Previous Article | Next Article 
Applied and Environmental Microbiology, May 1999, p. 1849-1853, Vol. 65, No. 5
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Subspecies-Dependent Regulation of Bacillus
thuringiensis Protoxin Genes
Ping
Cheng,1
Lan
Wu,2
Yu
Ziniu,1 and
Arthur
Aronson2,*
Laboratory of Bacillus Molecular Biology,
Department of Microbiological Sciences and Technology, Huazhong
Agricultural University, Wuhan, Hubei 430070, People's Republic of
China,1 and Department of Biological
Sciences, Purdue University, West Lafayette, Indiana
479072
Received 22 October 1998/Accepted 18 February 1999
 |
ABSTRACT |
Bacillus thuringiensis accumulates, primarily during
sporulation, large quantities of insecticidal protoxins which are
deposited as crystalline, intracellular inclusions. Most subspecies
contain several plasmid-encoded cry genes, each of which
has a unique specificity. The overall toxicity profile of a subspecies
depends not only on the array of cry genes present but also
on the relative expression of the genes. In general, transcription
depends on sporulation-specific sigma factors, but little is known
about regulation of expression of the individual genes. In order to determine whether expression of a particular cry gene
varies in different subspecies, lacZ fusions to the
cry promoters of two protoxin genes (cry1
class) were constructed. Protoxin accumulation and mRNA contents were
also measured by performing immunoblotting and Northern analyses,
respectively. The expression of a cry1Ab-lacZ fusion, but
not the expression of a cry1C-lacZ fusion, was three to
four times lower in B. thuringiensis subsp.
aizawai strains than in B. thuringiensis subsp.
kurstaki or B. thuringiensis subsp. tolworthi. Also, the Cry1Ab antigen and steady-state mRNA
contents of B. thuringiensis subsp. aizawai
were lower. The regulation of the genes must involve regions upstream
of the promoters which are unique to each cry gene since
(i) mutations in the upstream region of the cry1Ab gene
resulted in enhanced expression in B. thuringiensis subsp.
aizawai and (ii) no differences were found when the
lacZ fusions contained the cry1Ab promoters but
no upstream sequences. The capacity to regulate each of the protoxin
genes must be a factor in the overall protoxin composition of a
subspecies and thus its toxicity profile.
| |
INTRODUCTION |
In most subspecies the crystalline
inclusions produced by sporulating cells of Bacillus
thuringiensis consist of a mixture of closely related protoxins,
each of which is active against a subset of insect larvae (6,
15). The plasmid-encoded cry genes are transcribed
throughout much of sporulation by forms of RNA polymerase which
function in the mother cells, but there are variations in the types of
promoters, as well as in the times of transcription of certain classes
of these genes (1, 9).
Each of the many subspecies produces its own array of protoxins, which
very often is a mixture of Cry1 types (6, 15). There is
evidence that the cry1 genes are transcribed differentially (2) and that the relative amounts of the protoxins in
inclusions differ (20, 21). There were also medium-dependent
differences in the protoxin yields obtained by Dulmage (13),
but since complex media were used, the specific factors involved could
not be defined.
The previous reports suggest that regulation of expression of the
individual cry genes is probably important for determining the overall toxicity profile of an isolate. In addition to the relative
amounts of the various protoxins, inclusion solubility (2,
16) and synergism between certain toxins (19, 31) are
also factors to consider. In order to analyze this regulation in more
detail, plasmids containing fusions of the cry1 regulatory regions to lacZ were introduced into various B. thuringiensis subspecies. Subspecies-dependent differences in
expression were found, and these differences were confirmed by
measuring protoxin antigen and mRNA contents. Regions upstream of the
promoters were found to be important for this regulation.
| |
MATERIALS AND METHODS |
Strains and growth.
The strains used and their origins are
listed in Table 1. The presence of the
cry1Ab gene in B. thuringiensis subsp.
kurstaki HD1, B. thuringiensis subsp.
aizawai HD133, B. thuringiensis subsp. aizawai HD112, and B. thuringiensis subsp.
tolworthi HD124 had been established previously either by
Southern hybridization (26) or by PCR analysis (11, 17,
18). Slot blotting with a specific cry1Ab
oligonucleotide (17) was used to demonstrate that the relative amounts of cry1Ab DNA were the same in these
subspecies (2, 3).
In order to establish that the regions upstream of the
cry1Ab coding sequences were essentially the same in these
subspecies,
1,025 bp of each sequence was amplified by PCR
(
27) by using
oligonucleotides
5'GAATGGTTGGCATGCCGAAGACGG and
5'GGTTACTTAAACAATTATAAGG.
The approximately 1-kb sequences
upstream of the promoters of
the three
cry1A genes
(
cry1Aa,
cry1Ab, and
cry1Ac) in
B. thuringiensis subsp.
kurstaki HD1 were found
to differ at only one base (
14),
and the sequence of the
cry1Ab gene was confirmed (Fig.
1). Based
on this sequence, restriction
enzymes
HpaI,
NsiI,
NdeI, and
NsiI
plus
NdeI were used to demonstrate that the
PCR digestion products
of
B. thuringiensis subsp.
kurstaki HD1,
B. thuringiensis subsp.
aizawai HD133, and
B. thuringiensis subsp.
tolworthi HD124 were
the same size.
View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
Sequence of the region upstream of the cry1A
protoxin gene. The BtI and BtII promoters are underlined with one line
and two lines, respectively. The start sites of transcription for BtI
and BtII are indicated by I and II, respectively. The regions in
boldface type are the potential bend and IR (arrows) sites of binding
of the pyruvate dehydrogenase E2 protein (32, 33). The
GenBank accession no. of this sequence is AF039908.
|
|
The plasmid-cured strains 80-21, 5, and HD124-12 and the uncured strain
HD112 served as hosts for the
lacZ fusion plasmids.
A cloned
cry1Ab gene (
8) was introduced by electroporation
(
28) into strains 80-21 and 5. This clone and all of the
lacZ fusion plasmids were stable in the various strains, as
judged
by the constant level of resistance to chloramphenicol, the
inability
to find plasmid deletions after reisolation, and (for the
cry1Ab clone) the extent of hybridization with the specific
oligonucleotide
probe in slot blots (
2). Cells were grown in
Luria broth (
27)
for preparation of DNA and in G-Tris medium
(
4) for all other
experiments.
Preparation of nucleic acids.
DNA and RNA were prepared
(7, 8) from B. thuringiensis subsp.
kurstaki HD1, strain 80-21, B. thuringiensis
subsp. aizawai HD112 and HD133, and B. thuringiensis subsp. tolworthi HD124. RNA was isolated
from cells 1 h after clumping (early sporulation with no visible
endospores), about 1 h later when 40 to 50% of the cells
contained phase-dull endospores, and after an additional 90 min
when >80% of the cells contained phase-white to phase-bright endospores.
RNA was fractionated in an agarose gel for Northern blotting
(
27). A nitrocellulose filter was incubated with 35 pmol of
32P-labeled 5'CGGATGCTCATAGAGGAAGAA, an
oligonucleotide unique to
the
cry1Ab gene (
17)
which had been labeled by using [
-
32P]ATP and
polynucleotide kinase (
27). The X-ray films were scanned
with a PhosphoImager in order to determine relative
amounts.
lacZ fusions and 
-galactosidase assays.
A
plasmid containing the promoter region of the cry1A gene
with or without 280 bp upstream of the promoters fused to
lacZ has been described previously (29). A 780-bp
fragment upstream of the promoters of the cry1C gene
(30) was introduced in the same way. Both of these genes
contain overlapping promoters, designated BtI and BtII, with the
following sequences (in which the boldface segments indicate the
sequences of 
35 
K, 35 E, 10
K, and 10 E in that order):
TTAGTTGCACTTTGTGCATTTTTTCATAAGATGAGTCATATGTT in cry1A and
TTTGTTACGTTTTTTGTATTTTTTCATAAGATGTGTCATATGTT in cry1C. The BtI promoter is recognized by
E RNA polymerase, and BtII is recognized by
K RNA polymerase (9). The locations and
sequences of the 10 regions are identical in these two genes. The
35 regions differ at one base for the E promoter and
at two bases for the K promoter. Neither of these 35
regions is highly conserved in Bacillus subtilis
(25). However, the sequences differ substantially for at
least 1 kb upstream of the promoters (Fig. 1) (30, 33).
Mutations in the
10 region of the BtII promoter (Fig.
1) which
resulted in differences from the consensus sequence for both
K and
E resulted in inactivation of BtII
and a fivefold-greater rate
of expression from the BtI promoter
(
29). One mutant promoter,
designated
cry1A-272,
was used for many of our studies because
the
-galactosidase activity
with this promoter was much higher
than that with the wild-type
promoters and thus differences in
expression could be readily detected.
In all cases in which we
observed differences with the
cry1A-272 promoter, the differences
were confirmed with the
wild
type.
The upstream sequences were added in the correct orientation as 280- or
780-bp
HindIII fragments to the
cry1A-272 or
cry1A wild-type promoters fused to
lacZ (
29,
32). The upstream region
of the
cry1A gene contains an
inverted repeat (IR) and a potential
bend sequence about 200 to 250 bp
from the dual promoters (Fig.
1). These regions were selected
previously for mutagenesis on
the basis of the footprint of a binding
protein (
32). The mutations
resulted in decreased binding of
this protein, as well as altered
kinetics of expression of
lacZ fusions (
32). Each mutant
cry1A sequence was introduced as described above for the wild
type.
The
lacZ fusion plasmids were electroporated into the
various
B. thuringiensis strains (
28) with
selection on G-Tris plates
containing 7 µg of chloramphenicol per ml.
The presence of a functional
lacZ gene was established by
streaking preparations onto G-Tris
plates containing chloramphenicol
onto which 0.1 ml of 1%
methylumbelliferyl-
-
D-galactoside
(Sigma) in 50%
dimethylformamide had been spread and then examining
the plates with a
long-wavelength UV
lamp.
In order to demonstrate that the
lacZ fusion plasmids had
not undergone any deletions or rearrangements, they were reisolated
from
B. thuringiensis transformants by the alkaline lysis
procedure
(
10) and electroporated into the other
B. thuringiensis strains.
Consequently,
-galactosidase contents
were confirmed by using
subspecies which contained the same
lacZ fusion plasmid. The
lacZ fusion plasmids
from
B. thuringiensis were also transformed into
Escherichia coli DH5
. These plasmids were digested with
HindIII
and
BglII (
29) in order to
establish that no major deletions
or rearrangements had
occurred.
Duplicate samples of cells grown as described above were removed
throughout sporulation at 90- to 120-min intervals until
free spores
were released. The samples were frozen at
80°C. The
optical
densities at 600 nm were also determined with a Perkin-Elmer
junior
model 35 spectrophotometer until the cells became extensively
clumped
at the end of growth (at least when they were grown on
glucose).
-Galactosidase assays were performed with 30- to 50-µl
aliquots
(
29) in duplicate, and the data obtained were converted
to
Miller units (
22). The specific activities were expressed
in
Miller units per unit of optical density at 600 nm, and the
maximum
values are reported below. These values are the averages
of the values
from at least three independent experiments, and
the coefficients of
variance were less than ±10% in all
cases.
Detection of protoxin antigens.
Spores plus inclusions were
harvested (usually after 24 h) and washed, and the relative spore
concentrations were determined by direct counting in a Petroff-Hauser
chamber (in triplicate) and by determining the absorbance at 600 nm.
The values agreed well, and equal quantities of spores (plus
inclusions) were pelleted and then extracted (5). The
inclusions were purified in Renografin gradients, and the protoxins
were solubilized as described previously (5, 8).
To prepare cell extracts,
B. thuringiensis subsp.
kurstaki HD1 and
B. thuringiensis subsp.
aizawai HD133 were grown at 30°C
in 80 ml of G-Tris until
about 50 or 80% of the cells contained
phase-white to phase-bright
endospores. At each time point, 30
ml of cells was harvested, washed
once with 10 ml of 1 M KCl-5
mM EDTA (pH 8.0) and twice with 10 ml of
deionized water, and
resuspended in 80 µl of 6 M urea-1% sodium
dodecyl sulfate-5 mM
dithiothreitol-2 mM phenylmethylsulfonyl
fluoride (pH 9.6) (
5).
The suspensions were sonicated on ice
twice for 40 s each time
with a microtip and a Branson model 200 Sonifier. The suspensions
were then placed in a boiling water bath for
2 min. The protein
contents were determined by using 5-µl portions
and the bicinchoninic
acid reagent (Pierce Chemical Co.). The samples
were first precipitated
in 1 ml of 10% trichloroacetic acid, and the
pellets were dissolved
in 0.2 ml of 0.2 N NaOH. Equal quantities of
protein were electrophoresed
on sodium dodecyl sulfate-10%
polyacrylamide gel electrophoresis
gels and transferred to
polyvinylidene difluoride membranes for
immunoblotting with a Cry1Ab
monoclonal antibody plus a rabbit
anti-mouse alkaline phosphatase
conjugate or a Cry1Ac rabbit polyclonal
antibody plus an anti-rabbit
alkaline phosphatase conjugate (
24).
| |
RESULTS |
Subspecies variation in cry gene expression.
Expression of the cry1A-lacZ fusion was three- to fourfold
less in either of the two B. thuringiensis subsp.
aizawai strains examined, strain 5 (derived from HD133), or
HD112 than in B. thuringiensis subsp. kurstaki
80-21 or B. thuringiensis subsp. tolworthi
HD124-12 when the organisms were grown in G-Tris supplemented with
0.1% glucose (Table 2). The
lacZ fusion plasmid isolated from strain 5 had been used for
transformation of strain HD124-12 and was also reintroduced into strain
80-21 in order to confirm the results. Similarly, the lacZ
fusion plasmid from the original transformant of strain 80-21 was
electroporated into strains 5, 80-21, HD124-12, and HD112, and the
results were identical to those shown in Table 2. At the same time,
these plasmids were transformed into E. coli DH5 in order
to establish that there had been no major changes in the sizes of the
plasmids or of the HindIII-BglII restriction fragments (29).
The differences observed with the
cry1C-lacZ fusion were
marginal (Table
2). This is a hybrid construct containing the
cry1A-272
promoters plus the
cry1C upstream
region. Since the
cry1A and
cry1C genes have very
similar dual overlapping promoter sequences
(see above), such a
construct should provide a valid assessment
of the contribution of the
upstream
cry1C sequence to transcription
in the various
subspecies. The subspecies-specific responses of
the
cry1A
and
cry1C genes are likely to be due, therefore, to
certain
unique features of the upstream sequences. These sequences
differ
substantially in the
cry1A (Fig.
1) and
cry1C
(
30)
genes.
Further evidence that these upstream sequences have a regulatory
function included (i) the fact that the
-galactosidase specific
activities for a fusion of only the
cry1A promoters to
lacZ in
the absence of the upstream sequence were the same
in strains
80-21 and 5 (Table
2) and (ii) the fact that mutations which
substantially changed the potential bend region or the IR in the
cry1A upstream sequence (Fig.
1) (
33) resulted in
somewhat lower
specific activities in strain 80-21. However, the
specific activities
in strain 5 were the same as the specific
activities in strain
80-21 and almost threefold higher than the
specific activities
in the wild type (Table
2). In the other
B. thuringiensis subsp.
aizawai strain, HD112, there was
an approximately twofold increase
in the specific activity due to the
bend mutation. This strain
had a different origin and perhaps a
different
cry gene composition
than the other
B. thuringiensis subsp.
aizawai strain, HD133,
and had not
been cured of the plasmid containing the
cry1Ab gene.
Measurements of cry1Ab mRNA.
Total RNA from
sporulating cells was fractionated in an agarose gel (27),
transferred to nitrocellulose, and hybridized to a
32P-labeled oligonucleotide specific for the
cry1Ab gene (Fig. 2). The
relative contents of cry1Ab mRNA were 0.28:1.00 for HD133 and HD1 (Fig. 2, lanes 1 and 2) and 0.3:1.00 for HD112 and HD124 (lanes
3 and 4). The results obtained with RNA prepared from cells with >80%
phase-dull to phase-white endospores are shown in Fig. 2, but the same
differences were observed with RNA prepared at two earlier times during
sporulation (see above). The differences in steady-state mRNAs were
about the same as the differences found with lacZ fusions
(Table 2), which confirmed that there were differences in transcription
of this cry gene in the subspecies.
View larger version (109K):
[in this window]
[in a new window]
|
FIG. 2.
Northern blot of RNA (5 or 10 µg per lane) prepared
from sporulating cells (>80% phase-dull to phase-white endospores)
hybridized with 35 pmol of a 32P-labeled oligonucleotide
specific for the cry1Ab gene (see Materials and Methods).
Lane 1, 5 µg of RNA from B. thuringiensis subsp.
aizawai HD133; lane 2, 5 µg of RNA from B. thuringiensis subsp. kurstaki HD1; lane 3, 10 µg of
RNA from B. thuringiensis subsp. aizawai HD112;
lane 4, 10 µg of RNA from B. thuringiensis subsp.
tolworthi HD124.
|
|
Measurements of Cry1Ab antigen.
All of the subspecies which we
studied contain several cry1 genes, including
cry1Ab (Table 1). On the basis of the results obtained with
the lacZ fusions, we anticipated that the amount of Cry1Ab
antigen in B. thuringiensis subsp. aizawai
inclusions should be less than the amount of Cry1Ab antigen in B. thuringiensis subsp. kurstaki or B. thuringiensis subsp. tolworthi inclusions. Protoxins
were extracted from purified inclusions and electrophoresed for
staining or immunoblotting (Fig. 3). The
total amounts of inclusion protein in the three subspecies were about
the same (Fig. 3A), but there was considerably less Cry1Ab antigen in
B. thuringiensis subsp. aizawai inclusions than
in the inclusions of the other organisms (Fig. 3B). A Cry1A polyclonal
antibody which also cross-reacted with other Cry1 protoxins was used
(Fig. 3C), and no major differences in the total protoxin antigen
content were found.
View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
Analysis of protoxins extracted from purified inclusions
from B. thuringiensis subsp. kurstaki HD1 (lanes
1), B. thuringiensis subsp. aizawai HD133 (lanes
2), and (3) B. thuringiensis subsp.
tolworthi HD124 (lanes 3). (A) Stained sodium dodecyl
sulfate-10% polyacrylamide gel electrophoresis gel with 2 µg of
protein in each lane. The standards used (lane STD) were (from top to
bottom) myosin (205 kDa), -galactosidase (116 kDa), phosphorylase
b (97.4 kDa), and bovine serum albumin (66 kDa). (B)
Immunoblot obtained with a Cry1Ab monoclonal antibody containing the
same amounts of protein. (C) Immunoblot obtained with a Cry1A
polyclonal rabbit antibody.
|
|
The Cry1Ab antigen content of purified inclusions from
B. thuringiensis subsp.
aizawai HD133 (Fig.
3B) was
considerably less
than the content anticipated based on the
measurements of
-galactosidase
activity (Table
2) or mRNA (Fig.
2).
There was some variability
in the recovery of Cry1Ab antigen from
inclusions, which was attributable
to the instability of this protoxin
(
23). When protoxins were
extracted from sporulating cells
as well as from spore-inclusion
mixtures immediately upon their
release, the ratios of Cry1Ab
antigen content for
B. thuringiensis subsp.
kurstaki HD1 and
B. thuringiensis subsp.
aizawai HD133 were 2.4:1 and 2.8:1
for the
cell extracts and 3.0:1.0 (including the 130- and 60-kDa
antigens)
for the spore-inclusion mixtures (Fig.
4A). These ratios are consistent
with the
-galactosidase and mRNA values obtained for these subspecies.
View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Immunoblots with a Cry1Ab monoclonal antibody of
extracts from sporulating cells (lanes 1 to 4 in panel A) or
spore-inclusion mixtures (lanes 5 and 6 in panel A; lanes 1 to 3 in
panel B). (A) Extracts of sporulating cells of B. thuringiensis subsp. kurstaki HD1 (lanes 1 and 2) and
B. thuringiensis subsp. aizawai HD133 (lanes 3 and 4) were prepared when either 30% of the cells (lanes 1 and 3) or
60% of the cells (lanes 2 and 4) contained phase-bright endospores.
Equal quantities (50 µg) of protein in the extracts were
electrophoresed. Lanes 5 and 6 contained extracts of washed
spore-inclusion mixtures of each strain. (B) Extracts of
spore-inclusion mixtures of strain 80-21 transformed with a clone of
the cry1Ab gene (lane 1), strain 80-21 (lane 2), and strain
5 transformed with the same clone (lane 3). For all of the
spore-inclusion mixture extractions, the same quantity of spores was
used. Lane STD contained (from top to bottom) 200-, 116-, 90-, and
65-kDa standards. See Materials and Methods for details concerning
strain construction and extraction procedures. The staining intensities
were quantitated with a General Dynamics ImageQuant apparatus.
|
|
Differences in the amounts of Cry1Ab antigen may also be due to small
differences in the sequences of the Cry1Ab protoxins
in the two
subspecies and thus in the extent of reactivity with
the monoclonal
antibody prepared against the
B. thuringiensis subsp.
kurstaki HD1 Cry1Ab protoxin. In order to examine this
possibility, a clone of the
cry1Ab gene from
B. thuringiensis subsp.
kurstaki HD1 (
8) was
introduced into strains 80-21 and
5. Protoxins were extracted from
spore-inclusion mixtures, and
the Cry1Ab antigen contents were
determined with the monoclonal
antibody (Fig.
4B). The ratio of the
major reactive bands at 130
kDa was >3.0:1.0, which confirmed that the
expression of this
cry gene was subspecies
dependent.
| |
DISCUSSION |
Subspecies-dependent differences in the expression of a
cry1 gene were established with lacZ fusions and
were confirmed by measuring cry1Ab mRNA and Cry1Ab protoxin
antigen contents of sporulating cells and inclusion-spore extracts. In
all cases, the cells were grown with glucose as the major carbon
source. Similar differences were found when other carbon sources were used, although the absolute -galactosidase specific activities differed (12).
The cry1Ab gene is present on a 40- to 50-kDa plasmid in all
of the subspecies examined (2, 7). The copy numbers appear to be very similar based on hybridization in slot blots of total DNA
with a cry1Ab-specific probe (2). In addition,
differences in transcription were found with identical lacZ
fusion plasmids, as well as with the same clone of the
cry1Ab gene (Fig. 4B).
This subspecies-dependent regulation is attributable to the region
upstream of the promoters since (i) there were no differences when only
the promoters were fused to lacZ, (ii) fusion of the cry1C upstream region did not result in any difference, and
(iii) the low level of transcription in strain 5 was enhanced by
mutations in the potential bend and IR regions (Fig. 1) in the
cry1A upstream sequence (Table 2). The segments used for
mutagenesis were selected because a DNA binding protein identified as
the E2 subunit of pyruvate dehydrogenase footprinted to these sites
(32). There were decreases in the rates of -galactosidase
synthesis (as well as in the maximum specific activities, as shown in
Table 2) in strains containing lacZ fusions with either the
bend or the IR region mutated (32).
There were similar differences in steady-state cry1Ab
mRNAs (Fig. 2), as well as in the relative accumulation of the
Cry1Ab protoxin in sporulating cells, between B. thuringiensis subsp. kurstaki and B. thuringiensis subsp. aizawai (Fig. 4A). The amounts of
this protoxin in spore-inclusion extracts and especially in purified
inclusions were somewhat variable. When Cry1Ab is the only protoxin
produced, it is unstable, but it is stabilized by disulfide
cross-linking to other protoxins in an inclusion (2, 23).
Perhaps this protoxin does not cross-link as well with the Cry1C and
Cry1D protoxins in B. thuringiensis subsp.
aizawai as it does with the more closely related Cry1Aa and
Cry1Ac protoxins in B. thuringiensis subsp.
kurstaki and thus is more unstable in the former subspecies.
It is known that media can influence protoxin accumulation
(13), so there may be catabolic properties unique to each
subspecies which account for the differences in expression of the
cry1Ab gene. This regulation may involve the relative amount
of soluble E2 present in sporulating cells of each subspecies. This
protein binds to cry gene upstream regions, and it could
regulate transcription (32). Alternatively, or in addition,
the protoxin compositions of the various subspecies may be a factor due
to the competition among the cry genes for limiting
transcription components (such as E and
K). This possibility is difficult to evaluate without
information about the protoxin gene complement of each subspecies, the
number of genes transcribed, and the extent of transcription of each gene (especially if the same sigma factors are used). Other unspecified subspecies differences may also influence the relative transcription of
the genes. Whatever regulatory mechanism is involved, the gene-specific differences and the abilities of mutations in the cry1A
upstream region to overcome low-level expression of the lacZ
fusion in B. thuringiensis subsp. aizawai must be
accounted for.
There are obvious practical implications for the differential
expression of cry genes. Growth and sporulation conditions
could affect the overall protoxin composition of inclusions and thus the toxicity profile. This regulation is likely to be significant to
B. thuringiensis in its natural environment, a possibility which is worth exploring.
| |
ACKNOWLEDGMENTS |
This research was supported by grant MCB-9600584 from the
National Science Foundation and by Abbott Laboratories. Ping Cheng was
a visiting scientist supported by the Ministry of Agriculture, People's Republic of China.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biological Sciences, Purdue University, West Lafayette, IN 47907. Phone: (765) 494-4992. Fax: (765) 494-0876. E-mail:
aaronson{at}bilbo.bio.purdue.edu.
| |
REFERENCES |
| 1.
|
Agaisse, H., and D. Lereclus.
1995.
How does Bacillus thuringiensis produce so much insecticidal crystal protein?
J. Bacteriol.
177:6027-6032[Free Full Text].
|
| 2.
|
Aronson, A.
1995.
The protoxin composition of Bacillus thuringiensis insecticidal inclusions affects solubility and toxicity.
Appl. Environ. Microbiol.
61:4057-4060[Abstract].
|
| 3.
| Aronson, A. Unpublished results.
|
| 4.
|
Aronson, A. I.,
W. Angelo, and S. C. Holt.
1971.
Regulation of extracellular protease production in Bacillus cereus T: characterization of mutants producing altered amounts of protease.
J. Bacteriol.
106:1016-1025[Abstract/Free Full Text].
|
| 5.
|
Aronson, A. I.,
E.-S. Han,
W. McGaughey, and D. Johnson.
1991.
The solubility of inclusion proteins from Bacillus thuringiensis is dependent upon protoxin composition and is a factor in toxicity to insects.
Appl. Environ. Microbiol.
57:981-986[Abstract/Free Full Text].
|
| 6.
|
Aronson, A. I.
1993.
The two faces of Bacillus thuringiensis: insecticidal proteins and post-exponential survival.
Mol. Microbiol.
7:489-496[Medline].
|
| 7.
|
Aronson, A. I.
1994.
Flexibility in the protoxin composition of Bacillus thuringiensis.
FEMS Microbiol. Lett.
117:21-28[Medline].
|
| 8.
|
Arvidson, H.,
P. E. Dunn,
S. Strand, and A. I. Aronson.
1989.
Specificity of Bacillus thuringiensis for lepidopteran larvae: factors involved in vivo and in the structure of a purified protoxin.
Mol. Microbiol.
3:1533-1543[Medline].
|
| 9.
|
Baum, J. A., and T. Malvar.
1995.
Regulation of insecticidal crystal protein production in Bacillus thuringiensis.
Mol. Microbiol.
18:1-12[Medline].
|
| 10.
|
Birnboim, H. C., and J. Doly.
1979.
A rapid alkaline extraction procedure for screening recombinant plasmid DNA.
Nucleic Acids Res.
7:1513-1523[Abstract/Free Full Text].
|
| 11.
|
Carozzi, N. B.,
V. C. Kramer,
G. W. Warren,
S. Evola, and M. G. Koziel.
1991.
Prediction of insecticidal activity of Bacillus thuringiensis strains by polymerase chain reaction product profiles.
Appl. Environ. Microbiol.
57:3057-3061[Abstract/Free Full Text].
|
| 12.
| Cheng, P., and A. Aronson. Unpublished results.
|
| 13.
|
Dulmage, H. T.
1970.
Production of the spore- -endotoxin complex by variants of Bacillus thuringiensis in two fermentation media.
J. Invertebr. Pathol.
16:385-389[Medline].
|
| 14.
| Geiser, M. Personal communication.
|
| 15.
|
Hofte, H., and H. R. Whiteley.
1989.
Insecticidal crystal proteins of Bacillus thuringiensis.
Microbiol. Rev.
53:242-255[Abstract/Free Full Text].
|
| 16.
|
Jaquet, F.,
R. Hutter, and P. Luthy.
1987.
Specificity of Bacillus thuringiensis delta-endotoxins.
Appl. Environ. Microbiol.
53:500-504[Abstract/Free Full Text].
|
| 17.
|
Juarez-Perez, V. M.,
M. D. Ferrandis, and R. Frutos.
1997.
PCR-based approach for the detection of novel Bacillus thuringiensis crystal genes.
Appl. Environ. Microbiol.
63:2997-3002[Abstract].
|
| 18.
|
Kuo, W.-S., and K.-F. Chak.
1996.
Identification of novel cry-type genes from Bacillus thuringiensis strains on the basis of restriction fragment length polymorphism of the PCR-amplified DNA.
Appl. Environ. Microbiol.
62:1369-1377[Abstract].
|
| 19.
|
Lee, M. K.,
A. Curtiss,
E. Alacantra, and D. H. Dean.
1996.
Synergistic effects of the Bacillus thuringiensis toxins Cry1Aa and Cry1Ac on the gypsy moth, Lymantria dispar.
Appl. Environ. Microbiol.
62:583-586[Abstract].
|
| 20.
|
Masson, L.,
G. Pre'fontaine,
L. Pe'loquin, and P. C. K. Lau.
1989.
Comparative analysis of the individual protoxin constituents in P1 crystals of Bacillus thuringiensis subsp. kurstaki isolates NRD12 and HD1.
Biochem. J.
269:507-512.
|
| 21.
|
Masson, L.,
M. Erlandson,
M. Puzstai-Carey,
R. Brousseau,
V. Juarez-Perez, and R. Frutos.
1998.
A holistic approach for determining the entomopathogenic potential of Bacillus thuringiensis strains.
Appl. Environ. Microbiol.
64:4782-4788[Abstract/Free Full Text].
|
| 22.
|
Miller, J. H.
1972.
Experiments in molecular genetics, p. 352-355.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 23.
|
Minnich, S. A., and A. I. Aronson.
1984.
Regulation of protoxin synthesis in Bacillus thuringiensis.
J. Bacteriol.
158:447-454[Abstract/Free Full Text].
|
| 24.
|
Mohammed, S. I.,
D. E. Johnson, and A. I. Aronson.
1996.
Altered binding of the Cry1Ac toxin to larval membranes but not to the toxin-binding protein in Plodia interpunctella selected for resistance to different Bacillus thuringiensis isolates.
Appl. Environ. Microbiol.
62:4168-4173[Abstract].
|
| 25.
|
Moran, C. P., Jr.
1993.
RNA polymerase and transcription factors, p. 653-668.
In
A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and other gram-positive bacteria. American Society for Microbiology, Washington, D.C.
|
| 26.
|
Prefontaine, G.,
P. Fast,
P. C. K. Lau,
M. A. Hefford,
Z. Hanna, and R. Brousseau.
1987.
Use of oligonucleotide probes to study the relatedness of delta-endotoxin genes among Bacillus thuringiensis subspecies and strains.
Appl. Environ. Microbiol.
53:2808-2814[Abstract/Free Full Text].
|
| 27.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 28.
|
Schurter, W.,
M. Geiser, and D. Mathé.
1989.
Efficient transformation of Bacillus thuringiensis and B. cereus via electroporation: transformation of acrystalliferous strains with a cloned -endotoxin gene.
Mol. Gen. Genet.
218:177-181[Medline].
|
| 29.
| Sedlak, M., T. Walter, and A. Aronson. The function
of overlapping promoters in the regulation of Bacillus
thuringiensis protoxin genes. Submitted for publication.
|
| 30.
|
Smith, G. P., and D. J. Ellar.
1993.
Novel sequence elements associated with the cry1C gene from Bacillus thuringiensis subsp. aizawai.
Nucleic Acids Res.
16:6240[Free Full Text].
|
| 31.
|
Tabashnik, B. E.
1992.
Evaluation of synergism among Bacillus thuringiensis toxins.
Appl. Environ. Microbiol.
58:334-346.
|
| 32.
|
Walter, T., and A. Aronson.
1999.
Specific binding of the E2 subunit of pyruvate dehydrogenase to the upstream regions of Bacillus thuringiensis protoxin genes.
J. Biol. Chem.
274:7901-7906[Abstract/Free Full Text].
|
| 33.
|
Walter, T. M.
1995.
Regulation of cry gene transcription in Bacillus thuringiensis by a DNA binding protein which recognizes DNA elements upstream of the cry1Ab, cry1C and cry1D genes. PhD. thesis.
Purdue University, West Lafayette, Ind.
|
Applied and Environmental Microbiology, May 1999, p. 1849-1853, Vol. 65, No. 5
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Aronson, A. I., Bell, C., Fulroth, B.
(2005). Plasmid-Encoded Regulator of Extracellular Proteases in Bacillus anthracis. J. Bacteriol.
187: 3133-3138
[Abstract]
[Full Text]
-
Chang, L., Grant, R., Aronson, A.
(2001). Regulation of the Packaging of Bacillus thuringiensisdelta -Endotoxins into Inclusions. Appl. Environ. Microbiol.
67: 5032-5036
[Abstract]
[Full Text]
Top
Abstract
Introduction
