Previous Article | Next Article 
Applied and Environmental Microbiology, March 1999, p. 1127-1132, Vol. 65, No. 3
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Diversity of Dissimilatory Bisulfite Reductase
Genes of Bacteria Associated with the Deep-Sea Hydrothermal Vent
Polychaete Annelid Alvinella pompejana
Matthew T.
Cottrell and
S. Craig
Cary*
College of Marine Studies, University of
Delaware, Lewes, Delaware 19958
Received 29 September 1998/Accepted 23 December 1998
 |
ABSTRACT |
A unique community of bacteria colonizes the dorsal integument of
the polychaete annelid Alvinella pompejana, which inhabits the high-temperature environments of active deep-sea hydrothermal vents
along the East Pacific Rise. The composition of this bacterial community was characterized in previous studies by using a 16S rRNA
gene clone library and in situ hybridization with oligonucleotide probes. In the present study, a pair of PCR primers (P94-F and P93-R)
were used to amplify a segment of the dissimilatory bisulfite reductase
gene from DNA isolated from the community of bacteria associated with
A. pompejana. The goal was to assess the presence and
diversity of bacteria with the capacity to use sulfate as a terminal
electron acceptor. A clone library of bisulfite reductase gene PCR
products was constructed and characterized by restriction fragment and
sequence analysis. Eleven clone families were identified. Two of the 11 clone families, SR1 and SR6, contained 82% of the clones. DNA sequence
analysis of a clone from each family indicated that they are
dissimilatory bisulfite reductase genes most similar to the
dissimilatory bisulfite reductase genes of Desulfovibrio vulgaris, Desulfovibrio gigas, Desulfobacterium
autotrophicum, and Desulfobacter latus. Similarities
to the dissimilatory bisulfite reductases of
Thermodesulfovibrio yellowstonii, the sulfide oxidizer Chromatium vinosum, the sulfur reducer
Pyrobaculum islandicum, and the archaeal sulfate reducer
Archaeoglobus fulgidus were lower. Phylogenetic analysis
separated the clone families into groups that probably represent two
genera of previously uncharacterized sulfate-reducing bacteria. The
presence of dissimilatory bisulfite reductase genes is consistent
with recent temperature and chemical measurements that documented
a lack of dissolved oxygen in dwelling tubes of the worm. The diversity
of dissimilatory bisulfite reductase genes in the bacterial community
on the back of the worm suggests a prominent role for anaerobic
sulfate-reducing bacteria in the ecology of A. pompejana.
| |
INTRODUCTION |
Alvinella pompejana is a
polychaete annelid that inhabits high-temperature environments of
active deep-sea hydrothermal vents along the East Pacific Rise
(14). Colonies of this worm and a congener, Alvinella
caudata, are found on the sides of black smoker chimneys, where
hydrothermal fluids emit at temperatures near 350°C. The worms
live in areas of steep chemical and thermal gradients where
hydrothermal fluids move through the chimney wall and mix with
the surrounding seawater (15, 16), creating a temperature
gradient of maximally 60°C (9). The physiological and
biochemical adaptations allowing the worm to thrive under extreme
conditions not normally tolerated by eukaryotes are unknown.
The worm's dorsal integument is covered by a diverse community of
bacteria dominated by conspicuous filamentous members of the epsilon
group of the class Proteobacteria (8, 18).
Earlier culture efforts revealed a community composed of both aerobes and facultative anaerobes (25), sulfur oxidizers, sulfate
reducers, nitrifiers, nitrate respirers, denitrifiers, and nitrogen
fixers. Characteristics common to many of these isolates are resistance to cadmium, zinc, arsenate, and silver and tolerance of high
concentrations of copper (21).
The role of epibiotic bacterial symbionts in the ecology of the host
worm is not clear. A nutritional role analogous to the symbiotic
associations between chemoautotrophic bacteria and other invertebrate
hosts (10, 11) has been proposed, but there is little
evidence of chemoautotrophy (CO2 fixation) (2).
It has also been suggested that the symbionts detoxify the worm's
immediate environment of metals and hydrogen sulfide (2).
Our primary goal is to understand the interaction between A. pompejana and its associated bacteria by identifying the
abundant bacterial epibionts and their metabolic capacities. In
this study, we explored the diversity of a gene involved in the
anaerobic respiratory metabolism of sulfur, because the worm's
environment contains abundant sulfur and little dissolved oxygen.
Dissimilatory bisulfite reductase is the terminal redox enzyme that
catalyzes the reduction of sulfite to sulfide during anaerobic
respiratory sulfate reduction. Prokaryotic dissimilatory bisulfite
reductases have an 
2
2 or
22
2 structure (4, 12,
24) and possess iron-sulfur clusters and siroheme
prosthetic groups. This is the key enzyme involved in sulfate
respiration and was probably utilized by the common ancestors of
bacteria and archaea (31).
| |
MATERIALS AND METHODS |
Animal collection.
Specimens of A. pompejana were
collected from active vent sites designated 13°N (12°48'N,
103°56'W) and 9°N (9°50'N, 104°17'W) on the East Pacific Rise
at a depth of approximately 2,620 m in November of 1994 and 1995. Animals were collected by the deep-submergence vehicle Alvin
and held in an insulated container which maintained the collection at
<5°C until surfacing. Once on board, specimens were held at 2°C
until they were sampled for bacteria and nucleic acids as described below.
DNA purification.
Bacteria were aseptically removed from the
dorsal surface of freshly collected A. pompejana for DNA
purification. Forceps cleaned with 70% ethanol were used to remove
approximately 50-µl tufts of hair-like projections covered with
bacteria. Bacteria were homogenized in 1 ml of 5 M guanidine
thiocyanate-50 mM Tris-HCl (pH 7.4)-25 mM EDTA-0.8%
2-mercaptoethanol. A brief centrifugation was performed to remove the
bulk of the mineral grains, and the homogenates were stored at 
80°C
until DNA extraction was performed in the laboratory. Aliquots (100 µl) of the thawed homogenates were incubated for 1 h with 25 µl of 20% Chelex 100 (32) while being mixed on a rotating
wheel. Following a brief centrifugation to remove the Chelex 100, total
nucleic acids were extracted with the IsoQuick nucleic acid extraction
kit (ORCA Research, Inc., Bothel, Wash.). In accordance with the
manufacturer's instructions, the first extraction was performed at
65°C for 10 min, and the second extraction was done at room
temperature. The nucleic acids were concentrated by isopropanol
precipitation and quantified spectrophotometrically.
PCR.
Deoxyoligonucleotide primers (P94-F and P93-R) were
designed by Karkhoff-Schweizer et al. (22) on the basis of
nucleotide sequence similarities between the Archaeoglobus
fulgidus and Desulfovibrio vulgaris dissimilatory
bisulfite reductase genes. The forward primer, P94-F
[5'-ATCGG(A/T)ACCTGGAAGGA(C/T)GACATCAA], and the reverse
primer, P93-R [5'-GGGCACAT(G/C)GTGTAGCAGTTACCGCA],
hybridized at nucleotide positions 943 to 968 and 2347 to 2372, respectively, of the dissimilatory bisulfite reductase gene of
D. vulgaris (GenBank accession no. U16723). The
reaction mixtures contained approximately 7 ng of template DNA per
µl, 1 mM (each) the four deoxynucleoside triphosphates (dTTP, dCTP,
dGTP, and dATP), 1.25 mM MgCl2, 1 µM (each) primer, and
2.5 U of Taq DNA polymerase (Promega) in a total reaction
volume of 20 µl. The thermocycling was performed by using a
RoboCycler gradient 96 thermocycler (Stratagene, La Jolla, Calif.) with
thermocycling conditions including 1.5 min of denaturation at 94°C,
2.5 min of primer annealing at 60°C, and 3 min of primer extension at
72°C. This cycle was repeated 30 times. A hot start (13)
was performed by warming the reaction mixtures to 95°C before adding
the primers and Taq DNA polymerase.
Clone library construction and screening.
PCR products
obtained from two A. pompejana specimens collected at
9°N and 13°N were cloned by using the TA cloning kit with pCR II
vector (Invitrogen, San Diego, Calif.) in accordance with the
manufacturer's instructions. Approximately 200 hundred recombinants were screened for full-size inserts (approximately 1.4 kb) by transferring small aliquots of cells to PCR mixtures containing the
bisulfite reductase primers and thermocycling under the same conditions
described above. Colonies that did not produce amplifications were
eliminated from the library. The PCR products, which were all
approximately 1.4 kb, were cut with the restriction endonuclease MboI. The restriction fragments were resolved by agarose gel
electrophoresis with 3% NuSieve (FMC, Rockland, Maine) agarose. Clones
with identical restriction patterns were grouped together into clone families.
Nucleotide sequencing.
Nucleotide sequencing was performed
with a Perkin-Elmer (Foster City, Calif.) ABI PRISM 310 genetic
analyzer and an ABI PRISM dye termination cycle sequencing ready
reaction kit with Ampli Taq DNA polymerase, FS in accordance
with the manufacturer's instructions. Double-stranded DNA templates
were prepared according to the manufacturer's alkaline-lysis and
polyethylene glycol precipitation protocols. Sequencing primers M13
forward or reverse were used to sequence in from the cloning vector
depending on the orientation of the cloned PCR product. The sequencing
of complementary strands was performed with primers SFITE450AR
(AGGCCCTGACGCTTCATCAG) and SFITE471AR (TAACGCTCAGGAAGGTGGGC) for clone families SR1, -2, -4, -5, -7, and -8 and SR3, -6, -9, -10, and -11, respectively. These primers bind to positions 450 and 471 nucleotides into the PCR products numbered with the clone representing SR2 as a reference. Approximately 500 nucleotides were sequenced for each strand. The sequences were
initially analyzed by a search of all nonredundant GenBank CDS
translations, PDB, SwissProt, and PIR databases by using the Basic
Local Alignment Search Tool (BLAST) (3).
Phylogenetic analysis of nucleotide sequences.
An alignment
of the deduced protein sequences of the open reading frames was made
using the CLUSTAL function of Sequence Navigator version V. 1.0.1 (Perkin-Elmer) was and refined by eye. The phylogenetic analysis
was performed with the SEQBOOT, PROTDIST, NEIGHBOR, and CONSENSUS programs in PHYLIP version 3.527.
| |
RESULTS AND Discussion |
Occurrence of dissimilatory bisulfite reductase genes.
We
investigated the presence of dissimilatory bisulfite reductase genes in
the microbial community on the dorsal surface of A. pompejana, because preliminary data suggested that this habitat is
high temperature, anoxic, and rich in potential electron acceptors, e.g., sulfate (9, 17). Since the chemical and physical
environment will dictate the specific physiological capability of the
bacteria, it was logical to investigate genes involved in the anaerobic respiration of sulfate. We used primers previously shown to be very
effective with known sulfate reducers from the genera
Desulfovibrio, Desulfobulbus, and
Desulfobacter (22).
Genes encoding dissimilatory bisulfite reductase were detected in every
DNA sample isolated from microbes on the dorsal surface of
A. pompejana (Fig. 1).
Amplifications were obtained from both the anterior and posterior
dorsal surfaces of A. pompejana collected at both
13°N and 9°N on the East Pacific Rise. The amplicons were approximately the size generated in control amplifications of the
dissimilatory bisulfite reductase gene of D. vulgaris
(1.4 kb) (22). On agarose gels, the amplification products
typically appeared as two closely spaced bands. The
higher-molecular-weight band was slightly larger than the 1.4-kb
amplicon produced from D. vulgaris.
View larger version (67K):
[in this window]
[in a new window]
|
FIG. 1.
Agarose gel of PCR amplification products generated by
using primers (P94-F and P95-R) for dissimilatory bisulfite reductase
genes. Template DNA was isolated from the epibiotic microbial community
on the dorsal surface of A. pompejana (lanes 1 to 11)
and from the pRKS72 plasmid that contains the dsvA and
-B genes (dissimilatory bisulfite reductase of D. vulgaris) (22). A. pompejana specimens
were collected from 13°N (lanes 1 to 5) and 9°N (lanes 6 to 11) of
the East Pacific Rise. The microbial communities located on the
anterior (ant [lanes 1 and 2 and 6 to 8]) and posterior (post [lanes
3 to 5 and 9 to 11]) of A. pompejana specimens were
assayed separately. The dsv amplification product is 1.4 kb
(22). The image was prepared with Adobe Photoshop.
|
|
Clone library construction and characterization.
A clone
library of PCR products was used to explore the diversity of
dissimilatory bisulfite reductase genes of the bacteria on the dorsal
surface of A. pompejana. The library consisted of clones from two PCR products enriched in the high- and
low-molecular-weight bands, respectively (Fig. 1). The library
contained 154 clones that were assembled into 11 clone families based
on MboI restriction fragment banding patterns (Fig.
2). The library was dominated by clone
families SR1 and SR6, which together accounted for 82% of the clones
(Table 1). Clone families SR1 and
SR6 were detected exclusively in libraries of the lower- and
higher-molecular-weight PCR products, respectively. The balance of the
library was composed of nine families obtained from both the high- and
low-molecular-weight PCR products, which each contained 5% or fewer of
the clones.
View larger version (79K):
[in this window]
[in a new window]
|
FIG. 2.
Agarose gel of the MboI restriction patterns
of the 11 clone families identified in the clone library of
dissimilatory bisulfite reductase gene fragments amplified from the
A. pompejana epibiotic bacterial community. The image
was prepared with Adobe Photoshop.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Abundance of clone families in the library of bisulfite
reductase gene fragments amplified by PCR from the microbial community
associated with the dorsal surface of A. pompejana
|
|
Comparative sequence analysis of dissimilatory bisulfite reductase
gene amplicons.
Comparative sequence analysis revealed high
similarity between the clone families and the alpha subunits of
dissimilatory bisulfite reductases. The BLASTP program
(3) produced statistically significant alignments of the 11 clone families with every dissimilatory bisulfite reductase alpha
subunit in the database (nonredundant GenBank CDS translations, PDB,
SwissProt, SPupdate, and PIR sequences [release date 6 May 1998]).
For example, alignments of clone family SR1 had the smallest sum
probabilities, ranging from 2.3 × 10
58 to 8.6 × 104. The alignment with the D. vulgaris alpha subunit contained 85 identical amino acids out of
the 112 in the alignment and had the smallest probability of occurring
by chance alone. The most significant alignment with a gene other than
a dissimilatory bisulfite reductase was made with the polyferredoxin
gene of Methanococcus voltae (smallest sum probability,
0.022) and likely occurred by chance alone.
The similarity of the 5' end of the amplicons with the alpha subunits
of dissimilatory bisulfite reductase genes was consistent
with binding
of primer P94-F to a region of the operon coding
for the alpha subunit
in
D. vulgaris and
A. fulgidus
(
22). However,
a significant alignment with the beta subunit
would not have been
unexpected. The genes coding for the two subunits
of dissimilatory
bisulfite reductase evolved by the duplication of a
common ancestral
gene and therefore contain segments of statistically
significant
nucleotide and amino acid similarity (
19).
The 11 clone families were most similar to the dissimilatory bisulfite
reductases of bacterial sulfate reducers. A CLUSTAL
alignment of the
conceptual translations of the 11 clone families
with the alpha
subunits of the dissimilatory bisulfite reductases
of
D. vulgaris,
Desulfovibrio gigas,
Desulfobacterium
autotrophicum,
Desulfobacter latus,
Desulfotomaculum ruminis,
Thermodesulfovibrio yellowstonii,
Archeoglobus fulgidus,
Chromatium
vinosum, and
Pyrobaculum islandicum contained regions
of high conservation interspersed
with regions of variability (Fig.
3). The similarity (percent
identical
aligned amino acids) between the clone families and
the bacterial
sulfate reducers
D. vulgaris,
D. gigas,
D. autotrophicum,
and
D. latus ranged
from 60.4 to 75.0%. The similarities to
T. yellowstonii
(thermophilic bacterial sulfate reducer),
A. fulgidus (an archaeal sulfate reducer), and
C. vinosum (a sulfur
oxidizer)
were lower (41.7 to 46.9%, 53.1 to 63.5%, and 44.8 to
47.9%, respectively).
The clone families had very little similarity to
an archaeal sulfur
reducer,
P. islandicum (25.0 to 29.2%
similar).
View larger version (107K):
[in this window]
[in a new window]
|
FIG. 3.
Alignment of conceptual translations of the 11 clone
families with the homologous region of the gene coding for the alpha
subunit of the dissimilatory bisulfite reductases of D. vulgaris, D. gigas, Desulfobacterium
autotrophicum, A. fulgidus, C. vinosum, and P. islandicum. Approximately 390 nucleotides from the 5' end of each clone is represented. The alignment
was made by using CLUSTAL. The boxes indicate identity greater than or
equal to 65%, and dashes indicate gaps in the alignment.
|
|
Inspection of the alignment revealed two groups consisting of clone
families SR1, SR2, SR4, SR5, and SR8 and SR3, SR6, SR9,
SR10, and SR11,
respectively. Similarity within these two groups
ranged from 87.5 to
100%, while similarity between members of
these groups ranged from
62.5 to 68.7%. Similarities within the
two groups were at the high end
of this range (87.5 to 100%),
and similarities between members of the
two groups were lower
(62.5 to 68.7%). Clone families that were
identical at the amino
acid level were 99.1 to 100% similar at the
nucleotide level.
For example, clone families SR10 and SR11 had
identical nucleotide
sequences over 287 bases at the 5' end of the
insert, but different
restriction digest patterns of these two clone
families indicated
sequence variation elsewhere in the gene (Fig.
2).
A phylogenetic tree drawn with the neighbor-joining algorithm contained
two clades of bisulfite reductase clone families supported
by bootstrap
values of 99 that were clearly separate from previously
described
sulfate-reducing bacteria (Fig.
4). Two
Desulfovibrio species formed another well-supported clade
(bootstrap value of
76) separate from the clade containing
D. latus and
D. autotrophicum (bootstrap value of 96). There is probably some relationship between
the similarity of dissimilatory bisulfite reductase genes and
conventional taxonomic descriptors (i.e., genus, species, etc.),
because there is a high degree of similarity between the evolutionary
relationships inferred from 16S rRNA and dissimilatory bisulfite
reductase genes (
31). The two clades comprised of clone
families
probably represent two previously uncharacterized genera
of sulfate-reducing
bacteria, because similarities between these two
clades (62.5
to 68.7%) were lower than the similarities
between species within
the genus
Desulfovibrio (79.2%).
Amino acid identity between sequences
of the clone families and
sequences reported by Wagner et al.
(
31) were typically less
than 77%, supporting the idea that
they represent previously
uncharacterized sulfate-reducing bacteria.
The partial sequences
from these organisms were not included in
the phylogenetic tree due to
the small overlap with the region
of the gene sequenced for the clone
families. The high similarity
between clone families within clades
(greater than 87.5%) suggests
that they are phylotypes more closely
related than genera.
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
Dendrogram showing the relationships among the 11 clone
families of dissimilatory bisulfite reductase genes and the alpha
subunits of the dissimilatory bisulfite reductase genes of
D. vulgarus, D. gigas, D. autotrophicum, A. fulgidus, C. vinosum, and P. islandicum. The analysis was made by
using the neighbor-joining algorithm and 107 positions of aligned
conceptual translations. The consensus of 100 bootstrap resamplings is
shown with bootstrap values adjacent to the nodes.
|
|
The clade containing
C. vinosum,
P. islandicum,
A. fulgidus, and
T. yellowstonii was not well supported in this analysis,
because
the amount of variation was not suited to the great evolutionary
distances separating these genera. The dissimilatory bisulfite
reductases of
P. islandicum,
A. fulgidus,
and
C. vinosum are true
homologs (
19) and
seem to have evolved from a common ancestral
protein that divided into
three independent lineages prior to
the divergence of archaea and
bacteria (
23). The highly conserved
siroheme-binding region
of the gene that revealed this relationship
is outside the portion of
the gene amplified by primers P94-F
and P93-R used in this
study.
The primers designed by Karkhoff-Schweizer et al. (
22) used
in this study may have produced a conservative measure of the
diversity
of genes for dissimilatory bisulfite reductase, because
they were
designed solely with the highly conserved regions of
archaeal and
bacterial genes. Modified versions of these primers
based on the
alignment of a larger number of sequences suggested
by Wagner et al.
(
31) might reveal equal or greater diversity.
Nevertheless,
the diversity of dissimilatory bisulfite reductase
genes we found
suggests a role for anaerobic sulfate-reducing
bacteria in the ecology
of
A. pompejana.
Implications.
Sulfate-reducing bacteria are able to use a
broad range of compounds as electron donors (6), but which
ones are used by the sulfate-reducing bacteria associated with
A. pompejana is not clear. Utilization of lactate and
pyruvate is almost universal among the sulfate reducers (6),
and many species that oxidize energy sources incompletely to
excreted acetate can utilize malate, formate, and certain primary
alcohols. Those capable of complete oxidation can oxidize electron
donors, such as fatty acids, lactate, succinate, and benzoate.
These compounds are end products of the hydrolysis and
fermentation of complex polymeric compounds which are likely produced
by other members of the microbial community utilizing materials
produced by the worm (e.g., mucus, hair-like projections, and the
dwelling tube are all likely candidates).
In addition to heterotrophic growth on the by-products of fermentation,
certain sulfate-reducing bacteria are capable of autotrophic
growth
with CO
2 as the sole carbon source, H
2 as the
electron
donor, and sulfate as the electron acceptor. Carbon fixation
by
bacteria associated with
Alvinella would be necessary if
grazing
by the worm on these bacteria is to make a net contribution to
its nutrition (
2). There is some evidence of bicarbonate
uptake
by bacteria associated with
A. pompejana
(
1), but the low level
of activity of the carbon-fixing
enzyme ribulose bisphosphate
carboxylase has cast doubt on the
importance of autotrophy (
1,
29). Nevertheless, the
potential importance of autotrophy in
the microbial community
associated with
Alvinella remains open,
because autotrophic
sulfate-reducing bacteria fix carbon by using
the acetyl-coenzyme A
pathway exclusive of ribulose bisphosphate
carboxylase (
6).
It is unclear which bacterial morphotypes associated with the worm are
sulfate reducers. Comparative sequence analysis indicated
that the
dominant 16S rRNA clone families are aligned with members
of the
epsilon group of
Proteobacteria (
18), and in situ
hybridization
revealed that these phylotypes are of the filamentous
morphotype
that dominates the community (
8). Affiliation of
the filaments
with the epsilons suggests that they may not be sulfate
reducers,
because no cultivated members of the epsilon group of
Proteobacteria are known to reduce sulfate. Sulfate-reducing
bacteria come from
many taxonomic groups, including the
Nitrospira division, the
Thermodesulfobacterium
division, and the gram-positive group,
and there is one archaeal
representative, but most are members
of the delta group of
Proteobacteria (
6), a group from which
the
epsilon subdivision was only recently separated (
26). It
may
be possible to resolve which morphotypes are sulfate reducers
without
cultivation by using in situ PCR (
20,
27) and fluorescence
microscopy to localize dissimilatory bisulfite reductase genes
within
individual cells comprising the
community.
There is growing evidence for interactions between bacterial and
geological processes at deep-sea hydrothermal vents. The
role that
Alvinella spp. and their associated bacteria play in
altering the growth and morphology of sulfide chimneys is not
clear,
but a strong influence is indicated. Where colonies of
Alvinella spp. occur on the East Pacific Rise, there exist
particular
morphological types of chimneys known as white smokers or
snowball
diffusers which are colonized by the
Alvinella spp.
Elsewhere
on the East Pacific Rise, where
Alvinella spp. are
absent, these
chimney morphologies are absent as well, even though the
chemistries
of the vent fluids are similar (
7,
28,
30). It
has been
postulated that sulfate-reducing bacteria associated with
Alvinella spp. might play a role in the physical cementing
of
Alvinella dwelling tubes to smoker rocks (
5).
Understanding the interaction between
A. pompejana and
its associated microbes requires identification of the abundant members
of the community and the major metabolic capacities present. In
this
study, we established that at least two phylotypes (probably
separate
genera) of previously uncharacterized dissimilatory sulfate
reducers
are present in the community. The impact of sulfate-reducing
members of
the community and their interaction with the worm remain
to be
determined. Links with polymer-hydrolyzing and fermentative
members of
the community and an autotrophic role for these sulfate
reducers are
anticipated.
| |
ACKNOWLEDGMENTS |
We thank the captain and crew of the Atlantis II and
pilots of the deep-submergence vehicle Alvin for
facilitating the collection of the samples used in this study. Gerrit
Voordouw graciously provided the plasmid containing the dsv
gene, and Robert Feldman provided thoughtful insight.
This research was supported by grants from the National Science
Foundation to S. C. Cary (OCE-9314594 and OCE-9596082) and through a NATO Collaborative Research grant.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: College of
Marine Studies, University of Delaware, Lewes, DE 19958. Phone: (302)
645-4078. Fax: (302) 645-4007. E-mail: caryc{at}udel.edu.
| |
REFERENCES |
| 1.
|
Alayse-Danet, A. M.,
F. Gaill, and D. Desbruyeres.
1986.
In situ bicarbonate uptake by bacteria-Alvinella associations.
Mar. Ecol.
7:233-240.
|
| 2.
|
Alayse-Danet, A. M.,
D. Desbruyeres, and F. Gaill.
1987.
The possible nutritional or detoxification role of the epibiotic bacteria of Alvinellid polychaetes: review of current data.
Symbiosis
4:51-62.
|
| 3.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[Medline].
|
| 4.
|
Arendsen, A. F.,
M. Verhagen,
R. B. G. Wolbert,
A. J. Pierik,
A. J. M. Stams,
M. S. M. Jetten, and W. R. Hagen.
1993.
The dissimilatory sulfite reductase from Desulfosarcina variabilis is a desulforubidin containing uncoupled metalated sirohemes and S = 9/2 iron-sulfur clusters.
Biochemistry
32:10323-10330[Medline].
|
| 5.
|
Baross, J. A., and J. W. Deming.
1985.
The role of bacteria in the ecology of black-smoker environments.
Bull. Biol. Soc. Wash.
6:355-371.
|
| 6.
|
Brock, T. D., and M. T. Madigan.
1991.
Biology of microorganisms, 6th ed.
Prentice Hall, Englewood Cliffs, N.J.
|
| 7.
|
Butterfield, D. A.,
G. J. Massoth,
R. E. McDuff,
J. E. Lupton, and M. D. Lilley.
1990.
Geochemistry of hydrothermal fluids from axial seamount hydrothermal emissions study vent field, Juan-De-Fuca Ridge subseafloor boiling and subsequent fluid-rock interaction.
J. Geophys. Res. Solid Earth and Planets
95:12895-12921.
|
| 8.
|
Cary, S. C.,
M. T. Cottrell,
J. L. Stein,
F. Camacho, and D. Desbruyeres.
1997.
Molecular identification and localization of filamentous symbiotic bacteria associated with the hydrothermal vent annelid Alvinella pompejana.
Appl. Environ. Microbiol.
63:1124-1130[Abstract].
|
| 9.
|
Cary, S. C.,
T. Shank, and J. Stein.
1998.
Worms bask in extreme temperatures.
Nature
391:545-546.
|
| 10.
|
Cavanaugh, C. M.,
S. L. Gardiner,
M. L. Jones,
H. W. Jannasch, and J. B. Waterbury.
1981.
Prokaryotic cells in the hydrothermal vent tube worm Riftia pachyptila Jonespossible chemoautotrophic symbionts.
Science
213:340-342[Abstract/Free Full Text].
|
| 11.
|
Cavanaugh, C. M.
1985.
Symbioses of chemoautotrophic bacteria and marine invertebrates from hydrothermal vents and reducing sediments.
Bull. Biol. Soc. Wash.
6:373-388.
|
| 12.
|
Dahl, C.,
N. M. Kredich,
R. Deutzmann, and H. G. Truper.
1993.
Dissimilatory sulfite reductase from Archaeoglobus fulgidusphysicochemical properties of the enzyme and cloning, sequencing and analysis of the reductase genes.
J. Gen. Microbiol.
139:1817-1828[Abstract/Free Full Text].
|
| 13.
|
Daquila, R. T.,
L. J. Bechtel,
J. A. Videler,
J. J. Eron,
P. Gorczyca, and J. C. Kaplan.
1991.
Maximizing sensitivity and specificity of PCR by preamplification heating.
Nucleic Acids Res.
19:3749[Free Full Text].
|
| 14.
|
Desbruyeres, D., and L. Laubier.
1980.
Alvinella pompejana gen. sp. nov., aberrant Ampharetidae from East Pacific Rise hydrothermal vents.
Oceanol. Acta
3:267-274.
|
| 15.
|
Desbruyeres, D., and L. Laubier.
1985.
Les Alvinellidae, une falle nouvelle d'annelides polychetes infeodees aux sources hydrothermales sous-marines: systematique, biologie et ecologie.
Can. J. Zool.
64:2227-2245.
|
| 16.
|
Desbruyeres, D.,
F. Gaill,
L. Laubier,
D. Prieur, and G. H. Rau.
1983.
Unusual nutrition of the "Pompeii worm" Alvinella pompejana (polychaetous annelid) from a hydrothermal vent environment: SEM, TEM, 13C, and 15N evidence.
Mar. Biol.
75:201-205.
|
| 17.
| DiMeo, C. A., and S. C. Cary. Unpublished data.
|
| 18.
|
Haddad, A.,
F. Camacho,
P. Durand, and S. C. Cary.
1995.
Phylogenetic characterization of the epibiotic bacteria associated with the hydrothermal vent polychaete Alvinella pompejana.
Appl. Environ. Microbiol.
61:1679-1687[Abstract].
|
| 19.
|
Hipp, W. M.,
A. S. Pott,
N. Thum-Schmitz,
I. Faath,
C. Dahl, and H. G. Truper.
1997.
Towards the phylogeny of APS reductases and sirohaem sulfite reductases in sulfate-reducing and sulfur-oxidizing prokaryotes.
Microbiology
143:2891-2902[Abstract/Free Full Text].
|
| 20.
|
Hodson, R. E.,
W. A. Dustman,
R. P. Garg, and M. A. Moran.
1995.
In situ PCR for visualization of microscale distribution of specific genes and gene products in prokaryotic communities.
Appl. Environ. Microbiol.
61:4074-4082[Abstract].
|
| 21.
|
Jeanthon, C., and D. Prieur.
1990.
Susceptibility to heavy metals and characterization of heterotrophic bacteria isolated from two hydrothermal vent polychaete annelids, Alvinella pompejana and Alvinella caudata.
Appl. Environ. Microbiol.
56:3308-3314[Abstract/Free Full Text].
|
| 22.
|
Karkhoff-Schweizer, R.,
D. P. W. Huber, and G. Voordouw.
1995.
Conservation of the genes for dissimilatory sulfite reductase from Desulfovibrio vulgaris and Archaeoglobus fulgidus allows their detection by PCR.
Appl. Environ. Microbiol.
61:290-296[Abstract].
|
| 23.
|
Molitor, M.,
C. Dahl,
I. Schafer,
N. Speich,
R. Huber,
R. Deutzmann, and H. G. Truper.
1998.
A dissimilatory sirohaem-sulfite-reductase-type protein from the hyperthermophilic archaeon, Pyrobaculum islandicum.
Microbiology
144:529-541[Abstract/Free Full Text].
|
| 24.
|
Pierik, A. J.,
M. G. Duyvis,
J. Vanhelvoort,
B. G. Wolbert, and W. R. Hagen.
1992.
The 3rd subunit of desulfoviridin-type dissimilatory sulfite reductases.
Eur. J. Biochem.
205:111-115[Medline].
|
| 25.
|
Prieur, D.,
S. Chamroux,
P. Durand,
G. Erauso,
P. Fera,
C. Jeanthon,
L. Le Borgne, and G. Mevel.
1990.
Metabolic diversity in epibiotic microflora associated with the Pompeii worms Alvinella pompejana and A. caudata (Polychaetae: Annelida) from deep-sea hydrothermal vents.
Mar. Biol.
106:361-367.
|
| 26.
|
Rainey, F. A.,
R. Toalster, and E. Stackebrandt.
1993.
Desulfurella acetivorans, a thermophilic, acetate-oxidizing and sulfur-reducing organism, represents a distinct lineage within the proteobacteria.
Syst. Appl. Microbiol.
16:373-379.
|
| 27.
|
Tani, K.,
K. Kurokawa, and M. Nasu.
1998.
Development of a direct in situ PCR method for detection of specific bacteria in natural environments.
Appl. Environ. Microbiol.
64:1536-1540[Abstract/Free Full Text].
|
| 28.
|
Tunnicliffe, V.,
M. Botros,
M. E. Deburgh,
A. Dinet,
H. P. Johnson,
S. K. Juniper, and R. E. McDuff.
1986.
Hydrothermal vents of Explorer Ridge, Northeast Pacific.
Deep-Sea Res. I. Oceanogr. Res. Pap.
33:401-412.
|
| 29.
|
Tuttle, J. H.,
C. O. Wirsen, and H. W. Jannasch.
1983.
Microbial activities in the emitted hydrothermal waters of the Galapagos Rift vents.
Mar. Biol.
73:293-299.
|
| 30.
|
Vondamm, K. L., and J. L. Bischoff.
1987.
Chemistry of hydrothermal solutions from the Southern Juan-De-Fuca Ridge.
J. Geophys. Res. Solid Earth Planets
92:11334-11346.
|
| 31.
|
Wagner, M.,
A. J. Roger,
J. L. Flax,
G. A. Brusseau, and D. A. Stahl.
1998.
Phylogeny of dissimilatory sulfite reductases supports an early origin of sulfate respiration.
J. Bacteriol.
180:2975-2982[Abstract/Free Full Text].
|
| 32.
|
Walsh, P. S.,
D. A. Metzger, and R. Higuchi.
1991.
Chelex-100 as a medium for simple extraction of DNA for PCR-based typing from forensic material.
BioTechniques
10:506-513[Medline].
|
Applied and Environmental Microbiology, March 1999, p. 1127-1132, Vol. 65, No. 3
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Pham, V. H., Yong, J.-J., Park, S.-J., Yoon, D.-N., Chung, W.-H., Rhee, S.-K.
(2008). Molecular analysis of the diversity of the sulfide : quinone reductase (sqr) gene in sediment environments. Microbiology
154: 3112-3121
[Abstract]
[Full Text]
-
Dar, S. A., Yao, L., van Dongen, U., Kuenen, J. G., Muyzer, G.
(2007). Analysis of Diversity and Activity of Sulfate-Reducing Bacterial Communities in Sulfidogenic Bioreactors Using 16S rRNA and dsrB Genes as Molecular Markers. Appl. Environ. Microbiol.
73: 594-604
[Abstract]
[Full Text]
-
Nakagawa, T., Ishibashi, J.-I., Maruyama, A., Yamanaka, T., Morimoto, Y., Kimura, H., Urabe, T., Fukui, M.
(2004). Analysis of Dissimilatory Sulfite Reductase and 16S rRNA Gene Fragments from Deep-Sea Hydrothermal Sites of the Suiyo Seamount, Izu-Bonin Arc, Western Pacific. Appl. Environ. Microbiol.
70: 393-403
[Abstract]
[Full Text]
-
Nakagawa, T., Fukui, M.
(2003). Molecular Characterization of Community Structures and Sulfur Metabolism within Microbial Streamers in Japanese Hot Springs. Appl. Environ. Microbiol.
69: 7044-7057
[Abstract]
[Full Text]
-
Liu, X., Bagwell, C. E., Wu, L., Devol, A. H., Zhou, J.
(2003). Molecular Diversity of Sulfate-Reducing Bacteria from Two Different Continental Margin Habitats. Appl. Environ. Microbiol.
69: 6073-6081
[Abstract]
[Full Text]
-
Campbell, B. J., Stein, J. L., Cary, S. C.
(2003). Evidence of Chemolithoautotrophy in the Bacterial Community Associated with Alvinella pompejana, a Hydrothermal Vent Polychaete. Appl. Environ. Microbiol.
69: 5070-5078
[Abstract]
[Full Text]
-
Audiffrin, C., Cayol, J.-L., Joulian, C., Casalot, L., Thomas, P., Garcia, J.-L., Ollivier, B.
(2003). Desulfonauticus submarinus gen. nov., sp. nov., a novel sulfate-reducing bacterium isolated from a deep-sea hydrothermal vent. Int. J. Syst. Evol. Microbiol.
53: 1585-1590
[Abstract]
[Full Text]
-
Fishbain, S., Dillon, J. G., Gough, H. L., Stahl, D. A.
(2003). Linkage of High Rates of Sulfate Reduction in Yellowstone Hot Springs to Unique Sequence Types in the Dissimilatory Sulfate Respiration Pathway. Appl. Environ. Microbiol.
69: 3663-3667
[Abstract]
[Full Text]
-
Dhillon, A., Teske, A., Dillon, J., Stahl, D. A., Sogin, M. L.
(2003). Molecular Characterization of Sulfate-Reducing Bacteria in the Guaymas Basin. Appl. Environ. Microbiol.
69: 2765-2772
[Abstract]
[Full Text]
-
Friedrich, M. W.
(2002). Phylogenetic Analysis Reveals Multiple Lateral Transfers of Adenosine-5'-Phosphosulfate Reductase Genes among Sulfate-Reducing Microorganisms. J. Bacteriol.
184: 278-289
[Abstract]
[Full Text]
-
Buchan, A., Neidle, E. L., Moran, M. A.
(2001). Diversity of the Ring-Cleaving Dioxygenase Gene pcaH in a Salt Marsh Bacterial Community. Appl. Environ. Microbiol.
67: 5801-5809
[Abstract]
[Full Text]
-
Klein, M., Friedrich, M., Roger, A. J., Hugenholtz, P., Fishbain, S., Abicht, H., Blackall, L. L., Stahl, D. A., Wagner, M.
(2001). Multiple Lateral Transfers of Dissimilatory Sulfite Reductase Genes between Major Lineages of Sulfate-Reducing Prokaryotes. J. Bacteriol.
183: 6028-6035
[Abstract]
[Full Text]
-
Campbell, B. J., Jeanthon, C., Kostka, J. E., Luther, G. W. III, Cary, S. C.
(2001). Growth and Phylogenetic Properties of Novel Bacteria Belonging to the Epsilon Subdivision of the Proteobacteria Enriched from Alvinella pompejana and Deep-Sea Hydrothermal Vents. Appl. Environ. Microbiol.
67: 4566-4572
[Abstract]
[Full Text]
-
Campbell, B. J., Cary, S. C.
(2001). Characterization of a Novel Spirochete Associated with the Hydrothermal Vent Polychaete Annelid, Alvinella pompejana. Appl. Environ. Microbiol.
67: 110-117
[Abstract]
[Full Text]
-
Cottrell, M. T., Wood, D. N., Yu, L., Kirchman, D. L.
(2000). Selected Chitinase Genes in Cultured and Uncultured Marine Bacteria in the alpha - and gamma -Subclasses of the Proteobacteria. Appl. Environ. Microbiol.
66: 1195-1201
[Abstract]
[Full Text]
Top
Abstract
Introduction
