Previous Article | Next Article 
Applied and Environmental Microbiology, April 1999, p. 1584-1588, Vol. 65, No. 4
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
-Tubulin mRNA as a Marker of
Cryptosporidium parvum Oocyst Viability
Giovanni
Widmer,*
Elizabeth A.
Orbacz, and
Saul
Tzipori
Division of Infectious Diseases, Tufts
University School of Veterinary Medicine, North Grafton,
Massachusetts 01536
Received 20 October 1998/Accepted 21 January 1999
 |
ABSTRACT |
Determining the viability of waterborne Cryptosporidium
parvum oocysts remains a technical challenge. rRNA and mRNA
were evaluated in a reverse transcription (RT)-PCR assay as potential
markers of oocyst viability. The rationale for this approach is the
rapid turnover and postmortem decay of cellular RNA. The
-tubulin
mRNA and an anonymous mRNA transcript were chosen as potential
markers because they are the only mRNA species in C. parvum known to possess introns. This feature facilitated the
distinction between genuine RT-PCR products and PCR products
originating from copurifying DNA. Prolonged incubation at room
temperature of initially viable oocysts resulted in a gradual decrease
in mRNA levels, which correlated with the loss of oocyst
infectivity to neonatal mice. In contrast, oocysts stored at 4°C for
over 39 weeks maintained their infectivity and displayed no decrease in
the level of
-tubulin RT-PCR product. The postmortem decay of two
mRNA species demonstrates that RT-PCR analysis can provide
information on the viability of C. parvum oocysts.
The methodological similarity between PCR detection and RT-PCR
viability analysis could facilitate the development of a combined
detection and viability assay.
 |
INTRODUCTION |
Cryptosporidium parvum is
an enteric apicomplexan parasite infecting several mammalian species.
In immunocompromised individuals, C. parvum can
establish persistent infections leading to chronic diarrhea and wasting.
Oocysts of C. parvum are commonly found in surface
water and can contaminate public water supplies (15, 17,
23). Information on the viability of waterborne oocysts is
critical for assessing the risk of waterborne transmission. Since
standard, antibody-based detection methods do not discriminate
between viable and dead oocysts, it is difficult to assess the
risk posed by the presence of oocysts in drinking water. Although some
authors distinguish between viable and infectious oocysts, for the
purpose of this report the terms "viable" and "infectious" are
considered synonyms, as are "nonviable," "inactivated," and
"dead."
In the laboratory, the benchmark for viability assessment of
C. parvum oocysts is animal infectivity. Commonly used
animal surrogates are neonatal or immunosuppressed rodents
(28). Since animal infectivity assays do not meet the
requirements of the water industry for fast and cost-effective tests, a
number of in vitro methods which differentiate between viable and dead
oocysts have been developed. These methods take advantage of
several changes associated with oocyst death, such as increased
oocyst wall permeability to vital dyes (4, 11), loss of
ability to excyst (8, 30), loss of infectivity to tissue
culture cells (22, 24), and absence of transcriptional
activity (26, 29). The fact that waterborne oocysts are
typically recovered among a heterogeneous mixture of other organisms
and organic matter limits the use of viability assays requiring
microscopic examination of water filtrates such as vital dyes. These
commonly used methods are also affected by exposure of oocysts to
disinfectants (1, 7, 14) and will not indicate inactivation
by exposure to low doses of UV light (2a). Cell culture
methods are sensitive indicators of viability, particularly when
combined with PCR detection (21), but are relatively slow
and labor-intensive. A 24- to 48-h incubation time limits their use
in emergency situations. In contrast, techniques involving PCR do not
depend on microscopic examination and can take advantage of the
specificity of PCR amplification to distinguish among different species
or genotypes (31). Results can be obtained within a
day, and the use of newer PCR analysis tools can significantly shorten
the procedure by eliminating the need for electrophoretic analysis
(9).
On the basis of the observed rapid postmortem RNA decay in certain
mammalian tissues (16, 20), rRNA and mRNA transcripts from C. parvum oocysts were examined with the aim of
identifying suitable markers of oocyst viability. In this report we
show that rRNA and mRNA decay at different rates.
-Tubulin
mRNA was a suitable target for this assay because it decays quickly
and because the presence of an intron (3) facilitates the
differentiation between PCR products originating from mRNA and from
copurifying genomic DNA.
 |
MATERIALS AND METHODS |
Oocyst preparation.
C. parvum oocysts of isolate
GCH1 (27), propagated in neonatal calves, were isolated from
fecal material by flotation on 2 volumes of saturated NaCl followed by
sedimentation on a 15% to 25% (wt/vol) Nycodenz (Sigma, St. Louis,
Mo.) step gradient in phosphate-buffered saline for 1.5 h at
100,000 × g (32). Recovered oocysts were
surface sterilized in 10% bleach (0.5% sodium hypochloride) on ice
for 10 min and resuspended in 1% penicillin-streptomycin in sterile
phosphate-buffered saline. The ratio of excystation was estimated by
counting excysted and unexcysted oocysts after a 45-min incubation in
0.75% taurocholic acid at 37°C.
Purified oocysts were divided into two groups. One group was stored at
4°C, and the other was stored at room temperature. At 5-week
intervals, two aliquots of 107 oocysts were removed from
the sample stored at room temperature. One aliquot was tested for the
ability to infect mice, and the remaining aliquot was stored at
80°C for later RNA extraction and reverse transcription (RT)-PCR
analysis. Oocysts stored at 4°C were processed in the same manner
except that samples were collected at 10-week intervals.
Animal inoculation.
Litters of ICR mice (Taconic,
Germantown, N.Y.), 6 to 7 days of age, were inoculated with
106 purified oocysts per mouse. Typically, eight mice were
infected per sample. Modified acid-fast staining was used to monitor
inoculated mice three times a week for oocyst shedding. Fecal oocyst
counts were estimated on acid-fast stained smears as described and
expressed on a scale from 0 to 5 (27).
RNA extraction, RT-PCR, and gel analysis.
Oocysts were lysed
by three cycles of freeze-thawing, and RNA was extracted with
Trireagent (Sigma). Contaminating DNA was digested with RQ1 DNase
(Promega, Madison, Wis.). The DNase was inactivated before RT by heat
treatment at 65°C for 15 min.
RNA from approximately 2 × 10
5 oocysts were used in
each RT reaction. The RNA was denatured in diethylpyrocarbonate-treated
water by incubation at 80°C in 10 mM EDTA-2 µM reverse primer
for
2 min. The reaction mixtures were cooled slowly to 37°C, and
100 U of
Moloney murine leukemia virus reverse transcriptase,
20 U of RNase
inhibitor, 1 mM (each) deoxynucleoside triphosphates,
and 1× Moloney
murine leukemia virus RT buffer (50 mM Tris-HCl
[pH 8.3], 75 mM KCl,
3 mM MgCl
2, 10 mM dithiothreitol) were added.
The reaction
mixtures were incubated at 37°C for 1 h. RT primers
included
cry20 (positions 1091 to 1072; GenBank accession no.
L16996) and btub2
(
32) (positions 708 to 689; GenBank accession
no.
Y12615).
A fragment of the
C. parvum 
-tubulin cDNA was
amplified from RT reaction mixtures following a nested-PCR protocol. In
the
first-round RT-PCR, a 454-bp fragment of the

-tubulin cDNA
spanning
the exon1-exon2 splice site was amplified by using sense
primer
btub5 (positions 165 to 184; accession no.
Y12615) and
antisense
primer btub2 (positions 708 to 689) (
32). It is
important to
note that a putative artifactual 6-bp duplication in the
sequence
deposited under accession no.
Y12615 causes a
discrepancy between
calculated and expected amplicon sizes. In the
second round of
amplification, an internal 282-bp fragment was
amplified by using
sense primer btub3 (5' GTCATTTCTGATGAGCACGG
3'; positions 187
to 206) and antisense primer btub6 (5'
ACAGCATCTAAGAGTTCAGCTCC
3'; positions 536 to 558) also
located in exon 1 and exon 2, respectively.
First-round amplifications
were performed by using a hot-start
protocol with
Taq DNA
polymerase, 1/10 volume of RT reaction mixtures
as a template, and 30 cycles of 95°C for 50 s, 52°C for 50 s,
and 72°C for 1 min followed by a final extension at 72°C for 3
min. The same PCR
protocol was used with the internal primers
except that the primer
annealing temperature was raised to 57°C
and 1 µl of first-round
amplicon was used as a template. Oocyst
RNA and sterile water were used
as negative RT-PCR
controls.
The ribosomal PCR products were amplified from 1/10 volume of the RT
reaction mixtures primed with cry20 (5' AAGTTTCAGCCTTGCGACC
3') by using primers cry4 and cry2 as described by Carraway et
al. (
5), except that the annealing temperature was raised to
55°C. A single 35-cycle PCR amplification was performed with the
ribosomal primers. A 408-bp fragment of the mRNA deposited under
GenBank accession no.
AA224676 was amplified by RT-PCR using
reverse
primer AA2241 (5' GATACTTTCGAAGGGCAAGG 3'; positions
527
to 507) and forward primer AA2242 (5'
TGGTTCGAGTAAAATCCAAGG 3';
positions 120 to 139). The
reverse primer was also used to prime
the
RT.
PCR products were visualized on 1.5% agarose stained with ethidium
bromide. Gel images were digitized with MCID-M4 software
(Imaging
Research Inc., St. Catharines, Ontario, Canada), and
band intensities
were measured as integrated optical density with
the Direct Band
Analysis
program.
 |
RESULTS |
To assess the rate of RNA decay following oocyst inactivation,
viable C. parvum oocysts were inactivated at 65°C for
15 min (6) and stored at room temperature. RT-PCR analysis
of the
-tubulin mRNA and small-subunit (SSU) rRNA revealed
different rates of decay between these transcripts. Whereas the SSU
rRNA was still detectable for at least 11 weeks after oocyst
inactivation when a single 35-cycle PCR was used, the
-tubulin
transcript was not detected, even when a nested-PCR protocol was used,
in RNA extracted within 1 h of oocyst inactivation (data not shown).
The rapid decay of the
-tubulin mRNA in inactivated oocysts
suggested that this transcript might be an adequate marker of oocyst viability. RNA stability was examined in live oocysts stored for
prolonged periods of time at room temperature or at 4°C. Oocysts of isolate GCH1 were purified from the stool of an experimentally infected calf within 3 days of excretion. The viability of the oocysts
at the onset of the experiment was estimated microscopically by
determining the rate of excysted oocysts in an in vitro excystation assay and determining their infectivity to neonatal mice. An
excystation rate of 90%, and 100% infectivity (eight mice infected
out of eight inoculated), confirmed that this sample was fully viable. RT-PCR analysis was performed on RNA extracted from oocysts aged over
periods of 20 and 39 weeks at room temperature and 4°C, respectively. To minimize sample-to-sample variation in the analysis, oocyst samples
removed at specific time points were stored at
70°C and RNA was
extracted at all time points simultaneously. At each time point, the
infectivity of the oocysts was determined in neonatal mice (Table
1). As expected, the infectivity
decreased faster at room temperature. Loss of infectivity occurred by
week 20. In the 4°C sample, oocysts were still infectious after 39 weeks, although some reduction in mouse fecal oocyst scores was found. Confirming the initial observations with inactivated oocysts, RT-PCR
analysis of the room temperature samples revealed a relative rapid
decay in the RT-PCR signal. By week 15, no
-tubulin mRNA was detected (Fig. 1A). Except for
one sample (Fig. 1A, lane 6), a PCR product was also amplified from the
unspliced, genomic sequence. The disappearance of the DNA signal in the
20-week sample suggests that DNA degradation might also occur at later
time points. In contrast to the
-tubulin signal, the SSU rRNA showed
little sign of decay after 20 weeks of storage (Fig. 1B). Due to the
relative abundance of this transcript, a single 35-cycle amplification was sufficient for its detection. Control RT-PCRs with the rRNA primers
performed in the absence of reverse transcriptase were negative
(data not shown), confirming that the persistence of the RT-PCR
signal was not due to DNA contamination. Attempts at identifying less
stable regions of the SSU rRNA by using RT-PCR primers closer to the 3'
end did not reveal differences in the rate of decay within this
transcript. In oocysts stored at 4°C, the spliced
-tubulin PCR
signal was still visible after 39 weeks of storage. In fact, there was
no apparent decrease in signal intensity (Fig.
2).

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 1.
RT-PCR detection of RNA in oocysts aged at room
temperature for 20 weeks. (A) mRNA and genomic DNA amplification
using the -tubulin primers btub3 and btub6. The size difference
between the genomic (366-bp) and the spliced (mRNA; 282-bp) product
is due to the presence of an 84-bp intron. Notice the decay of the
mRNA signal starting at week 11 and the disappearance of the DNA
signal at week 20 (lane 6). A trace of PCR product is visible in the
negative control (lane 8). (B) RT-PCR amplification of SSU rRNA showing
no time-dependent decay of this transcript. Lanes 1, pBR/Bst/NI DNA ladder, with sizes of relevant bands (in base
pairs) shown left of panel B; lanes 7, positive PCR control; lanes 8, negative PCR control.
|
|

View larger version (86K):
[in this window]
[in a new window]
|
FIG. 2.
Stability of -tubulin RT-PCR signal in oocysts stored
at 4°C for 39 weeks. Notice the persistence of the RT-PCR signal in
oocysts maintained at this temperature. Leftmost lane,
pBR/Bst/NI DNA markers, with sizes of relevant bands (in
base pairs) shown on the left. The negative PCR control is shown in the
rightmost lane ( ).
|
|
The infectivity of aged oocysts was monitored in neonatal mice with the
aim of examining the correlation between the decay of two mRNA
species and infectivity. Although the correlation between
-tubulin
mRNA and infectivity was not very high (correlation coefficient
[r] = 0.64; n = 10), two independent
experiments confirmed the absence of
-tubulin mRNA in oocysts
that were no longer infective (Fig. 3).
In contrast, all infectious oocyst samples showed some level of
-tubulin mRNA. Samples displaying a high RT-PCR signal infected
60 to 100% of the mice. The decrease in infectivity was paralleled by
the fecal oocyst concentration (Table 1); fecal scores ranged from 2 to
3 for fresh oocysts and gradually decreased to 0 for aged samples. In
agreement with the persistence of the RT-PCR signal, all mice
inoculated with the 4°C oocysts developed an infection.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 3.
The -tubulin RT-PCR signal as a marker of oocyst
viability. The integrated optical density of the spliced RT-PCR signal
was plotted against oocyst infectivity in mice (Table 1) for oocysts
aged at room temperature. Different symbols represent two independent
series of RT-PCR amplifications.
|
|
Because of the advantage of targeting the viability assay to
transcripts bearing introns, we monitored the rate of decay of a second
mRNA transcript reported to contain an intron (GenBank accession
no. AA224676) (18). This transcript, of unknown coding
function, also decayed in a time-dependent fashion (r = 0.92). In contrast to
-tubulin mRNA, a PCR signal was
still detectable in nonviable oocysts (data not shown),
suggesting a higher stability of this transcript than of
-tubulin
mRNA. It also appears that this transcript is present at a
higher copy number in oocysts, because a single round of PCR
amplification was sufficient to generate visible PCR products.
Since RT-PCR was performed with oocyst numbers unlikely to be
encountered in environmental samples, a serial dilution experiment was
performed with the aim of identifying the detection limit of the
-tubulin RT-PCR assay. A nested-PCR amplification of 10-fold serial
dilutions of an RT reaction detected spliced and unspliced
-tubulin
signal in a 10-oocyst equivalent (data not shown).
 |
DISCUSSION |
Much attention has focused on the use of vital dyes for
C. parvum viability assessment (1, 2, 7, 11,
14). The effect of disinfectants on oocyst dye uptake has
generated some controversy regarding the use of dye-based methods. In
spite of such assays being technically simple and cost-effective, it is conceivable that in the future the need for microscopic examination of
individual oocysts will limit the application of vital dyes to
small operations. As nucleic acid-based diagnostic technologies amenable to automation are being developed (9), such
methods will become attractive for environmental testing.
Detection and viability methods based on PCR may facilitate
automation for water testing.
PCR has been evaluated for the detection of waterborne C. parvum oocysts in many laboratories (12, 21, 25, 31).
Because loss of viability is not thought to immediately affect DNA
integrity, few viability methods relying on nucleic acid amplification
have been described. Originally, Filkorn et al. (8) and
Wagner-Wiening and Kimmig (30) proposed a PCR viability
method based on the detection of excysted sporozoites by PCR. In our
hands, exposure of intact oocysts to high temperatures during thermal
cycling resulted in the release of some DNA from oocysts, suggesting
that a PCR test relying solely on the capacity of viable oocysts to excyst could be prone to generating false positives. A different approach was described by Stinear et al. (26). The heat
shock protein 70 (hsp70) transcript was chosen as a target
for RT-PCR amplification because it is known to be induced in some
experimental organisms in response to heat shock. Although the
hsp70 RT-PCR proved to be a sensitive detection method
(13), the hsp70 mRNA was not induced in
oocysts exposed to heat. In addition, the fate of this RNA species in
aged oocysts was not investigated (26). Using
fluorescent in situ hybridization (FISH) directed at the SSU rRNA 5'
region, Vesey et al. (29) demonstrated a good
correlation between oocyst fluorescence and excystation. At first
sight, this observation is in conflict with the stability of rRNA
described here. Several differences in the RT-PCR and FISH protocols
could explain the discrepancy, namely, (i) differential sensitivities of the RT-PCR and FISH and the exponential amplification (PCR) versus
the nonamplified (FISH) signal, (ii) the different regions of the SSU
targeted in the assays, and (iii) the use of excystation versus
animal infectivity as the second variable.
The sensitivity of any PCR is dependent on the initial concentration of
target molecules. Because visualization of the mRNA deposited under
accession no. AA224676 required a single round of amplification, we
assume that this transcript is present in oocysts at a higher copy
number than
-tubulin mRNA. We initially focused on the
-tubulin transcript because it was the only transcript in
C. parvum known to contain an intron. This feature
allowed us to eliminate the interference from DNA contaminating our RNA extracts. For the purpose of a viability assay, the advantage of a
single-step amplification with this transcript (accession no. AA224676)
is offset by its lower rate of decay. An extrapolation of the RT-PCR
data from this transcript shows that, assuming a constant and linear
rate of decay, mRNA would still be detected more than 20 weeks
postmortem. This property makes this mRNA (accession no. AA224676)
unsuitable as a marker of viability. The rates of decay of rRNA and of
two mRNA species investigated in this study demonstrate that
transcripts in oocysts vary considerably in their abundance and
postmortem stability. An ideal RNA-based viability assay requires the
identification of an mRNA species of higher abundance than
-tubulin and with a higher decay rate than that of the mRNA
deposited under accession no. AA224676.
Because of the effects of sodium hypochloride on the oocyst wall
(7, 19), it would have been preferable to omit the bleach treatment in the preparation of aged oocyst stocks. Initial trials showed that without sterilization even highly purified oocyst samples
would rapidly become contaminated with fungi and bacteria. This made it
difficult to obtain precise oocyst counts. Therefore, the bleach
treatment was retained as a means of removing contaminants. Although
this resulted in an artificially homogeneous oocyst suspension, it was
considered adequate for the purpose of this study, namely, establishing
the correlation between RNA levels and viability. Assessing the
performance of the RNA-based viability assay in environmental samples
is a separate goal, which is currently being addressed.
In conclusion, although the development of an optimal viability test
for waterborne oocysts remains a technical challenge, RNA analysis,
whether by RT-PCR or hybridization, compares favorably with other
viability methods. Since RNA decay was examined in heat-inactivated and
in untreated, aged oocysts only, the effect of disinfectants on the
performance of this assay remains to be investigated. A significant
advantage of this approach is the potential for the development of a
combined detection-viability assay. In addition, this method can be
tailored to species- or genus-specific sequences depending on the
requirements of the test.
 |
ACKNOWLEDGMENT |
This work was supported by U.S. Department of Agriculture grant 9604051.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Tufts
University, Bldg. 20, 200 Westboro Rd., North Grafton, MA 01536. Phone:
(508) 839-7944. Fax: (508) 839-7977. E-mail:
gwidmer{at}infonet.tufts.edu.
 |
REFERENCES |
| 1.
|
Black, E. K.,
G. R. Finch,
R. Taghi-Kilani, and M. Belosevic.
1996.
Comparison of assays for Cryptosporidium parvum oocyst viability after chemical disinfection.
FEMS Microbiol Lett.
135:187-189[Medline].
|
| 2.
|
Brown, M. A.,
V. McDonald,
H. Denton, and G. H. Coombs.
1996.
The use of a new viability assay to determine the susceptibility of Cryptosporidium and Eimeria sporozoites to respiratory inhibitors and extremes of pH.
FEMS Microbiol. Lett.
142:203-208[Medline].
|
| 2a.
| Bukhari, Z. (Clancy Environmental Consultants).
Personal communication.
|
| 3.
|
Cacciò, S.,
G. La Rosa, and E. Pozio.
1997.
The beta-tubulin gene of Cryptosporidium parvum.
Mol. Biochem. Parasitol.
89:307-311[Medline].
|
| 4.
|
Campbell, A. T.,
L. J. Robertson, and H. V. Smith.
1992.
Viability of Cryptosporidium parvum oocysts: correlation of in vitro excystation with inclusion or exclusion of fluorogenic vital dyes.
Appl. Environ. Microbiol.
58:3488-3493[Abstract/Free Full Text].
|
| 5.
|
Carraway, M.,
S. Tzipori, and G. Widmer.
1996.
Identification of genetic heterogeneity in the Cryptosporidium parvum ribosomal repeat.
Appl. Environ. Microbiol.
62:712-716[Abstract].
|
| 6.
|
Fayer, R.
1994.
Effect of high temperature on infectivity of Cryptosporidium parvum oocysts in water.
Appl. Environ. Microbiol.
60:2732-2735[Abstract/Free Full Text].
|
| 7.
|
Fayer, R.
1995.
Effect of sodium hypochloride exposure on infectivity of Cryptosporidium parvum oocysts for neonatal BALB/c mice.
Appl. Environ. Microbiol.
61:844-846[Abstract].
|
| 8.
|
Filkorn, R.,
A. Wiedenmann, and K. Botzenhart.
1994.
Selective detection of viable Cryptosporidium oocysts by PCR.
Zentbl. Hyg.
195:489-494.
|
| 9.
|
Heid, C. A.,
J. Stevens,
K. J. Livak, and P. M. Williams.
1996.
Real time quantitative PCR.
Genome Res.
6:986-994[Abstract/Free Full Text].
|
| 10.
|
Hodgson, J.
1998.
Shrinking DNA diagnostics to fill the markets of the future.
Nat. Biotechnol.
16:725-727[Medline].
|
| 11.
|
Jenkins, M. B.,
L. J. Anguish,
D. D. Bowman,
M. J. Walker, and W. C. Ghiorse.
1997.
Assessment of dye permeability assay for determination of inactivation rates of Cryptosporidium parvum oocysts.
Appl. Environ. Microbiol.
63:3844-3850[Abstract].
|
| 12.
|
Johnson, D. W.,
N. J. Pieniazek,
D. W. Griffin,
L. Misener, and J. B. Rose.
1995.
Development of a PCR protocol for sensitive detection of Cryptosporidium oocysts in water samples.
Appl. Environ. Microbiol.
61:3849-3855[Abstract].
|
| 13.
|
Kaucner, C., and T. Stinear.
1998.
Sensitive and rapid detection of viable Giardia cysts and Cryptosporidium parvum oocysts in large-volume water samples with wound fiberglass cartridge filters and reverse transcription-PCR.
Appl. Environ. Microbiol.
64:1743-1749[Abstract/Free Full Text].
|
| 14.
|
Korich, D. G.,
J. R. Mead,
M. S. Madore,
N. A. Sinclair, and C. R. Sterling.
1990.
Effects of ozone, chlorine dioxide, chlorine, and monochloramine on Cryptosporidium parvum oocyst viability.
Appl. Environ. Microbiol.
56:1423-1428[Abstract/Free Full Text].
|
| 15.
|
LeChevallier, M. W., and W. D. Norton.
1995.
Giardia and Cryptosporidium in raw and finished water.
J. Am. Water Works Assoc.
87:54-68.
|
| 16.
|
Noguchi, I.,
H. Arai, and R. Iizuka.
1991.
A study on postmortem stability of vasopressinmessenger RNA in rat brain compared with those in total RNA and ribosomal RNA.
J. Neural Transm.
83:171-178[Medline].
|
| 17.
|
Ongerth, J. E., and H. H. Stibbs.
1987.
Identification of Cryptosporidium oocysts in river water.
Appl. Environ. Microbiol.
53:672-676[Abstract/Free Full Text].
|
| 18.
|
Piper, M. B.,
A. T. Bankier, and P. H. Dear.
1998.
A HAPPY map of Cryptosporidium parvum.
Genome Res.
8:1299-1307[Abstract/Free Full Text].
|
| 19.
|
Reduker, D. W.,
C. A. Speer, and J. A. Blixt.
1985.
Ultrastructural changes in the oocyst wall during excystation of Cryptosporidium parvum (Apicomplexa; Eucoccidiorida).
Can. J. Zool.
63:1892-1896.
|
| 20.
|
Reichert, G. H., and O. G. Issinger.
1985.
In vitro study of the biological activity of RNAs after incubation of hog liver, heart and brain at room temperature.
Biochimie
67:657-661[Medline].
|
| 21.
|
Rochelle, P. A.,
R. De Leon,
M. H. Stewart, and R. L. Wolfe.
1997.
Comparison of primers and optimization of PCR conditions for detection of Cryptosporidium parvum and Giardia lamblia in water.
Appl. Environ. Microbiol.
63:106-114[Abstract].
|
| 22.
|
Rochelle, P. A.,
D. M. Ferguson,
T. J. Handojo,
R. De Leon,
M. H. Stewart, and R. L. Wolfe.
1997.
An assay combining cell culture with reverse transcriptase PCR to detect and determine the infectivity of waterborne Cryptosporidium parvum.
Appl. Environ. Microbiol.
63:2029-2037[Abstract].
|
| 23.
|
Rose, J. B.,
C. P. Gerba, and W. Jakubowski.
1991.
Survey of potable water supplies for Cryptosporidium and Giardia.
Environ. Sci. Technol.
25:1393-1400.
|
| 24.
|
Slifko, T. R.,
D. Friedman,
J. B. Rose, and W. Jakubowski.
1997.
An in vitro method for detecting infectious Cryptosporidium oocysts with cell culture.
Appl. Environ. Microbiol.
63:3669-3675[Abstract].
|
| 25.
|
Sluter, S. D.,
S. Tzipori, and G. Widmer.
1997.
Parameters affecting polymerase chain reaction detection of waterborne Cryptosporidium parvum oocysts.
Appl. Microbiol. Biotechnol.
48:325-330[Medline].
|
| 26.
|
Stinear, T.,
A. Matusan,
K. Hines, and M. Sandery.
1996.
Detection of a single viable Cryptosporidium parvum oocysts in environmental water concentrates by reverse transcription-PCR.
Appl. Environ. Microbiol.
62:3385-3390[Abstract].
|
| 27.
|
Tzipori, S.,
W. Rand,
J. Griffiths,
G. Widmer, and J. Crabb.
1994.
Evaluation of an animal model system for Cryptosporidiosis: the therapeutic efficacy of paromomycin and hyperimmune bovine colostrum-immunoglobulin.
Clin. Diagn. Lab. Immunol.
1:450-463[Abstract/Free Full Text].
|
| 28.
|
Tzipori, S.
1998.
Cryptosporidiosis: laboratory investigations and chemotherapy.
Adv. Parasitol.
40:188-221.
|
| 29.
|
Vesey, G.,
N. Ashbolt,
E. J. Fricker,
D. Deere,
K. L. Williams,
D. A. Veal, and M. Dorsch.
1998.
The use of a ribosomal RNA targeted oligonucleotide probe for fluorescent labelling of viable Cryptosporidium parvum oocysts.
J. Appl. Microbiol.
86:429-440.
|
| 30.
|
Wagner-Wiening, C., and P. Kimmig.
1995.
Detection of viable Cryptosporidium parvum oocysts by PCR.
Appl. Environ. Microbiol.
61:4514-4516[Abstract].
|
| 31.
|
Widmer, G.
1998.
Genetic heterogeneity and PCR detection of Cryptosporidium parvum.
Adv. Parasitol.
40:224-241.
|
| 32.
|
Widmer, G.,
L. Tchack,
C. L. Chappell, and S. Tzipori.
1998.
Sequence polymorphism in the -tubulin gene reveals heterogeneous and variable population structures in Cryptosporidium parvum.
Appl. Environ. Microbiol.
64:4477-4481[Abstract/Free Full Text].
|
Applied and Environmental Microbiology, April 1999, p. 1584-1588, Vol. 65, No. 4
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Brescia, C. C., Griffin, S. M., Ware, M. W., Varughese, E. A., Egorov, A. I., Villegas, E. N.
(2009). Cryptosporidium Propidium Monoazide-PCR, a Molecular Biology-Based Technique for Genotyping of Viable Cryptosporidium Oocysts. Appl. Environ. Microbiol.
75: 6856-6863
[Abstract]
[Full Text]
-
Nocker, A., Camper, A. K.
(2006). Selective removal of DNA from dead cells of mixed bacterial communities by use of ethidium monoazide.. Appl. Environ. Microbiol.
72: 1997-2004
[Abstract]
[Full Text]
-
King, B. J., Keegan, A. R., Monis, P. T., Saint, C. P.
(2005). Environmental Temperature Controls Cryptosporidium Oocyst Metabolic Rate and Associated Retention of Infectivity. Appl. Environ. Microbiol.
71: 3848-3857
[Abstract]
[Full Text]
-
Ponnuraj, E. M., Hayward, A. R.
(2001). Intact Intestinal mRNAs and Intestinal Epithelial Cell Esterase, But Not Cryptosporidium parvum, Reach Mesenteric Lymph Nodes of Infected Mice. J. Immunol.
167: 5321-5328
[Abstract]
[Full Text]
-
Bukhari, Z., Marshall, M. M., Korich, D. G., Fricker, C. R., Smith, H. V., Rosen, J., Clancy, J. L.
(2000). Comparison of Cryptosporidium parvum Viability and Infectivity Assays following Ozone Treatment of Oocysts. Appl. Environ. Microbiol.
66: 2972-2980
[Abstract]
[Full Text]