
Diversity of aquatic actinomycetes in lakes of the middle plateau, Yunnan, China.
Appl. Environ. Microbiol.
62:249-253[Abstract].
|
| 27.
|
Johnson, J. L.
1991.
Isolation and purification of nucleic acids, p. 1-19.
In
E. Stackebrandt, and M. Goodfellow (ed.), Nucleic acid techniques in bacterial systematics. John Wiley & Sons Ltd., West Sussex, England.
|
| 28.
|
Johnston, D. W., and T. Cross.
1976.
The occurrence and distribution of actinomycetes in lakes of the English Lake District.
Freshwater Biol.
6:457-463.
|
| 29.
|
Johnston, D. W., and T. Cross.
1976.
Actinomycetes in lake muds: dormant spores or metabolically active mycelium.
Freshwater Biol.
6:465-470.
|
| 30.
|
Jürgens, K., and H. Güde.
1994.
The potential importance of grazing-resistant bacteria in planktonic systems.
Mar. Ecol. Prog. Ser.
112:169-188.
|
| 31.
|
Kruskal, J. B., and M. Wish.
1978.
Multidimensional scaling.
Sage Publications, Beverly Hills, Calif.
|
| 32.
|
Lessa, E. P.
1990.
Multidimensional analysis of geographic genetic structure.
Syst. Zool.
39:242-252.
|
| 33.
|
Mathias, C. B.,
A. K. T. Kirschner, and B. Velimirov.
1995.
Seasonal variations of virus abundance and viral control of the bacterial production in a backwater system of the Danube River.
Appl. Environ. Microbiol.
61:3734-3740[Abstract].
|
| 34.
|
Middelboe, M.,
N. O. G. Jorgensen, and N. Kroer.
1996.
Effects of viruses on nutrient turnover and growth efficiency of noninfected marine bacterioplankton.
Appl. Environ. Microbiol.
62:1991-1997[Abstract].
|
| 35.
|
Moed, J. R., and G. M. Hallegraeff.
1978.
Some problems in the estimation of chlorophyll-a and phaeopigments from pre- and post-acidification spectrophotometric measurements.
Int. Rev. Gesamten Hydrobiol.
63:787-800.
|
| 36.
|
Muyzer, G.,
E. C. Dewaal, and A. G. Uitterlinden.
1993.
Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16s rRNA.
Appl. Environ. Microbiol.
59:695-700[Abstract/Free Full Text].
|
| 37.
|
Nei, M., and W. H. Li.
1979.
Mathematical model for studying genetic variation in terms of restriction endonucleases.
Proc. Natl. Acad. Sci. USA
76:5269-5273[Abstract/Free Full Text].
|
| 38.
| Nold, S. C., and G. Zwart. Patterns and
governing forces in aquatic microbial communities. Aquat. Ecol.
32:17-35. (Review.)
|
| 39.
|
Ogram, A. V.,
G. S. Sayler, and T. T. Barkay.
1988.
The extraction and purification of microbial DNA from sediments.
J. Microbiol. Methods
7:57-66.
|
| 40.
|
Porter, K. G.,
H. Paerl,
R. Hodson,
M. Pace,
J. Priscu,
B. Riemann,
D. Scavia, and J. Stockner.
1988.
Microbial interactions in lake food webs, p. 209-227.
In
S. R. Carpenter (ed.), Complex interactions in lake communities. Springer-Verlag, New York, N.Y.
|
| 41.
|
Porter, K. G., and Y. S. Feig.
1980.
The use of DAPI for identifying and counting aquatic microflora.
Limnol. Oceanogr.
25:943-948.
|
| 42.
|
Proctor, L. M., and J. A. Fuhrman.
1990.
Viral mortality of marine bacteria and cyanobacteria.
Nature
343:60-62.
|
| 43.
|
Reichenbach, H.
1992.
The order Cytophagales, p. 3631-3675.
In
A. Balows, H. G. Truper, M. Dwokin, W. Harder, and K. M. Schleifer (ed.), The prokaryotes. Springer-Verlag, New York, N.Y.
|
| 44.
|
Reisser, W.
1993.
Viruses and virus-like particles of freshwater and marine eukaryotic algae a review.
Arch. Protistenkd.
143:257-265.
|
| 45.
|
Reysenbach, A.,
L. J. Giver,
G. S. Wickham, and N. R. Pace.
1992.
Differential amplification of rRNA genes by polymerase chain reaction.
Appl. Environ. Microbiol.
58:3417-3418[Abstract/Free Full Text].
|
| 46.
|
Rijkeboer, M.,
F. de Bles, and H. J. Gons.
1990.
Laboratory scale enclosure: concept, construction and operation.
J. Plankton Res.
12:231-244.
[Abstract/Free Full Text] |
| 47.
|
Suttle, C. A.
1994.
The significance of viruses to mortality in aquatic microbial communities.
Microb. Ecol.
28:237-243.
|
| 48.
|
Suttle, C. A., and A. M. Chan.
1994.
Dynamics and distribution of cyanophages and their effects on marine Synechococcus spp.
Appl. Environ. Microbiol.
60:3167-3174[Abstract/Free Full Text].
|
| 49.
|
Suttle, C. A.,
A. M. Chan, and M. T. Cottrell.
1990.
Infection of phytoplankton by viruses and reduction of primary productivity.
Nature
347:467-470.
|
| 50.
|
Teske, A.,
C. Wawer,
G. Muyzer, and N. B. Ramsing.
1996.
Distribution of sulfate-reducing bacteria in a stratified fjord (Mariager Fjord, Denmark) as evaluated by most-probable-number counts and denaturing gradient gel electrophoresis of PCR-amplified ribosomal DNA fragments.
Appl. Environ. Microbiol.
62:1405-1415[Abstract].
|
| 51.
| Van Boekel, W. H. M., F. C. Hansen, R. Riegman, and R. P. M. Bak. Lysis-induced decline of a
Phaeocystis spring bloom and coupling with the microbial foodweb. Mar.
Ecol. Prog. Ser. 81:269-276.
|
| 52.
| Van Hannen, E. J., M. Veninga, J. Bloem, H. J. Gons, and H. J. Laanbroek. Genetic changes in the bacterial
community structure associated with protistan grazers. Arch.
Hydrobiol., in press.
|
| 53.
|
Van Hannen, E. J.,
M. P. van Agterveld,
H. J. Gons, and H. J. Laanbroek.
1998.
Revealing genetic diversity of eukaryotic microorganisms in aquatic environments by denaturing gradient gel electrophoresis.
J. Phycol.
34:206-213.
|
| 54.
|
Weinbauer, M. G., and M. G. Hofle.
1998.
Significance of viral lysis and flagellate grazing as factors controlling bacterioplankton production in a eutrophic lake.
Appl. Environ. Microbiol.
64:431-438[Abstract/Free Full Text].
|
| 55.
|
Yufera, M., and N. Navarro.
1995.
Population growth dynamics of the rotifer Brachionus plicatilis cultured in non-limiting food conditions.
Hydrobiologia
313:399-405.
|
| 56.
|
Zwart, G.,
W. D. Hiorns,
B. A. Methé,
M. P. van Agterveld,
R. Huismans,
S. C. Nold,
J. P. Zehr, and H. J. Laanbroek.
1999.
Nearly identical 16S rRNA sequences recovered from lakes in North America and Europe indicate the existence of clades of globally distributed freshwater bacteria.
Syst. Appl. Microbiol.
21:546-556.
|
| 57.
|
Zwart, G.,
R. Huismans,
M. P. van Agterveld,
Y. Van de Peer,
P. De Rijk,
H. Eenhoorn,
G. Muyzer,
E. J. van Hannen,
H. J. Gons, and H. J. Laanbroek.
1998.
Divergent members of the bacterial division Verrucomicrobiales in a temperate freshwater lake.
FEMS Microbiol. Ecol.
25:159-169.
|
Applied and Environmental Microbiology, February 1999, p. 795-801, Vol. 65, No. 2
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Tian, C., Tan, J., Wu, X., Ye, W., Liu, X., Li, D., Yang, H.
(2009). Spatiotemporal transition of bacterioplankton diversity in a large shallow hypertrophic freshwater lake, as determined by denaturing gradient gel electrophoresis. J PLANKTON RES
0: fbp028v1-fbp028
[Abstract]
[Full Text]
-
Carrino-Kyker, S. R., Swanson, A. K.
(2008). Temporal and Spatial Patterns of Eukaryotic and Bacterial Communities Found in Vernal Pools. Appl. Environ. Microbiol.
74: 2554-2557
[Abstract]
[Full Text]
-
Golomidova, A., Kulikov, E., Isaeva, A., Manykin, A., Letarov, A.
(2007). The Diversity of Coliphages and Coliforms in Horse Feces Reveals a Complex Pattern of Ecological Interactions. Appl. Environ. Microbiol.
73: 5975-5981
[Abstract]
[Full Text]
-
Eiler, A., Bertilsson, S.
(2007). Flavobacteria Blooms in Four Eutrophic Lakes: Linking Population Dynamics of Freshwater Bacterioplankton to Resource Availability. Appl. Environ. Microbiol.
73: 3511-3518
[Abstract]
[Full Text]
-
Das, M., Royer, T. V., Leff, L. G.
(2007). Diversity of Fungi, Bacteria, and Actinomycetes on Leaves Decomposing in a Stream. Appl. Environ. Microbiol.
73: 756-767
[Abstract]
[Full Text]
-
Bongiorni, L., Magagnini, M., Armeni, M., Noble, R., Danovaro, R.
(2005). Viral Production, Decay Rates, and Life Strategies along a Trophic Gradient in the North Adriatic Sea. Appl. Environ. Microbiol.
71: 6644-6650
[Abstract]
[Full Text]
-
Pernthaler, J., Amann, R.
(2005). Fate of Heterotrophic Microbes in Pelagic Habitats: Focus on Populations. Microbiol. Mol. Biol. Rev.
69: 440-461
[Abstract]
[Full Text]
-
Simis, S. G. H., Tijdens, M., Hoogveld, H. L., Gons, H. J.
(2005). Optical changes associated with cyanobacterial bloom termination by viral lysis. J PLANKTON RES
27: 937-949
[Abstract]
[Full Text]
-
Tucker, S., Pollard, P.
(2005). Identification of Cyanophage Ma-LBP and Infection of the Cyanobacterium Microcystis aeruginosa from an Australian Subtropical Lake by the Virus. Appl. Environ. Microbiol.
71: 629-635
[Abstract]
[Full Text]
-
Massieux, B., Boivin, M. E. Y., van den Ende, F. P., Langenskiold, J., Marvan, P., Barranguet, C., Admiraal, W., Laanbroek, H. J., Zwart, G.
(2004). Analysis of Structural and Physiological Profiles To Assess the Effects of Cu on Biofilm Microbial Communities. Appl. Environ. Microbiol.
70: 4512-4521
[Abstract]
[Full Text]
-
Feris, K. P., Ramsey, P. W., Rillig, M., Moore, J. N., Gannon, J. E., Holben, W. E.
(2004). Determining Rates of Change and Evaluating Group-Level Resiliency Differences in Hyporheic Microbial Communities in Response to Fluvial Heavy-Metal Deposition. Appl. Environ. Microbiol.
70: 4756-4765
[Abstract]
[Full Text]
-
Huber, F., Peduzzi, P.
(2004). Online Tool for Analysis of Denaturing Gradient Gel Electrophoresis Profiles. Appl. Environ. Microbiol.
70: 4390-4392
[Abstract]
[Full Text]
-
Geiss, U., Bergmann, I., Blank, M., Schumann, R., Hagemann, M., Schoor, A.
(2003). Detection of Prochlorothrix in Brackish Waters by Specific Amplification of pcb Genes. Appl. Environ. Microbiol.
69: 6243-6249
[Abstract]
[Full Text]
-
Eiler, A., Langenheder, S., Bertilsson, S., Tranvik, L. J.
(2003). Heterotrophic Bacterial Growth Efficiency and Community Structure at Different Natural Organic Carbon Concentrations. Appl. Environ. Microbiol.
69: 3701-3709
[Abstract]
[Full Text]
-
Lee, L., Saxena, D., Stotzky, G.
(2003). Activity of Free and Clay-Bound Insecticidal Proteins from Bacillus thuringiensis subsp. israelensis against the Mosquito Culex pipiens. Appl. Environ. Microbiol.
69: 4111-4115
[Abstract]
[Full Text]
-
Calvo-Bado, L. A., Pettitt, T. R., Parsons, N., Petch, G. M., Morgan, J. A. W., Whipps, J. M.
(2003). Spatial and Temporal Analysis of the Microbial Community in Slow Sand Filters Used for Treating Horticultural Irrigation Water. Appl. Environ. Microbiol.
69: 2116-2125
[Abstract]
[Full Text]
-
Crump, B. C., Kling, G. W., Bahr, M., Hobbie, J. E.
(2003). Bacterioplankton Community Shifts in an Arctic Lake Correlate with Seasonal Changes in Organic Matter Source. Appl. Environ. Microbiol.
69: 2253-2268
[Abstract]
[Full Text]
-
Morris, C. E., Bardin, M., Berge, O., Frey-Klett, P., Fromin, N., Girardin, H., Guinebretiere, M.-H., Lebaron, P., Thiery, J. M., Troussellier, M.
(2002). Microbial Biodiversity: Approaches to Experimental Design and Hypothesis Testing in Primary Scientific Literature from 1975 to 1999. Microbiol. Mol. Biol. Rev.
66: 592-616
[Abstract]
[Full Text]
-
Muylaert, K., Van der Gucht, K., Vloemans, N., Meester, L. D., Gillis, M., Vyverman, W.
(2002). Relationship between Bacterial Community Composition and Bottom-Up versus Top-Down Variables in Four Eutrophic Shallow Lakes. Appl. Environ. Microbiol.
68: 4740-4750
[Abstract]
[Full Text]
-
Becker, S., Fahrbach, M., Boger, P., Ernst, A.
(2002). Quantitative Tracing, by Taq Nuclease Assays, of a Synechococcus Ecotype in a Highly Diversified Natural Population. Appl. Environ. Microbiol.
68: 4486-4494
[Abstract]
[Full Text]
-
Diez, B., Pedros-Alio, C., Marsh, T. L., Massana, R.
(2001). Application of Denaturing Gradient Gel Electrophoresis (DGGE) To Study the Diversity of Marine Picoeukaryotic Assemblages and Comparison of DGGE with Other Molecular Techniques. Appl. Environ. Microbiol.
67: 2942-2951
[Abstract]
[Full Text]
-
Yang, C.-H., Crowley, D. E., Borneman, J., Keen, N. T.
(2001). Microbial phyllosphere populations are more complex than previously realized. Proc. Natl. Acad. Sci. USA
98: 3889-3894
[Abstract]
[Full Text]
-
Davey, M. E., O'toole, G. A.
(2000). Microbial Biofilms: from Ecology to Molecular Genetics. Microbiol. Mol. Biol. Rev.
64: 847-867
[Abstract]
[Full Text]
-
ben Omar, N., Ampe, F.
(2000). Microbial Community Dynamics during Production of the Mexican Fermented Maize Dough Pozol. Appl. Environ. Microbiol.
66: 3664-3673
[Abstract]
[Full Text]
-
Dahllöf, I., Baillie, H., Kjelleberg, S.
(2000). rpoB-Based Microbial Community Analysis Avoids Limitations Inherent in 16S rRNA Gene Intraspecies Heterogeneity. Appl. Environ. Microbiol.
66: 3376-3380
[Abstract]
[Full Text]
-
Wommack, K. E., Colwell, R. R.
(2000). Virioplankton: Viruses in Aquatic Ecosystems. Microbiol. Mol. Biol. Rev.
64: 69-114
[Abstract]
[Full Text]
-
Riemann, L., Steward, G. F., Azam, F.
(2000). Dynamics of Bacterial Community Composition and Activity during a Mesocosm Diatom Bloom. Appl. Environ. Microbiol.
66: 578-587
[Abstract]
[Full Text]
-
MacNaughton, S. J., Stephen, J. R., Venosa, A. D., Davis, G. A., Chang, Y.-J., White, D. C.
(1999). Microbial Population Changes during Bioremediation of an Experimental Oil Spill. Appl. Environ. Microbiol.
65: 3566-3574
[Abstract]
[Full Text]
-
van Hannen, E. J., Mooij, W., van Agterveld, M. P., Gons, H. J., Laanbroek, H. J.
(1999). Detritus-Dependent Development of the Microbial Community in an Experimental System: Qualitative Analysis by Denaturing Gradient Gel Electrophoresis. Appl. Environ. Microbiol.
65: 2478-2484
[Abstract]
[Full Text]