Previous Article | Next Article 
Applied and Environmental Microbiology, May 1999, p. 1973-1979, Vol. 65, No. 5
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
D-Pantothenate Synthesis in
Corynebacterium glutamicum and Use of panBC and
Genes Encoding L-Valine Synthesis for
D-Pantothenate Overproduction
Hermann
Sahm and
Lothar
Eggeling*
Institut für Biotechnologie,
Forschungszentrum Jülich GmbH, 52425 Jülich, Germany
Received 11 January 1999/Accepted 1 March 1999
 |
ABSTRACT |
D-Pantothenate is synthesized via four enzymes from
ketoisovalerate, which is an intermediate of branched-chain amino acid synthesis. We quantified three of these enzyme activities in
Corynebacterium glutamicum and determined specific
activities ranging from 0.00014 to 0.001 µmol/min mg
(protein)
1. The genes encoding the
ketopantoatehydroxymethyl transferase and the pantothenate synthetase
were cloned, sequenced, and functionally characterized. These studies
suggest that panBC constitutes an operon. By using
panC, an assay system was developed to quantify D-pantothenate. The wild type of C. glutamicum
was found to accumulate 9 µg of this vitamin per liter. A strain was
constructed (i) to abolish L-isoleucine synthesis, (ii) to
result in increased ketoisovalerate formation, and (iii) to enable its
further conversion to D-pantothenate. The best resulting
strain has ilvA deleted from its chromosome and has two
plasmids to overexpress genes of ketoisovalerate (ilvBNCD) and D-pantothenate (panBC) synthesis. With this
strain a D-pantothenate accumulation of up to 1 g/liter is
achieved, which is a 105-fold increase in concentration
compared to that of the original wild-type strain. From the series of
strains analyzed it follows that an increased ketoisovalerate
availability is mandatory to direct the metabolite flux into the
D-pantothenate-specific part of the pathway and that the
availability of
-alanine is essential for D-pantothenate formation.
 |
INTRODUCTION |
D-Pantothenate is a
water-soluble vitamin required as a pharmaceutical and a feed additive.
About 4,000 tons of pantothenate are produced annually (48).
The present method of production depends for the most part on chemical
synthesis from bulk chemicals. However, this synthesis requires the
optical resolution of racemic intermediates. Therefore, a variety of
routes have been assayed to improve its synthesis, including enzyme
conversions (41). One of the processes of
D-pantothenate synthesis uses a lactonohydrolase activity
of Fusarium oxysporum, which catalyzes the
stereospecific hydrolysis of chemically made
D,L-pantolactone to generate D-pantolactone as
a chiral building block for its further chemical conversion to
D-pantothenate (19). Therefore, there is
still potential for further improving D-pantothenate
production, for instance, by its direct microbial synthesis.
In Escherichia coli the specific biosynthesis pathway of
this vitamin consists of only four steps (Fig.
1). The first reaction, catalyzed by the
ketopantoatehydroxymethyl transferase, uses the L-valine
intermediate 2-ketoisovalerate to generate ketopantoate, which is
reduced to D-pantoic acid. An
aspartate-
-decarboxylase activity generates
-alanine,
which is ligated with pantoic acid to yield D-pantothenate.
The respective enzymes of E. coli and Salmonella
typhimurium have been characterized, and the corresponding genes
have been identified (11, 15). Also for Bacillus
subtilis, transferase and ketopantoate reductase activities have
been demonstrated (1). In general, three different
mechanisms of
-alanine formation are thought to be present in
microorganisms (41).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1.
The pathway of D-pantothenate biosynthesis
and its integration into the synthesis of branched-chain amino acids.
|
|
We are interested in metabolite flux analysis in the gram-positive
bacterium Corynebacterium glutamicum (25). This
bacterium is used for the large-scale production of
L-lysine and L-glutamate (22). It
has a high capacity to supply precursor metabolites (26),
and its molecular physiology of amino acid synthesis has been analyzed
in detail (36). We have also developed strains producing L-isoleucine (7), the synthesis of
which uses enzymes in part identical to those required for the
synthesis of L-valine (Fig. 1). Due to the linkage of
the branched-chain amino acid synthesis with the short reaction
sequence of D-pantothenate synthesis, the analysis of
D-pantothenate formation with C. glutamicum is an attractive target. Moreover, a closely related bacterium,
Brevibacterium ammoniagenes, has already been reported to
accumulate coenzyme A, which is synthesized from
D-pantothenate (42). In the present work, we
analyze enzymes and genes involved in D-pantothenate synthesis by C. glutamicum and study their use, together
with genes of branched-chain amino acid synthesis, for the direct
microbial synthesis of D-pantothenate.
 |
MATERIALS AND METHODS |
Strains, plasmids, and cultivations.
The strains and
plasmids used are shown in Table 1.
C. glutamicum was grown on brain heart infusion medium or
minimal medium CGXII (20). E. coli was grown in
Luria broth or minimal medium M9 (45). The cultivations of
strains containing the pEKx2 plasmids were done in the presence of 1 mM
IPTG (isopropyl-
-D-thiogalactopyranoside) added 5 h
after inoculation.
Metabolite quantifications.
D-Pantothenate was
quantified in a microbiological assay with C. glutamicum
R127::panC (this work). For this purpose, cells of
this strain were precultivated overnight on brain heart infusion medium
(with 25 µg of kanamycin [Difco]), washed twice with 9 g of
NaCl per liter, and inoculated into minimal medium CGXII (with 25 µg
of kanamycin) to obtain an initial optical density at 600 nm
(OD600) of 0.5. This served to deprive the cells of D-pantothenate. Although D-pantothenate had not
been supplied, growth of the cells was possible up to an
OD600 of about 20 (the control strain, C. glutamicum R127, reaches an OD600 of about 40). One
milliliter of the pantothenate-deprived culture (taken after 30 h)
was mixed with 700 µl of glycerol and stored at
70°C. Sixty-microliter aliquots of these stocks were used to inoculate assay
tubes. These assay tubes (Falcon 2057; Becton and Dickinson) contained
3 ml of four-thirds concentrated CGXII medium (with 25 µg of
kanamycin), 1 ml of sterile filtered D-pantothenate sample, and C. glutamicum R127::panC (60 µl).
Tubes were cultivated for 40 h at 30°C with shaking, and the
OD600 was determined. On the basis of results from this
procedure, growth is linearly dependent on the concentration of
D-pantothenate over a broad concentration range (Fig.
2), which is a clear advantage compared
to the standard D-pantothenate determination with
Lactobacillus plantarum ATCC 8014 according to the U.S.
Pharmacopoeial Convention. When assays for one sample were repeated,
the standard deviation for 10 ng of D-pantothenate per ml
was ± 0.9 ng. The assay is linear in the range from 0 to 100 ng
of D-pantothenate per assay (4 ml). In the case of
nonlinear growth obtained with new glycerol stock cultures of the
panC mutant, the inoculum varied between 60 and 100 µl.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 2.
D-Pantothenate quantification for C. glutamicum::panC ( ) and L. plantarum ( ). The D-pantothenate concentration
given is the final concentration in the assay.
|
|
L-Valine and

-alanine were quantified by automated
precolumn derivatization with
ortho-phthaldialdehyde
(
24), followed
by reversed-phase chromatography
with fluorometric detection (model
HP LC1090; Hewlett Packard).

-Ketoisovalerate was derivatized
with
diaminomethoxybenzole (
12) and again quantified by
reversed-phase
chromatography and fluorometric
detection.
Enzyme activity determinations.
A crude extract of cells
taken from the late-exponential phase was prepared by sonication.
The level of ketopantoatehydroxymethyl transferase activity
was determined by quantifying the ketoisovalerate formation from
ketopantoate. The assay mixture consisted of 71 mM potassium phosphate
(pH 6.8), 1 mM MgSO4, 3.6 mM ketopantoate, and 0.71 mM
tetrahydrofolate. The reaction was started by the addition of the crude
extract, which was equilibrated prior to use on PD10 columns
(LKB-Pharmacia) with 100 mM potassium phosphate (pH 6.8), and was run
at 37°C for 60 min.
The pantothenate synthetase activity was assayed, with minor
modifications, as described previously (
29). The assay
mixture
consisted of 100 mM Tris-HCl (pH 10), 10 mM MgSO
4,
5 mM
D,L-pantoate,
5 mM

-alanine, and 10 mM ATP. After
the addition of the crude
extract the assay mixture was incubated at
30°C for 40 min, and
the assay was then terminated by the addition of
5 volumes of
isatoic acid anhydride (to a concentration of 3.2 mM in
dimethylformamide).
This enabled the quantification of pantothenate by
reversed-phase
chromatography as described by Julliard (
18).
The aspartate

-decarboxylase activity was quantified by

-alanine
formation in a reaction mixture containing 100 mM potassium
phosphate
buffer (pH 7.5), 5 mM EDTA (pH 7.5), and 5 mM
L-aspartate.
The reaction was started by the addition of the crude extract
to the
mixture and was run for 60 min at 37°C.
Gene bank and sequence analysis.
The gene bank used was as
described previously (32). The sequence for both strands of
the 2,164-bp fragment was determined by the dideoxy chain termination
method on subclones derived from exonuclease treatment of pUR1.1 and
pUR1.2. Additional sequence information covering xylB was
obtained by primer walking.
Plasmid constructions.
All plasmid constructions were
done in E. coli DH5
mcr. Plasmid
pJC1ilvBNCD was obtained by ligating a 2.6-kb
XbaI fragment containing ilvD into the
BamHI site of pKK5 (2). To obtain pECM3ilvBNC a 5.7-kb fragment of pKK5 encompassing
ilvBNC was cloned into the EcoRV site of pECM3.
Additionally, a 5.7-kb XbaI fragment (ilvBNC) of
pKK5 and a 3.1-kb XbaI fragment (ilvD) were ligated with EcoRV-digested pECM3 to yield
pECM3ilvBNCD. Plasmid pEC7panD was
constructed by ligating a 900-bp PvuII fragment of pDKS1,
containing panD of E. coli (35), with
SmaI-digested pEC7. To construct pEKEx2panBC, the
5' region of panB was amplified with the primers
5'GATCGTCGACCATCACATCTATACTCATGCCC and
5'ACCCGATGTGGCCGACAACC. The resulting PCR fragment was
treated with SalI and EcoRI and ligated with the
identically treated pEKEx2. The plasmid obtained was cleaved with
EcoRI and ligated with the 1.8-kb EcoRI fragment of pUR1, containing the 3' end of panB and panC.
Strain constructions.
To construct the ilvA
deletion mutant of C. glutamicum ATCC 13032, the 242-bp
BglII fragment of ilvA was deleted in pBM21 (30). Subsequently, the fragment with the deletion was
excised as a 1.3-kb EcoRI fragment, which was ligated with
pK19mobsacB (39). The resulting mobilizable E. coli vector enabled the transfer of the deletion into the
chromosome of C. glutamicum by two rounds of positive
selection. The deletion was confirmed by PCR.
To construct the
panC insertion mutant of
C. glutamicum R127, an internal 168-bp
panC fragment was
amplified with the primers
5'GTTCGCACCCGATGTGGAGG and
5'ATGCACGATCAGGGCGCACC. The fragment
was cloned into the
SmaI site of pUC18 with the SureClone ligation
kit
(Amersham), subsequently excised as an
EcoRI/
SalI fragment,
and finally ligated with
EcoRI/
SalI-treated pK18mob (
39). The
resulting vector was transferred to
C. glutamicum via
conjugation
(
38), and kanamycin-resistant transconjugants
were obtained.
One strain selected was termed
C. glutamicum
R127::
panC. Its
D-pantothenate
auxotrophy was verified, as well as the vector integration into
the
chromosome.
To construct the open reading frame (ORF) 1 insertion mutant of
C. glutamicum R127, an internal 202-bp ORF 1 fragment was
amplified with the primers 5'GATCGAATTCCCGATTAAATCGCGGAGACGG
and
5'GATCGTCGACCTTTGCTGCCGATTCAAGTG. The fragment was
digested with
EcoRI and
SalI and ligated with the
EcoRI/
SalI-treated pK19mobsacB.
This vector was
used to construct
C. glutamicum R127::orf1, whose
correct integration of the vector into ORF 1 was verified via
PCR.
Nucleotide sequence accession number.
The sequence for both
strands of the 2,164-bp fragment was deposited in the EMBL and GenBank
databases under accession no. X96580.
 |
RESULTS |
Cloning and sequence analysis of panBC.
The E. coli panB mutant SJ2 (4) was transformed to ampicillin
resistance with genomic DNA of C. glutamicum ATCC 13032 ligated with pBR322. This yielded eight plasmids able to restore the
growth of SJ2 on minimal medium plates. They were found to contain
three different inserts of 9.3, 2.1, and 1.8 kb, respectively. The
insert in the largest plasmid, named pUR1 (Fig.
3), was assayed by a Southern blot
analysis of ScaI-digested chromosomal DNA (data not shown)
with the 1.5-kb PvuII/SalI fragment as a
probe. This confirmed the origin and structural identity of the large
fragment cloned. The isolated plasmids were used to assay for an
additional complementation of the panC mutation of E. coli DV39 (47). Plasmid pUR1 complemented this
mutation, whereas the two smaller plasmids failed to do so. To further
confine the complementing functions, several subclones were made.
Whereas pUR1.1 only complemented the mutation in E. coli SJ2, pUR1.2 complemented the mutations of both E. coli strains. A nucleotide sequence of 2.2 kb from the insert of
pUR1 was determined on both strands, whereas the sequence for an
adjacent 1.5-kb part was established on one strand only (Fig. 3).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 3.
Overview of the cloned and subcloned chromosomal
fragments (A), the sequenced part and organization of the genes (B),
and the overlaps of panB with panC and those of
panC with xylB (C). S, SalI; Sc,
ScaI; Sa, SalI; P, PstI; Sp,
SphI.
|
|
The sequence analyses identified four ORFs. ORF 1 exhibits no
identities with known sequences. Inactivation of ORF 1 in
C. glutamicum R127::orf1 resulted in a decreased growth
rate (µ =
0.31 h
1; µ = 0.38 h
1 [for
C. glutamicum R127]), which could not be restored by the
addition of
D-pantothenate (data not shown). Interestingly,
amino
acid residues 64 to 89 encoded by ORF 1 fit exactly to the
consensus
sequence of the helix-turn-helix motif of LysR-type
regulators
(
40). Therefore, it is proposed that ORF 1 encodes a transcriptional
regulator which is functionally not related
to
D-pantothenate
synthesis in
C. glutamicum.
The deduced amino acid sequence encoded
by the second ORF (nucleotides
351 to 1166) exhibits a high identity
with PanB, as does that encoded
by the third ORF (nucleotides
1166 to 2005) with PanC polypeptides. The
highest identities are
shared with PanB of
Mycobacterium
tuberculosis (52%) and PanC
of
Schizosaccharomyces
pombe (45%), respectively. The fourth ORF
is located on the
strand opposite to that of the
pan genes. Its
deduced
polypeptide shows significant homology to xylulokinases
(encoded by
xylB).
Enzyme activity determinations.
To functionally characterize
the genes, enzyme activity determinations in the homologous background
were performed. For this purpose, the
ScaI/ SalI fragment of pUR1.2 was ligated
with the E. coli-C. glutamicum shuttle vector
pZ1 (27) to yield pZ1panBC and with the
BstEII/SalI fragment to yield pZ1panC
(Fig. 3). With these plasmids the wild type of C. glutamicum
was transformed. The resulting recombinant strains were grown on
minimal medium, and cells were harvested for activity determinations.
The ketopantoatehydroxymethyl transferase activity (
panB)
was determined in a novel assay based on the quantification of
ketoisovalerate
formed from ketopantoate (see Materials and Methods).
With
C. glutamicum/pZ1
panBC a specific activity
of 1.9 nmol/min/mg of
protein was obtained, whereas the control yielded
an activity
of 0.14 nmol/min/mg of protein (Table
2). This ~13-fold increase
in synthesis
confirms the identity of
panB. It is reported that
D-pantothenate and
D-pantoate inhibit the
transferase activity
in
E. coli (
33) and
salicylate the enzyme in
S. typhimurium (
34).
Therefore, these compounds were included individually
at 10 mM
concentrations in the enzyme assay with the extract of
C. glutamicum. Only a marginal effect with
D-pantothenate
was
detected, but
D,L-pantoate reduced the transferase
activity to
20% and salicylate to 22%.
The activity of the pantothenate synthetase (encoded by
panC) was determined in
C. glutamicum/pZ1
panBC. It is 12 nmol/min/mg
of
protein, opposed to 1 nmol/min/mg of protein in the control
(Table
2).
However, with
C. glutamicum/pZ1
panC, no
increased
specific activity was detected. This suggests the
organization
of
panBC as an operon, as indicated from the
sequence of the
cluster.
In addition to the quantification of the transferase and synthase
activities, we also assayed
C. glutamicum for aspartate
decarboxylase activity with a novel assay by quantification of

-alanine via high-pressure liquid chromatography. As shown in
Table
2, this enzyme has a specific activity of 0.11 nmol/min/mg
of protein.
For comparison Table
2 also includes decarboxylase,
transferase, and
synthetase activities for
E. coli. It can be
seen that the
enzyme activities in
E. coli are in the same order
of
magnitude, except that of the transferase, which is at least
1 order of
magnitude
higher.
D-Pantothenate formation by the wild type.
To
assay for D-pantothenate accumulation by C. glutamicum, the wild type was grown in minimal medium. In samples
of sterile filtered culture supernatants, D-pantothenate
was quantified in the assay developed (see Materials and Methods). As
can be seen in Fig. 4, there is only a
very weak accumulation of maximal 42 nM D-pantothenate in
culture supernatants, which is in accord with the low activities and/or
a tight control of D-pantothenate synthesis. The unexpected
time course of the D-pantothenate concentrations shown in
Fig. 4 was verified in a separate experiment. With the wild type
of E. coli a D-pantothenate accumulation
of 3 mg/liter has been reported (14). In an additional
experiment a recombinant C. glutamicum strain was made and
assayed for D-pantothenate formation. This strain was
C. glutamicum/pZ1panBC, which additionally
contained the plasmid-encoded L-aspartate
decarboxylase (panD) of E. coli (see Materials
and Methods). This strain overexpressing three of the
D-pantothenate biosynthesis genes again exhibited a time course of D-pantothenate accumulation almost identical to
that of the wild type and also not exceeding 42 nM as the highest
concentration. Further engineering was therefore required.
Increased D-pantothenate formation by ilvA
deletion.
We first assayed the consequences of the deletion of the
threonine dehydratase gene ilvA on a flux increase towards
D-pantothenate. This was based on the idea that due to the
prevention of L-isoleucine synthesis an increased pyruvate
availability could result in increased ketoisovalerate accumulation
with further conversion to D-pantothenate (Fig. 1). By the
application of two rounds of positive selection for the presence and
absence of vector sequences, respectively (39), a C. glutamicum wild-type derivative was constructed with the internal
242-bp BglII fragment of ilvA deleted from the
chromosome. The D-pantothenate concentration after
24 h of cultivation in minimal medium by the C. glutamicum
ilvA deletion mutant obtained was 236 nM, which is about a
fivefold increase compared to that of the wild type (see above).
L-Valine accumulation by overexpressing ilv
genes.
Based on the increased D-pantothenate
accumulation as a consequence of the ilvA deletion, a
further flux increase was attempted by overexpressing the common genes
required for L-valine and L-isoleucine synthesis (Fig. 1). For this purpose pKK5 encoding ilvBNC
(2) was used, thus resulting in high-level acetohydroxy acid
synthase and isomeroreductase activities. In addition the recently
cloned ilvD gene (30a) was used. This gene was
ligated with pKK5 to yield pJC1ilvBNCD. As a further
construct pECM3ilvBNCD was made, which confers
chloramphenicol resistance in contrast to pJC1ilvBNCD. The
plasmids were used to transform C. glutamicum and its
ilvA deletion mutant. The strains constructed were
cultivated in minimal medium, and L-valine accumulations
were determined after 48 h of cultivation when glucose was
consumed. The highest L-valine concentration obtained was
79 mM, whereas the wild type accumulated only 1 mM (Fig.
5). The strains with the ilvA
deletions accumulated higher L-valine concentrations than
the ilvA+ strains. Furthermore, ilvD
overexpression is necessary to obtain the maximal L-valine
accumulation. As a third outcome, it is evident that the basis vector
itself influences L-valine accumulations, although both
vectors use the same C. glutamicum replicon.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 5.
L-Valine accumulation with isogenic
C. glutamicum strains. Below the columns the genotype of
each strain is given, which is either ilvA+ or
ilvA. The strains additionally carry the plasmid pECM3 or
pJC1 carrying ilvBNC or ilvBNCD,
respectively.
|
|
D-Pantothenate accumulation by combined overexpression
of ilv and pan genes.
To exploit the
increased capability of L-valine formation for increased
D-pantothenate accumulation, the four ilv genes
were overexpressed together with panBC. To enable their
common overexpression, compatible plasmids were required. For this
purpose, the chromosomal 2.2-kb fragment encompassing panBC
was engineered, as outlined in Materials and Methods, to be cloned into
the expression vector pEKEx2, which carries the pBL1 replicon
(37) and confers kanamycin resistance, to yield
pEKEx2panBC. Furthermore, panBC was ligated with pEC7 by using the same replicon (but conferring chloramphenicol resistance) to yield pEC7panBC. Starting from the
C. glutamicum ilvA deletion mutant carrying
pJC1ilvBNCD, a C. glutamicum ilvA deletion
mutant carrying pJC1ilvBNCD and
pEC7panBC was made, and starting from the C. glutamicum ilvA deletion mutant carrying pECM3ilvBNCD, a C. glutamicum ilvA deletion
mutant carrying pECM3ilvBNCD and pEKEx2panBC was
made. The D-pantothenate accumulations obtained with these
strains in the standard minimal medium containing 20 mM
-alanine are
shown in Fig. 6. First of all, the
L-valine-producing C. glutamicum ilvA deletion
mutant carrying pJC1ilvBNCD and pEC7 (control [without
panBC overexpressed]) already accumulated up to 0.53 mM
D-pantothenate after 49 h (Fig. 6). Without
-alanine addition the accumulation was only 0.87 µM, thus showing
the absolute requirement of this amino acid derivative for increased
D-pantothenate formation (data not shown). When
additionally panBC was overexpressed (the ilvA
deletion mutant carrying pJC1ilvBNCD and
pEC7panBC) the D-pantothenate was accumulated to
a concentration of 2.1 mM. This strong effect of panBC
overexpression is also apparent with the second gene combination.
Whereas the ilvA deletion mutant carrying
pECM3ilvBNCD and pEKEx2 accumulated 0.43 mM
D-pantothenate, the ilvA deletion mutant
carrying pEKEx2panBC accumulated as much as a 4.2 mM
concentration of the vitamin, which is a 105-fold-higher
concentration than that obtained with the wild type. After 74 h
the pantothenate accumulations quantified were almost the same as those
at the earlier point in time.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 6.
D-Pantothenate accumulation with
plasmid-carrying strains derived from the C. glutamicum ilvA
deletion mutant. pJilv, pJC1ilvBNCD;
pEilv, pECM3ilvBNCD; pEpan,
pEC7panBC; pEKpan, pEKEx2panBC; pE,
pEC7.
|
|
 |
DISCUSSION |
In the present work the genes panB and panC
of C. glutamicum were cloned and were found to be clustered.
In B. subtilis and E. coli an identical
organization of the two genes is present (28, 44). For the
latter organism a transcriptional analysis has revealed a significantly
larger transcript of panB than expected from the size of
that gene, suggesting the cotranscription of a second gene
(17). According to recent genome information this could well
be panC. There is evidence that in C. glutamicum
panB and panC constitute an operon. The sequence shows
that both genes overlap by one nucleotide (Fig. 3), which has been
demonstrated for amino acid biosynthetic genes to be evidence of a
close translational coupling (31). In addition to this
structural feature, the functional characterization of
pantothenate synthetase activities supports the conclusion that
panBC in C. glutamicum forms an operon. Whereas with a panBC-containing fragment an increased
synthetase activity was the result, this was not the case with a
fragment containing panC, which included a significant
chromosomal part of the 5' region of the gene.
The three enzymes of the D-pantothenate synthesis
quantified have specific activities of around 1 nmol/min/mg of protein. This is extremely low compared to the specific activities of
enzymes of amino acid synthesis, which are about 2 orders of magnitude higher, or that of enzymes of the central metabolism, whose specific activities are increased by as many as 3 orders of magnitude. This
may be due to different enzyme amounts and consequently different expression levels. As the expression levels of genes of amino acid
synthesis and of the central metabolism are shown to be directly related to the degree of codon bias in C. glutamicum
(10), as is the case for other organisms too, it was
interesting to inspect the codon usage of the cloned pan
genes. This was done together with the biotin biosynthesis genes
(bioABD) of C. glutamicum (13). This
analysis revealed that in fact the codon usage of the vitamin biosynthesis genes of C. glutamicum is less biased than that
of the high and moderately expressed genes. As a consequence, the preferred codon for vitamin biosynthesis genes is, in 6 of 19 cases,
different from that of the high and moderately expressed genes, for
which almost exclusively the same codon is used (data not shown). Since
the D-pantothenate accumulation is in part dependent on the
vector used (Fig. 6), which might reflect different expression levels,
the design of pan genes by the use of appropriate codons is
an option to obtain optimal expression levels for increased product accumulation.
From the enzyme activity determinations it is furthermore evident that
the pathway of D-pantothenate synthesis in the
gram-positive bacterium C. glutamicum is identical to that
of the gram-negative bacterium E. coli, where
-alanine is
not uracil derived as in plants, for instance. Also the
feedback inhibition of the ketopantoatehydroxymethyl transferase by
pantoate is comparable in both organisms (33). The
inhibition of the transferase activity of C. glutamicum by the false feedback inhibitor salicylate reflects the situation described for S. typhimurium (34). An
important difference is the inhibition of the transferase in E. coli by D-pantothenate. In a concentration of 2.5 mM
this effector reduces the enzyme activity of E. coli by
about 50% (33), whereas the enzyme of C. glutamicum is almost unaffected by 10 mM
D-pantothenate.
The increased D-pantothenate accumulation by C. glutamicum required a concerted engineering of the metabolite flux
similar to that experienced during the construction of
L-isoleucine-producing strains (7). One
important feature in obtaining a D-pantothenate accumulation is the deletion of ilvA, which encodes the key
enzyme of isoleucine synthesis (30). There are three
possibilities of explaining this effect. The first is that the
catalytic activity of the single acetohydroxy acid synthase present
in C. glutamicum (20) is, after the deletion of
ilvA, exclusively available for ketoisovalerate synthesis.
The second is that L-isoleucine no longer exerts its
inhibitory effect by an allosteric interaction with the acetohydroxy
acid synthase (6). The third is that due to the
introduced growth limitations, increased precursor metabolite
concentrations are available to enter the biosynthesis pathway. This is
known from several examples. For instance, a molecularly
introduced growth limitation results in an increased L-lysine accumulation by C. glutamicum
(8, 32), and a growth limitation obtained by an
appropriate process management results in an increased
L-phenylalanine accumulation by E. coli
(21).
The successful use of ilvBNCD overexpression to obtain an
increased D-pantothenate accumulation is due to the
increased ketoisovalerate availability. Only then does the
panBC overexpression result in a substantial accumulation of
D-pantothenate. It therefore follows that an increased
ketoisovalerate availability is mandatory to direct the metabolite flux
into the D-pantothenate-specific part of the pathway with
its low specific activities. Furthermore, the availability of
-alanine is essential, since without its addition no
substantial amounts of D-pantothenate accumulate with the
strain constructed. By using the appropriate tools and procedures developed in this study the low concentration of 10 µg of
D-pantothenate per liter accumulated by the wild type of
C. glutamicum was increased to the high concentration of
about 1 g of the vitamin per liter. A further improvement of
C. glutamicum appears possible to reach concentrations
which are in the range of those obtained for the amino acids
produced with this organism.
 |
ACKNOWLEDGMENTS |
We thank S. Jackowski for the E. coli strains, A. Ondrejková for the use of ilvD from C. glutamicum, K. Krumbach for help during the work, and Degussa AG
for the synthesis of enzyme substrates.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut
für Biotechnologie, Forschungszentrum Jülich GmbH, 52428 Jülich, Germany. Phone: 49 2461 61 5132. Fax: 49 2461 61 2710. E-mail: l.eggeling{at}fz-juelich.de.
 |
REFERENCES |
| 1.
|
Baigori, M.,
R. Grau,
H. R. Morbidoni, and D. de Mendoza.
1991.
Isolation and characterization of Bacillus subtilis mutants blocked in the synthesis of pantothenic acid.
J. Bacteriol.
173:4240-4242[Abstract/Free Full Text].
|
| 2.
|
Cordes, C.,
B. Möckel,
L. Eggeling, and H. Sahm.
1992.
Cloning and functional analysis of ilvA, ilvB and ilvC genes from Corynebacterium glutamicum.
Gene
112:113-116[Medline].
|
| 3.
|
Cremer, J.,
L. Eggeling, and H. Sahm.
1990.
Cloning of the dapA dapB cluster of Corynebacterium glutamicum.
Mol. Gen. Genet.
220:478-480.
|
| 4.
|
Cronan, J. E., Jr.
1980.
-Alanine synthesis in Escherichia coli.
J. Bacteriol.
141:1291-1297[Abstract/Free Full Text].
|
| 5.
|
Cronan, J. E., Jr.,
K. J. Littel, and S. Jackowski.
1982.
Genetic and biochemical analyses of pantothenate biosynthesis in Escherichia coli and Salmonella typhimurium.
J. Bacteriol.
149:916-922[Abstract/Free Full Text].
|
| 6.
|
Eggeling, I.,
C. Cordes,
L. Eggeling, and H. Sahm.
1987.
Regulation of acetohydroxy acid synthase in Corynebacterium glutamicum during fermentation of -ketobutyrate to L-isoleucine.
Appl. Microbiol. Biotechnol.
25:346-351.
|
| 7.
|
Eggeling, L.,
S. Morbach, and H. Sahm.
1997.
The fruits of molecular physiology: engineering the L-isoleucine biosynthesis pathway in Corynebacterium glutamicum.
J. Biotechnol.
56:167-182.
|
| 8.
|
Eggeling, L.,
S. Oberle, and H. Sahm.
1997.
Improved L-lysine yield with Corynebacterium glutamicum: use of dapA resulting in increased flux combined with growth limitation.
Appl. Microbiol. Biotechnol.
49:24-30.
|
| 9.
|
Eikmanns, B. J.,
E. Kleinertz,
W. Liebl, and H. Sahm.
1991.
A family of Corynebacterium glutamicum/Escherichia coli shuttle vectors for cloning, controlled gene expression, and promoter probing.
Gene
102:93-98[Medline].
|
| 10.
|
Eikmanns, B. J.
1992.
Identification, sequence analysis, and expression of a Corynebacterium glutamicum gene cluster encoding the three glycolytic enzymes glyceraldehyde-3-phosphate dehydrogenase, 3-phosphoglycerate kinase, and triosephosphate isomerase.
J. Bacteriol.
174:6076-6086[Abstract/Free Full Text].
|
| 11.
|
Frodyma, M. E., and D. Downs.
1998.
AbpA, the ketopantoate reductase enzyme of Salmonella typhimurium is required for the synthesis of thiamine via the alternative pyrimidine biosynthetic pathway.
J. Biol. Chem.
273:5572-5576[Abstract/Free Full Text].
|
| 12.
|
Hara, S.,
Y. Takemori,
T. Iwata,
M. Yamaguchi, and M. Nakamura.
1985.
Fluorimetric determination of -keto acids with 4,5-dimethoxy-1,2-diamino-benzene and its application to high-performance liquid chromatography.
Anal. Chim. Acta
172:167-173.
|
| 13.
|
Hatakeyama, K.,
K. Kohama,
A. A. Vertès,
M. Kobayashi,
Y. Kurusu, and H. Yukawa.
1993.
Genomic organization of the biotin biosynthetic genes of coryneform bacteria: cloning and sequencing of the bioA-bioD genes from Brevibacterium flavum.
DNA Sequence
4:177-184[Medline].
|
| 14.
|
Jackowski, S., and C. O. Rock.
1981.
Regulation of coenzyme A biosynthesis.
J. Bacteriol.
146:926-932.
|
| 15.
|
Jackowski, S.
1996.
Biosynthesis of pantothenic acid and coenzyme A, p. 687-694.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. American Society for Microbiology, Washington, D.C.
|
| 16.
|
Jäger, W.,
A. Schäfer,
A. Pühler,
G. Labes, and W. Wohlleben.
1992.
Expression of the Bacillus subtilis sacB gene leads to sucrose sensitivity in the gram-positive bacterium Corynebacterium glutamicum but not Streptomyces lividans.
J. Bacteriol.
174:5462-5465[Abstract/Free Full Text].
|
| 17.
|
Jones, C. E.,
J. M. Brook,
D. Buck,
C. Abell, and A. G. Smith.
1993.
Cloning and sequencing of the Escherichia coli panB gene, which encodes ketopantoate hydroxymethyltransferase, and overexpression of the enzyme.
J. Bacteriol.
175:2125-2130[Abstract/Free Full Text].
|
| 18.
|
Julliard, J. H.
1994.
Purification and characterization of oxopantoyl lactone reductase from higher plants: role in pantothenate biosynthesis.
Bot. Acta
107:191-200.
|
| 19.
|
Kataoka, M.,
K. Shimizu,
K. Sakamoto,
H. Yamada, and S. Shimizu.
1995.
Lactonohydrolase-catalyzed optical resolution of pantoyl lactone: selection of a potent enzyme producer and optimization of culture and reaction conditions for practical resolution.
Appl. Microbiol. Biotechnol.
44:333-338.
|
| 20.
|
Keilhauer, C.,
L. Eggeling, and H. Sahm.
1993.
Isoleucine synthesis in Corynebacterium glutamicum: molecular analysis of the ilvB-ilvN-ilvC operon.
J. Bacteriol.
175:5595-5603[Abstract/Free Full Text].
|
| 21.
|
Konstantinov, K. B.,
N. Nishino,
T. Seki, and T. Yoshida.
1991.
Physiologically motivated strategies for control of the fed-batch cultivation of recombinant Escherichia coli for phenylalanine production.
J. Ferment. Bioeng.
71:350-355.
|
| 22.
|
Leuchtenberger, W.
1996.
Amino acids technical production and use, p. 455-502.
In
H. J. Rehm, and G. Reed (ed.), Biotechnology, vol. 6. Products of primary metabolism. VCH Verlagsgesellschaft, Weinheim, Germany.
|
| 23.
|
Liebl, W.,
A. Bayerl,
B. Schein,
U. Stillner, and K. H. Schleifer.
1989.
High efficiency electroporation of intact Corynebacterium glutamicum cells.
FEMS Microbiol. Lett.
65:299-394.
|
| 24.
|
Lindroth, P., and K. Mopper.
1979.
High performance liquid chromatographic determination of subpicomole amounts of amino acids by precolumn fluorescence derivatization with o-phthaldialdehyde.
Anal. Chem.
51:1167-1174.
|
| 25.
|
Marx, A.,
A. A. de Graaf,
W. Wiechert,
L. Eggeling, and H. Sahm.
1996.
Determination of the fluxes in the central metabolism of Corynebacterium glutamicum by NMR spectroscopy combined with metabolite balancing.
Biotechnol. Bioeng.
49:111-129.
|
| 26.
|
Marx, A.,
K. Striegel,
A. A. de Graaf,
H. Sahm, and L. Eggeling.
1997.
Response of the central metabolism of Corynebacterium glutamicum to different flux burdens.
Biotechnol. Bioeng.
56:168-180.
|
| 27.
|
Menkel, E.,
G. Thierbach,
L. Eggeling, and H. Sahm.
1989.
Influence of increased aspartate availability on lysine formation by a recombinant strain of Corynebacterium glutamicum and utilization of fumarate.
Appl. Environ. Microbiol.
55:684-688[Abstract/Free Full Text].
|
| 28.
|
Merkel, W. K., and B. Nichols.
1996.
Characterization and sequence of the Escherichia coli panBCD gene cluster.
FEMS Microbiol. Lett.
143:247-252[Medline].
|
| 29.
|
Miyatake, K.,
Y. Nakano, and S. Kitaoka.
1976.
Pantothenate synthetase from Escherichia coli.
J. Biochem.
79:673-678[Abstract/Free Full Text].
|
| 30.
|
Möckel, B.,
L. Eggeling, and H. Sahm.
1994.
Threonine dehydratases of Corynebacterium glutamicum with altered allosteric control: their generation and biochemical and structural analysis.
Mol. Microbiol.
13:833-842[Medline].
|
| 30a.
| Ondrejková, A. Unpublished data.
|
| 31.
|
Oppenheim, D. S., and C. Yanofski.
1980.
Translational coupling during expression of the tryptophan operon of Escherichia coli.
Genetics
95:785-795[Abstract/Free Full Text].
|
| 32.
|
Pátek, M.,
K. Krumbach,
L. Eggeling, and H. Sahm.
1994.
Leucine synthesis in Corynebacterium glutamicum: enzyme activities, structure of leuA, and effect of leuA inactivation on lysine synthesis.
Appl. Environ. Microbiol.
60:133-140[Abstract/Free Full Text].
|
| 33.
|
Powers, S. G., and E. E. Snell.
1976.
Ketopantoate hydroxymethyltransferase.
J. Biol. Chem.
251:3786-3793[Abstract/Free Full Text].
|
| 34.
|
Primerano, D. A., and R. O. Burns.
1982.
Metabolic basis for the isoleucine, pantothenate or methionine requirement of ilvG strains of Salmonella typhimurium.
J. Bacteriol.
150:1202-1211[Abstract/Free Full Text].
|
| 35.
|
Ramjee, M. K.,
U. Genschel,
C. Abell, and A. G. Smith.
1997.
Escherichia coli L-aspartate- -decarboxylase: preprotein processing and observation of reaction intermediates by electrospray mass spectrometry.
Biochem. J.
323:661-669.
|
| 36.
|
Sahm, H.,
L. Eggeling,
B. J. Eikmanns, and R. Krämer.
1995.
Metabolic design in amino acid producing bacterium Corynebacterium glutamicum.
FEMS Microbiol. Rev.
16:243-252.
|
| 37.
|
Santamaria, R. I.,
J. A. Gil, and J. F. Martin.
1985.
High-frequency transformation of Brevibacterium lactofermentum protoplasts by plasmid DNA.
J. Bacteriol.
162:463-467[Abstract/Free Full Text].
|
| 38.
|
Schäfer, A.,
J. Kalinowski,
R. Simon,
A.-H. Seep-Feldhaus, and A. Pühler.
1990.
High-frequency conjugal plasmid transfer from gram-negative Escherichia coli to various gram-positive coryneform bacteria.
J. Bacteriol.
172:1663-1666[Abstract/Free Full Text].
|
| 39.
|
Schäfer, A.,
A. Tauch,
W. Jäger,
J. Kalinowski,
G. Thierbach, and A. Pühler.
1994.
Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum.
Gene
145:69-73[Medline].
|
| 40.
|
Schell, M. A.
1993.
Molecular biology of the LysR family of transcriptional regulators.
Annu. Rev. Microbiol.
47:597-626[Medline].
|
| 41.
|
Shimizu, S., and H. Yamada.
1992.
Enzymatic synthesis of chiral intermediates for D-pantothenate synthesis, p. 227-241.
In
R. Heinemann, and B. Wolnak (ed.), Opportunities with industrial enzymes. Bernard and Associates, Inc., Chicago, Ill.
|
| 42.
|
Shimizu, S.,
A. Esumi,
R. Komaki, and H. Yamada.
1984.
Production of coenzyme A by a mutant of Brevibacterium ammoniagenes resistant to oxypantetheine.
Appl. Environ. Microbiol.
48:1118-1122[Abstract/Free Full Text].
|
| 43.
|
Simon, R.,
U. Priefer, and A. Pühler.
1983.
A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria.
Bio/Technology
1:784-791.
|
| 44.
|
Sorokin, A.,
V. Azevedo,
E. Zumstein,
N. Galleron,
S. D. Ehrlich, and P. Serror.
1996.
Sequence analysis of the Bacillus subtilis chromosome region between the serA and kdg loci cloned in a yeast artificial chromosome.
Microbiology
142:2005-2016[Abstract/Free Full Text].
|
| 45.
|
Tanaka, S.,
S. A. Lerner, and E. C. C. Lin.
1967.
Replacement of a phosphoenolpyruvate-dependent phosphotransferase by a nicotinamide adenine dinucleotide-linked dehydrogenase for the utilization of mannitol.
J. Bacteriol.
93:642-648[Abstract/Free Full Text].
|
| 46.
|
Teller, J. H.,
S. G. Powers, and E. E. Snell.
1976.
Ketopantoate hydroxymethyltransferase. Purification and role in pantothenate biosynthesis.
J. Biol. Chem.
251:3780-3785[Abstract/Free Full Text].
|
| 47.
|
Vallari, D. S., and C. O. Rock.
1985.
Pantothenate transport in Escherichia coli.
J. Bacteriol.
162:1156-1161[Abstract/Free Full Text].
|
| 48.
|
Vandamme, E. J.
1992.
Production of vitamins, coenzymes and related biochemicals by biotechnological processes.
J. Chem. Technol. Biotechnol.
53:313-327[Medline].
|
| 49.
|
Williamson, J. M., and G. M. Brown.
1979.
Purification and properties of L-aspartate -decarboxylase, an enzyme that catalyses the formation of -alanine in Escherichia coli.
J. Biol. Chem.
254:8074-8082[Abstract/Free Full Text].
|
Applied and Environmental Microbiology, May 1999, p. 1973-1979, Vol. 65, No. 5
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Marienhagen, J., Eggeling, L.
(2008). Metabolic Function of Corynebacterium glutamicum Aminotransferases AlaT and AvtA and Impact on L-Valine Production. Appl. Environ. Microbiol.
74: 7457-7462
[Abstract]
[Full Text]
-
Blombach, B., Schreiner, M. E., Holatko, J., Bartek, T., Oldiges, M., Eikmanns, B. J.
(2007). L-Valine Production with Pyruvate Dehydrogenase Complex-Deficient Corynebacterium glutamicum. Appl. Environ. Microbiol.
73: 2079-2084
[Abstract]
[Full Text]
-
Stolz, M., Peters-Wendisch, P., Etterich, H., Gerharz, T., Faurie, R., Sahm, H., Fersterra, H., Eggeling, L.
(2007). Reduced Folate Supply as a Key to Enhanced L-Serine Production by Corynebacterium glutamicum. Appl. Environ. Microbiol.
73: 750-755
[Abstract]
[Full Text]
-
Kawaguchi, H., Vertes, A. A., Okino, S., Inui, M., Yukawa, H.
(2006). Engineering of a Xylose Metabolic Pathway in Corynebacterium glutamicum.. Appl. Environ. Microbiol.
72: 3418-3428
[Abstract]
[Full Text]
-
Huser, A. T., Chassagnole, C., Lindley, N. D., Merkamm, M., Guyonvarch, A., Elisakova, V., Patek, M., Kalinowski, J., Brune, I., Puhler, A., Tauch, A.
(2005). Rational Design of a Corynebacterium glutamicum Pantothenate Production Strain and Its Characterization by Metabolic Flux Analysis and Genome-Wide Transcriptional Profiling. Appl. Environ. Microbiol.
71: 3255-3268
[Abstract]
[Full Text]
-
Elisakova, V., Patek, M., Holatko, J., Nesvera, J., Leyval, D., Goergen, J.-L., Delaunay, S.
(2005). Feedback-Resistant Acetohydroxy Acid Synthase Increases Valine Production in Corynebacterium glutamicum. Appl. Environ. Microbiol.
71: 207-213
[Abstract]
[Full Text]
-
Xie, G., Keyhani, N. O., Bonner, C. A., Jensen, R. A.
(2003). Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change. Microbiol. Mol. Biol. Rev.
67: 303-342
[Abstract]
[Full Text]
-
Lange, C., Rittmann, D., Wendisch, V. F., Bott, M., Sahm, H.
(2003). Global Expression Profiling and Physiological Characterization of Corynebacterium glutamicum Grown in the Presence of L-Valine. Appl. Environ. Microbiol.
69: 2521-2532
[Abstract]
[Full Text]
-
Radmacher, E., Vaitsikova, A., Burger, U., Krumbach, K., Sahm, H., Eggeling, L.
(2002). Linking Central Metabolism with Increased Pathway Flux: L-Valine Accumulation by Corynebacterium glutamicum. Appl. Environ. Microbiol.
68: 2246-2250
[Abstract]
[Full Text]
-
Simic, P., Sahm, H., Eggeling, L.
(2001). L-Threonine Export: Use of Peptides To Identify a New Translocator from Corynebacterium glutamicum. J. Bacteriol.
183: 5317-5324
[Abstract]
[Full Text]