Previous Article | Next Article 
Applied and Environmental Microbiology, June 1999, p. 2636-2643, Vol. 65, No. 6
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Characterization of the Binding Protein-Dependent
Cellobiose and Cellotriose Transport System of the Cellulose
Degrader Streptomyces reticuli
Andreas
Schlösser,*
Jens
Jantos,
Karl
Hackmann, and
Hildgund
Schrempf
FB Biologie/Chemie, Universität
Osnabrück, D-49069 Osnabrück, Germany
Received 30 November 1998/Accepted 3 March 1999
 |
ABSTRACT |
Streptomyces reticuli has an inducible ATP-dependent
uptake system specific for cellobiose and cellotriose. By reversed
genetics a gene cluster encoding components of a binding
protein-dependent cellobiose and cellotriose ABC transporter was cloned
and sequenced. The deduced gene products comprise a regulatory protein
(CebR), a cellobiose binding lipoprotein (CebE), two integral membrane proteins (CebF and CebG), and the NH2-terminal part of an
intracellular
-glucosidase (BglC). The gene for the ATP binding
protein MsiK is not linked to the ceb operon. We have shown
earlier that MsiK is part of two different ABC transport systems, one
for maltose and one for cellobiose and cellotriose, in S. reticuli and Streptomyces lividans. Transcription of
polycistronic cebEFG and bglC mRNAs is induced
by cellobiose, whereas the cebR gene is transcribed independently. Immunological experiments showed that CebE is
synthesized during growth with cellobiose and that MsiK is produced in
the presence of several sugars at high or moderate levels. The
described ABC transporter is the first one of its kind and is the only
specific cellobiose/cellotriose uptake system of S. reticuli, since insertional inactivation of the cebE
gene prevents high-affinity uptake of cellobiose.
 |
INTRODUCTION |
The ABC superfamily of transporters
has been extensively studied, and members have been identified in most
bacteria, archaea, and eukaryotes (9). Uptake of a large
variety of nutrients seems to be the most obvious task of these
systems. Moreover, ABC transporters are involved in the export of drugs
or virulence factors, such as hemolysin, extracellular proteases, and
toxins; signal transduction; plant host-bacterial-parasite
interaction; antigen presentation in immune cells; transport of
pheromones; and sporulation of gram-positive bacteria (3,
7).
Members of the family of binding protein-dependent systems have so far
been identified only in prokaryotes (3, 7). These multicomponent systems consist of two membrane-inserted subunits, two
components inside the cytoplasm that carry the ATP binding site, and
the binding protein located outside the cytoplasm. The binding proteins
are responsible for the substrate specificity of the ABC transporter.
In gram-negative bacteria, the binding protein is a soluble periplasmic
protein, whereas in gram-positive bacteria and archaea, it is a
lipoprotein exposed to the cell surface (38).
Streptomyces reticuli is a soil bacterium which hydrolyzes
crystalline cellulose (Avicel) due to the action of an exoglucanase (Avicelase, Cel1) (32, 33, 44). The generated cellobiose and
cellotriose are taken up via an inducible, binding protein-dependent ABC transporter (cellobiose/cellotriose ABC transport system
[34]). The corresponding cellobiose/cellotriose
binding protein was shown to be a lipoprotein anchored to the
cytoplasmic membrane. This protein was extracted from membranes of
S. reticuli and purified to homogeneity; it binds to
cellobiose and cellotriose with equally high affinities
(34). The ATP-hydrolyzing subunit of the
cellobiose/cellotriose ABC transporter is MsiK (35). The
msiK gene is a homologue of a previously described
Streptomyces lividans msiK (15). MsiK from both
Streptomyces species assists two different ABC transporters, one for maltose and one for cellobiose and cellotriose. Earlier studies
have indicated that the chromosomally located msiK gene of
S. reticuli is not situated in the vicinity of genes
encoding the other components of the cellobiose/cellotriose ABC
transport system (35).
In this report we characterize the additional clustered genes of the
cellobiose/cellotriose transport system from S. reticuli. Further physiological, immunological, transcriptional, and mutational experiments elucidate details of the cellobiose/cellotriose ABC transport system.
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and culture conditions.
The
wild-type strain S. reticuli Tü45 (DSM 40776; German
Collection of Microorganism and Cell Cultures, Braunschweig, Germany) described by Wachinger et al. (44) was obtained from H. Zähner, Tübingen, Germany. The Escherichia coli
plasmids pUC18 and pUC19 (47) were used as cloning vectors
for DNA sequence analysis and for disruption of the cebE
gene. The aminoglycoside 3'-phosphotransferase gene (25)
from pUC4K, supplied by Pharmacia, was used for gene disruption
experiments. The E. coli K-12 strain DH5
containing the
plasmids used in this study was grown in Luria-Bertani medium with 100 µg of ampicillin ml
1 (with pUC derivatives) or 50 µg
of kanamycin ml
1 (with pUC4K derivatives)
(29). S. reticuli was cultivated in pH-stable minimal medium (45) supplemented with the
appropriate carbon source (1%, wt/vol) and 10 mM
(NH4)2SO4 as a nitrogen source. For
protoplast preparation S. reticuli was grown in complete
medium (Oxoid tryptone-soy broth [20 g liter
1], yeast
extract [5 g liter
1], sucrose [100 g
liter
1], MgCl2 [10 g
liter
1]).
DNA preparation and manipulations.
Genomic DNA from S. reticuli was isolated as described previously (12).
Plasmids were isolated from E. coli with the aid of a midi
plasmid kit (Qiagen GmbH, Hilden, Germany). Restriction enzyme
digestions, ligation reactions, and analyses of DNA with nucleases and
polymerases were carried out by standard procedures (29).
PCR amplification of S. reticuli chromosomal DNA was
performed with the oligonucleotides CB1,
5'-GGACATCAACATCAAGGAGAA-3', and CB2,
5'-CTCCTTSCCSAGGTCSACGAA-3', the former corresponding to the
DINIKEN motif of amino acids located within the signature sequence of
CebE (see Fig. 3). PCR was done under standard conditions (1) but in the presence of 5% dimethyl sulfoxide in a total volume of 50 µl. The mixture was covered with 30 µl of mineral oil
and subjected to 30 cycles of 1 min at 96°C, 1 min at 52°C, and 1 min at 72°C. PCR products were purified with a QIAquick PCR
purification kit (Qiagen GmbH), cloned into plasmid pUC18 with the aid
of a Sure Clone ligation kit (Pharmacia, Freiburg, Germany), and
subjected to nucleotide sequencing.
Preparation and screening of subgenomic DNA libraries.
Total
DNA (200 µg) from S. reticuli was cleaved with
BamHI, and the resulting fragments were separated on an
agarose gel. Fragments of about 1.5 to 2 kb were eluted with a QIAEX II
gel extraction kit and ligated to BamHI-digested and
dephosphorylated pUC18. The ligation mixtures were transformed to
E. coli DH5
by electroporation with an Electroporator II
from Invitrogen (NV Leek, The Netherlands). Ampicillin-resistant
transformants were tested for the presence of the desired
cebE gene by colony hybridization at 54°C overnight with
the digoxigenin-labelled PCR fragment (DNA labelling and detection kit;
Boehringer, Mannheim, Germany). Three additional subgenomic DNA
libraries consisting of SstII (1 to 1.5 kb),
ScaI-HindIII (2 to 2.5 kb), and
BamHI (2 to 2.5 kb) were generated in pUC18 and screened as
described above.
DNA sequence analysis.
DNA sequencing of both strands of the
ceb region was performed with double-stranded DNA based on
the dideoxy chain termination method (30) with a Cy5
Autoread sequencing kit, Cy5-dATP labelling mix (Pharmacia), and
universal or specific primers (MWG-Biotech, Ebersberg, Germany).
Sequencing reactions were run on an ALFexpress sequencer
from Pharmacia. The DNA and protein sequences were analyzed with the
GENMON program (GBF, Braunschweig, Germany), as well as the Genetics
Computer Group sequence analysis software package (version 8.0;
Biotechnology Center, University of Wisconsin, Madison). Reading frames
were determined with the GCWIND program (D. Shields, Dublin, Ireland)
on the basis of the codon usage preference in Streptomyces
DNA. The predicted proteins were scanned for similarities to sequences
in the SWISS-PROT and EMBL databases with the FASTA and BLITZ
algorithms (27). Membrane-spanning segments were predicted by the TMpred program according to the method of Hoffman and Stoffel (10).
Determination of amino acid sequences.
Purified CebE protein
(2 mg) was incubated overnight at 30°C with 20 mM CNBr in 80%
(vol/vol) formic acid and subsequently evaporated to dryness. Resulting
peptides were separated by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) (15%, wt/vol, acrylamide) and transferred
onto a polyvinylidene difluoride membrane (Immobilon P; Millipore GmbH,
Eschborn, Germany) as described previously (11). After
Coomassie brilliant blue staining, different protein bands were excised
and NH2-terminal amino acids were determined by Edman
degradation by R. Schmid, University of Osnabrück,
Osnabrück, Germany.
Generation of MsiK antibodies and Western blot analysis.
A
DNA fragment (372 bp) encoding the C terminus of MsiK was amplified
with the primers MsiK1 (CTGTCCAACCTGGACGCCAAG) and MsiK2 (GTGCTCGGGGCGGACGCCGAC) with chromosomal DNA of S. reticuli and cloned into SmaI-restricted pUC18. From
this plasmid the PCR fragment was isolated as a
BamHI-KpnI fragment (383 bp) and recloned with pQE31 (Qiagen). The resulting construct, pMS131, contained the desired
part of msiK with six codons encoding histidines at its 5'
end. Strain SG13009 (Qiagen) transformed with pMS131 produced the His
tag MsiK fusion protein in inclusion bodies. Once we obtained and
solubilized the inclusion bodies, the fusion protein was purified by
affinity chromatography with Ni2+-nitrilotriacetic acid
according to the instructions of the manufacturer (Qiagen).
Antiserum was obtained by immunization of a rabbit with the
purified six-His-MsiK fusion protein (Eurogentec, Seraing, Belgium). Western blot analyses were conducted as described previously (40) with a 1:10,000 dilution of antibodies raised against
His-tagged MsiK or a 1:100,000 dilution of antibodies raised against
CebE (34).
Construction of a cebE disruption mutant.
The
cebE gene in pCB40 was cleaved by NaeI, resulting
in an internal cebE deletion of 1,037 bp. Overhangs of the
remaining plasmid were filled in with the Klenow enzyme and
deoxynucleoside triphosphates and ligated to a PstI fragment
from pUC4K (Pharmacia) comprising the kanamycin resistance
(aphI) gene (25). The resulting construct was
named pCB41. Protoplasts of S. reticuli were generated (12) and transformed with pCB41, which was isolated from the dam and dcm methylation-deficient E. coli strain JM110. Transformants were selected by overlaying
regenerating protoplasts with agar (0.75%) containing kanamycin (20 µg/ml).
RNA isolation and Northern blot analysis.
Total RNA was
isolated from S. reticuli with acid guanidinium
thiocyanate-phenol-chloroform (6). For Northern blot
analysis, RNA (15 µg per slot) was separated in formaldehyde gels
(1) and transferred onto nylon membranes by vacuum blotting
(LKB 2016 VacuGene; Pharmacia). RNA molecular weight marker I (0.3 to
6.9 kb) from Boehringer was used for size determination. The molecular weight markers were stained on the surface of the nylon filter with
0.2% methylene blue in 0.2 M sodium acetate (pH 4.7) (20). Hybridization was performed at 64°C for 20 h in a solution
containing 5× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium
citrate), 0.1% SDS, 100 µg of salmon sperm DNA ml
1,
and 5× Denhardt's reagent (29) with randomly
[
-32P]dCTP-labelled DNA fragments (Rediprime DNA
labelling system; Amersham, Freiburg, Germany). The membrane was washed
twice in 2× SSC-0.1% SDS for 5 min and twice in 0.1× SSC-0.1% SDS
for 30 min and subjected to autoradiography at
70°C.
S1 nuclease mapping of transcription start sites.
The probes
were generated by PCR amplification of a 396-bp fragment with pCB20 as
the template and 10 pmol of the synthetic oligonucleotides E101 (for
the cebE probe) and R103 (for the cebR probe)
(see Fig. 2). Primers were labelled with [
-32P]ATP and
T4 polynucleotide kinase (1) and used for PCRs with the
corresponding unlabelled primer. Labelled PCR products were purified
with a QIAquick PCR purification kit (Qiagen). For every S1 nuclease
protection reaction, 50 µg of RNA was hybridized to ~105 Cerenkov counts of the PCR fragment in Na-TCA buffer
(23) min
1 at 45°C for 6 h, after
denaturation at 65°C for 15 min. Hybridization products were digested
with S1 nuclease (Gibco, Life Technologies, Karlsruhe, Germany) as
outlined by the manufacturer. Undigested radiolabelled DNA was
precipitated with ethanol and run on a 6% polyacrylamide gel. The
dried gel was subjected to autoradiography at
70°C. Sequence
ladders were generated by the dideoxy chain termination method with the
labelled primers R103 and E101 and with pCB20 as a template.
Nucleotide sequence accession number.
The nucleotide
sequence data reported in this article are stored in the EMBL database
under the accession no. AJ009797 and AJ009798.
 |
RESULTS AND DISCUSSION |
Cloning of the cebREFG cluster and the bglC
gene.
As the NH2-terminal amino acids of the purified
CebE protein (34) could not be obtained by Edman
degradation, several internal peptides were generated by CNBr
treatment. After separation by SDS-PAGE, NH2-terminal amino
acids were determined from three peptides (see Fig. 2) and used to
deduce corresponding oligonucleotides. These, in turn, were used to
generate fragments from total S. reticuli DNA in PCRs. The
obtained fragments were cloned into pUC18, and their nucleotide
sequences were determined. From the construct which comprises a
fragment encoding a portion of the CebE protein (pCB1) (Fig.
1A), the PCR fragment was reisolated, labelled, and used to screen a subgenomic S. reticuli DNA
library in E. coli DH5
(containing 1.5- to 2-kb
BamHI genomic S. reticuli fragments in pUC18).
Several clones were identified by colony hybridization, and their
plasmids were analyzed. Sequencing revealed that an inserted 1.7-kb
BamHI fragment was the desired one (Fig. 1). As genomic
S. reticuli SstII (1.2 kb) and
HindIII-ScaI (2.4 kb) fragments hybridized
with the 1.7-kb BamHI fragment, corresponding subgenomic
libraries were generated in pUC18 and the desired overlapping fragments
were gained (Fig. 1). The genomic 2.3-kb BamHI fragment was
obtained with the 1.2-kb SstII probe in a manner similar to that described above.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
Constructs and organization of genes. (A) Initial PCR
product and maps of the cloned chromosomal fragments in pUC18. (B)
Arrangement of genomic cebREFG and bglC. The
restriction sites relevant for cloning are shown. The probes used for
transcription analysis are shown above the genes (   ). Arrows
mark the positions of transcripts. Predicted transcription terminators
are indicated by stem-loop structures. orf, open reading
frame.
|
|
Determination of the sequence and its analysis.
The sequences
of the cloned overlapping fragments were determined. FRAME analysis
(2) of the assembled 5,448-bp DNA fragment revealed the
presence of five reading frames, whose codon usage was found to be
typical of GC-rich Streptomyces DNA. The sequence of the
first reading frame comprises 1,056 bp with a G+C content of 74 mol%.
A start codon (ATG), a putative ribosome binding site, and a stop codon
(TGA) were identified (Fig. 2). The
deduced amino acid sequence of this open reading frame encodes a 39-kDa
protein of 351 amino acids (aa). It was named CebR, as within its
NH2 terminus a helix-turn-helix (HTH)-containing region
characteristic of DNA binding proteins was identified (46).
The deduced CebR is most closely related to GalR (38% of its amino
acid residues are identical) and RbsR from E. coli (37% of
its amino acid residues are identical), the latter representing a
repressor of the ribose ABC transport operon (19). GalR and
RbsR are both members of the LacI-GalR regulatory family.
Interestingly, only 32% of CebR's amino acid residues are identical
to those of the recently identified Streptomyces coelicolor
A3(2) MalR regulator of the operon for a maltose ABC transporter
(41).

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 2.
Partial nucleotide sequences and deduced amino acid
sequences of cebREFG and bglC. The deduced amino
acid sequences are given in the one-letter code below the nucleotide
(nt) sequence, and nucleotide numbers are shown on the right. The
putative ribosome binding sites (rbs) are in white letters on a black
background, and predicted terminators are indicated by arrows above the
sequence. The transcriptional start sites are in boldface type and are
marked by asterisks followed by arrows indicating the direction of
transcription (tE, transcription start site for
cebE; tR1 and tR2, transcription
start sites for cebR). The sequence similar to that of the
Streptomyces class E promoter is marked by a line above the
sequence. The oligonucleotides R103 and E101 used for S1 nuclease
mapping are represented by broken lines. The predicted HTH motif in the
deduced CebR protein is underscored, and the putative operator sequence
for CebR binding is boxed (OCebR). The signal peptide of
CebE followed by the recognition sequence for the cleavage site of
lipoprotein signal peptidase is double underscored. The
NH2-terminal amino acids of peptides from the purified CebE
and BglC proteins determined by Edman degradation are in boldface type.
Most of the sequence within the structural genes has been omitted, as
is indicated by dots and double-slashed bars.
|
|
The most conserved portion of HTH motifs from various members of the
LacI-GalR family comprises the six residues ATVSRV, which
make up the
main portion of the recognition helix (GTVSRV in CebR)
required for
specific binding to the major groove within the operator
sequences
(
36). By sequence alignments it was suggested that
the
C-terminal domain of GalR is homologous to the
E. coli
periplasmic
D-galactose-
D-glucose binding
protein (
46). Data from the crystal
structures of several
periplasmatic binding proteins (
22,
43)
were used for
molecular modelling of the binding domain for
D-galactose-
D-glucose
in GalR (
14).
The amino acid side chains of Phe 73, Arg 194,
Asn 245, and Asp 273 from GalR were predicted to be involved in
creating the saccharide
binding pocket. Three corresponding residues,
Phe 73, Arg 194, and Asp
273, are found in the deduced CebR protein,
and it appears likely that
they interact with
cellobiose.
The
cebR gene is followed by the reading frame named
cebE (1,334 bp), which has an opposite orientation. A start
codon (ATG)
with a putative Shine-Dalgarno sequence and a stop codon
(TGA)
were identified (Fig.
2). The deduced CebE protein (47.9 kDa)
has
444 aa residues and contains the characterized internal peptides
(determined by Edman degradation) of the purified CebE protein.
The
first 26 aa residues of the deduced CebE include a positively
charged
NH
2-terminal hydrophobic core region and the sequence
LLAG
CA (the underscore indicates the cleavage
site), which corresponds
to the consensus (LLAG
CS)
of the lipoprotein signal peptidase
cleavage site
(
38). This finding is in agreement with those
of our
previous biochemical experiments, which had revealed that
S. reticuli produces CebE as a lipoprotein (
34). Only 20%
of
the deduced amino acids of CebE are identical to those of binding
proteins of cluster 1 as defined by Tam and Saier
(
39). The
signature sequence (Fig.
3) comprising the highly conserved lysine
residue is, however, conserved in CebE.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 3.
Alignments of signature sequences from binding proteins.
The numbers indicate the positions of the amino acids. The highly
conserved lysine (R) residue (according to the work of Tam and Saier
[39]) is given in boldface type, and residues
conserved in CebE are underlined. Sr, S. reticuli; Sc, S. coelicolor A3(2);
Ec, E. coli; Sp, Streptococcus
pneumoniae; Sm, Streptococcus mutans;
Tt, Thermoanaerobacterium thermosulfurigenes;
MalE, MalX, and AmyE, maltose and maltodextrin binding proteins; UgpB,
sn-glycerol-3-phosphate binding protein; MsmE,
multiple-sugar binding protein.
|
|
The
cebE gene is followed by a putative transcription
terminator and subsequently by the third (921-bp) and fourth (831-bp)
reading frames. Neither reading frame is preceded by putative
promoter
and ribosome binding sites. The sizes of the deduced
proteins for CebF
and CebG are 276 and 306 aa, respectively, and
both proteins contain
six predicted membrane-spanning segments.
Between the third and the
fourth membrane-spanning segments, both
proteins carry an EAA motif
that matches the consensus EAAX
2DGAX
8IXLP
sequence characteristic of membrane proteins from binding
protein-dependent
ABC transporters (
31). In the
E. coli MalF and MalG proteins
the EAA motif has been identified as
one site interacting with
the predicted

-helical domain of the ATP
binding protein MalK
(
21). Databank searches revealed that
the deduced
S. reticuli CebF and CebG proteins have highest
identities with deduced lactose
permeases from
Synechocystis
sp. (35% identity; EMBL accession
no.
P73352 and
P73854) and deduced
lactose permeases from
Thermus sp. (36% identity; EMBL
accession no. D1029300 and D1029301),
all of which are presumed to be
subunits of putative ABC transport
systems.
The partially sequenced open reading frame following
cebG is
preceded by a putative transcription terminator and a predicted
ribosome binding site and encodes a portion (714 bp) of a protein
(238 aa) named BglC. The sequence of the deduced NH
2 terminus
is
MPDSVSSLTFP (Fig.
2) and thus identical with the sequence of
amino
acids previously determined by Edman degradation for a purified
S. reticuli intracellular

-glucosidase of 50 kDa
(
8). Alignments
of the deduced BglC (calculated to
correspond to about half of
the purified

-glucosidase) have revealed
that it has 72% (over
234 aa) and 61% (over 232 aa) identity with

-glucosidases deduced
from
Streptomyces sp. strain
QM-B814 and
Microbispora bispora nucleotide sequences,
respectively.
The
ceb operon lacks a gene encoding an ATP-hydrolyzing
protein. Our previous experiments had shown that
S. reticuli
has a
separately located
msiK gene (
35). In this
context it is interesting
that the
S. coelicolor A3(2)
malEFG operon also lacks a gene encoding
an ATP binding
protein (
42). In the thermophilic archaea
Thermococcus litoralis and
Thermococcus thermosulfurigenes, the
malK homologues
are also not linked to ABC transport operons
for maltose (
28)
and for maltose and trehalose
(
13), respectively. Inspection
of complete genomic sequences
revealed that the
msiK homologues
msmX from
Bacillus subtilis (EMBL accession no. BG 11954) and
msiK from
Synechocystis sp. strain PCC 6803 (EMBL
accession no.
slr 0747) and an open reading frame from
Methanococcus jannaschii encoding a homologue of the
E. coli ATP binding protein UgpC of
the
sn-glycerol-3-phosphate ABC transporter (EMBL accession no.
MJ0121) are located independently of the genes encoding other
subunits
of binding protein-dependent ABC transporters. Whether
the above-cited
MsiK homologues assist several ABC transporters
as in
S. reticuli remains to be
elucidated.
Transcriptional experiments.
Hybridization experiments with
total RNA isolated from cellobiose-grown S. reticuli mycelia
revealed the formation of a polycistronic transcript (4.9 kb)
comprising cebEFG and bglC. Additionally, shorter
transcripts corresponding to cebEFG (3.1 kb),
cebEF (2.3 kb), and cebE (1.5 and 1 kb) were
detected. The small transcript (1.5 kb) corresponding to the
cebE gene attained up to 20-fold higher levels of
transcription than the 4.9- and 3.1-kb transcripts. During cultivation
with glucose, almost no cebEFG or bglC
transcripts were found (Fig. 4). The
large amount of the 1.5-kb cebE transcript corresponds to
the high levels of CebE protein present within membranes of S. reticuli during cultivation on cellobiose (34). The
size of the 1.5-kb cebE transcript is in agreement with the distance from the cebE transcription start site (nucleotide
1244) (Fig. 2) to the predicted terminator following the stop codon of
cebE (nucleotides 2749 to 2787). An additionally predicted terminator within the cebE gene corresponds to the 1.0-kb
cebE transcript. However, a truncated CebE protein of the
corresponding size (30 kDa) was not identified immunologically,
suggesting that this small transcript is not translated under the
conditions used or that it represents a degraded RNA form.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 4.
Transcription studies of the ceb operon and
msiK gene. Total RNA (15 µg) from mycelia grown in the
presence of glucose (lanes 1) and cellobiose (lanes 2) was separated
electrophoretically. After transfer of the RNA to a nylon membrane, the
strips were hybridized with the indicated 32P-labelled
probes and exposed to X-ray films. The X-ray film of the
cebR Northern blot analysis was exposed eight times longer
than the others. Transcript sizes (in kilobases) are given on the
left.
|
|
With the
cebR-specific DNA probe, a monocistronic transcript
of 1.1 kb was detected (Fig.
4). In glucose-grown
S. reticuli mycelia, the level of
cebR transcript was
extremely low but it
increased about 10 times during cultivation with
cellobiose. A
transcript of 1.3 kb corresponded to the monocistronic
msiK gene.
The quantity of the
msiK transcript
from cellobiose-grown cultures
exceeded that from glucose-grown
cultures by about 15-fold.
S1 nuclease mapping revealed that the
cebE transcript starts
132 nucleotides 5' upstream of the translational start codon
of
cebE. The sequence GGAAC is located 24 nucleotides 5'
upstream
of the transcription start codon (Fig.
5). This motif matches
the previously
identified

35 region of the p2 promoter of the
agarase gene
dagA from
S. coelicolor A3(2) (
5,
37),
a weak
promoter of class E lacking a typical

10 region
(
4). The 5'
upstream region of CebE contains the motif
GGAGCGCTCC (Fig.
2),
which has similarity to the optimal
consensus sequence of the
E. coli GalR operator
[(G/T)AA(A/C)CGNTT(A/C)] (
24,
46).
Transcription
of
cebR starts at the T and G 21 nucleotides
5' upstream of the
ATG start codon. Rarely used transcription start
codons of
cebR were found 22 nucleotides 5' upstream.

View larger version (85K):
[in this window]
[in a new window]
|
FIG. 5.
Mapping of the transcription initiation sites of
cebE and cebR. RNA (50 µg) prepared from
mycelia of S. reticuli grown in the presence of cellobiose
was hybridized to 0.1 pmol of the 32P-labelled
cebR (A) or cebE (B) probes, and S1 nuclease
treatment (lanes S) was done as described in Materials and Methods.
ACGT indicates the cebR and cebE nucleotide
sequence ladders. The asterisks mark the most probable transcription
start sites.
|
|
Production of CebE and MsiK.
Antibodies raised against the
C-terminal part of MsiK and the mature CebE (34) were used
to monitor the levels of corresponding proteins during cultivation on
minimal media containing different saccharides (Fig.
6). S. reticuli was found to
produce CebE only if it was grown in the presence of cellobiose (not
with glucose, maltose, or sucrose). When, however, cellobiose and one
of the above-mentioned saccharides were added together to the culture medium, the level of CebE attained was nearly that ascertained for
mycelia grown only with cellobiose.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 6.
Synthesis of CebE and MsiK proteins. Wild-type S. reticuli was grown in minimal medium with the following
saccharide(s) at 0.5% (wt/vol) each: glucose (lane 1), cellobiose
(lane 2), cellobiose plus glucose (lane 3), cellobiose plus maltose
(lane 4), cellobiose plus sucrose (lane 5), maltose (lane 6), and
sucrose (lane 7). Mycelia were disrupted by sonification, and 20 µg
of protein per lane was separated by SDS-PAGE (17).
Immunodetection of CebE (A) and MsiK (B) proteins was performed as
outlined previously (35).
|
|
The quantity of MsiK was highest in mycelia grown with cellobiose,
maltose, or sucrose. The addition of glucose to mycelia
growing with
cellobiose, maltose, or sucrose led to a decrease
of MsiK synthesis.
The relative amounts of
msiK transcripts corresponded
to the
quantities of MsiK protein obtained from mycelia grown
under comparable
conditions (data not shown). These data show
that MsiK synthesis is
regulated differently from that of the
CebE
protein.
Construction of an S. reticuli cebE mutant.
The
cebE gene was inactivated by insertion mutagenesis. The
aphI gene from Tn903 (25) was inserted
into the pUC18-borne cebE gene with an internal deletion of
an NaeI fragment (1,037 bp). After the S. reticuli wild type was transformed with the resulting plasmid,
pCB41, several resistant colonies growing with 20 µg of kanamycin per
ml were found. Following a double crossover between the genomic
cebE gene and the cebE-homologous flanking portions of the aphI gene on pCB41, the aphI gene
was found to disrupt the reading frame of the cebE gene,
which was confirmed by Southern hybridization. The mRNA of this
kanamycin-resistant S. reticuli mutant lacks all transcripts
corresponding to cebEFG and bglC, showing that
the insertion of the aphI gene in cebE had an
effect on the transcription of genes located downstream from it. As
expected, the CebE protein was not detectable immunologically within
cell extracts prepared from the cebE mutant. In minimal medium supplemented with glucose, the cebE mutant grew with
the same doubling time as that of the wild-type strain (3 h). In
cellobiose-containing minimal medium, the growth rate of the wild-type
strain was not affected but the cebE mutant strain grew
quite poorly (Fig. 7A). Unlike with the
wild type, no or only very little cellobiose was taken up by mycelia of
the cebE mutant during short-term uptake experiments (Fig.
7B). However, after prolonged incubation (exceeding 10 min), small
amounts of 14C label were detected. Previously
(8) we had shown that S. reticuli produces
extracellular and intracellular
-glucosidase activities (detected by
hydrolysis of
p-nitrophenyl-
-D-glucopyranoside). Inspection
of the cebE mutant revealed that the
-glucosidase activities were comparable to those of the progenitor strain (data not
shown). Thus, we suspect that part of the 14C-labelled
cellobiose was cleaved to glucose.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 7.
Characterization of the cebE mutant. (A)
Physiological experiments. Spores (106/ml) of the wild type
( ) and the cebE disruption mutant ( ) were inoculated
into minimal medium containing 0.5% (wt/vol) Casamino Acids and
glucose or cellobiose. After 24 h, the mycelia were washed twice
with minimal medium lacking Casamino Acids, and after the addition of
cellobiose, the growth could be monitored photometrically (optical
density at 600 nm [OD600]), due to the finely dispersed
hyphae. (B) Cellobiose uptake experiments. Mycelia from the S. reticuli wild type ( ) or the cebE mutant ( ) were
grown in minimal medium containing Casamino Acids (0.5%) and
cellobiose for 16 h, and then the mycelia were washed twice with
50 mM potassium phosphate buffer, pH 7.0. Uptake of
[14C]cellobiose (5 µM) was determined as described
previously (34). As a control, the uptake of cellobiose was
determined in wild-type ( ) mycelia cultivated with glucose. dw, dry
weight.
|
|
Unlike with
S. reticuli, within
E. coli
(
26) and
Bacillus stearothermophilus XL-65-6
(
18) cellobiose is taken up via
phosphoenolpyruvate-dependent
phosphotransferase systems, and
phosphorylated cellobiose, in
turn, is cleaved by the action of
intracellular phospho-

-glucosidases.
In the cellulose degrader
Trichoderma reesei, cellobiose uptake
is mediated by a
constitutively synthesized permease that is specific
for different

-glucosides such as sophorose, gentiobiose, and
cellobiose
(
16). The newly identified
S. reticuli genes are
so far the only known genes encoding a functional binding
protein-dependent
ABC transporter for cellobiose and cellotriose. Thus,
this ABC
transporter is an excellent model system for more-detailed
studies
to elucidate its high
specificity.
 |
ACKNOWLEDGMENTS |
We are grateful to J. Ritz for training J. Jantos to isolate RNA,
to T. Aldekamp for performing some of the Western blot analyses, and to R. Schmid, Department of Microbiology, University of
Osnabrück, for determining NH2-terminal amino acids
of CebE.
M. Lemme supported the writing of the manuscript. The work was
initially financed by the SFB (grant 171/C14 to H. Schrempf) and then
by the DFG (grant Schl 498/1-1 to A. Schlösser).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: FB
Biologie/Chemie, Universität Osnabrück, Barbarastraße 11, D-49069 Osnabrück, Germany. Phone: 49 541 969 2843. Fax: 49 541 969 2804. E-mail: schloesser{at}biologie.uni-osnabrueck.de.
 |
REFERENCES |
| 1.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. A. Smith,
J. G. Seidman, and K. Struhl (ed.).
1987.
Current protocols in molecular biology.
Greene Publishing Associates, New York, N.Y.
|
| 2.
|
Bibb, M. J.,
P. R. Findlay, and M. W. Johnson.
1984.
The relationship between base composition and codon usage in bacterial genes and its use for the simple and reliable identification of protein-coding sequences.
Gene
30:157-166[Medline].
|
| 3.
|
Boos, W., and J. M. Lucht.
1996.
Periplasmic binding protein-dependent ABC transporters, p. 1175-1209.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. American Society for Microbiology, Washington, D.C.
|
| 4.
|
Bourn, W. R., and B. Babb.
1995.
Computer assisted identification and classification of streptomycete promoters.
Nucleic Acids Res.
23:3696-3703[Abstract/Free Full Text].
|
| 5.
|
Buttner, M. J.,
I. M. Fearnley, and M. J. Bibb.
1987.
The agarase gene (dagA) of Streptomyces coelicolor A3(2): nucleotide sequence and transcriptional analysis.
Mol. Gen. Genet.
209:101-109.
|
| 6.
|
Chromczynski, P., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 7.
|
Dean, M., and R. Allikmets.
1995.
Evolution of ATP-binding cassette transporter genes.
Curr. Opin. Genet. Dev.
5:779-785[Medline].
|
| 8.
|
Heupel, C.,
A. Schlochtermeier, and H. Schrempf.
1993.
Characterization of an intracellular -glucosidase from Streptomyces reticuli.
Enzyme Microb. Technol.
15:127-132.
|
| 9.
|
Higgins, C. F.
1992.
ABC transporter: from microorganisms to man.
Annu. Rev. Cell Biol.
8:67-113.
|
| 10.
|
Hoffman, K., and W. Stoffel.
1993.
TMbase a database of membrane spanning protein segments.
Biol. Chem.
347:166.
|
| 11.
|
Höner zu Bentrup, K.,
R. Schmid, and E. Schneider.
1994.
Maltose transport in Aeromonas hydrophila: purification, biochemical characterization and partial protein sequence analysis of a periplasmic maltose-binding protein.
Microbiology
140:945-951[Abstract/Free Full Text].
|
| 12.
|
Hopwood, D. A.,
M. J. Bibb,
K. F. Chater,
T. Kieser,
C. J. Bruton,
H. M. Kieser,
D. J. Lydiate,
C. P. Smith,
J. M. Ward, and H. Schrempf.
1985.
Genetic manipulation of Streptomyces: a laboratory manual.
John Innes Foundation, Norwich, United Kingdom.
|
| 13.
|
Horlacher, R.,
K. B. Xavier,
H. Santos,
J. DiRuggiero,
M. Kossman, and W. Boos.
1998.
Archaeal binding protein-dependent ABC transporter: molecular and biochemical analysis of the trehalose/maltose transport system of the hyperthermophilic archaeon Thermococcus litoralis.
J. Bacteriol.
180:680-689[Abstract/Free Full Text].
|
| 14.
|
Hsieh, M.,
P. Hensley,
M. Brenowitz, and J. S. Fetrow.
1994.
A molecular model of the inducer binding domain of the galactose repressor of Escherichia coli.
J. Biol. Chem.
269:13825-13835[Abstract/Free Full Text].
|
| 15.
|
Hurtubise, Y.,
F. Shareck,
D. Kluepfel, and R. Morosoli.
1995.
A cellulase/xylanase-negative mutant of Streptomyces lividans 1326 defective in cellobiose and xylobiose uptake is mutated in a gene encoding a protein homologous to ATP-binding proteins.
Mol. Microbiol.
17:367-377[Medline].
|
| 16.
|
Kubicek, C. P.,
R. Messner,
F. Gruber,
M. Mandels, and E. M. Kubicek-Pranz.
1993.
Triggering of cellulase biosynthesis by cellulose in Trichoderma reesei.
J. Biol. Chem.
268:19364-19368[Abstract/Free Full Text].
|
| 17.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
|
| 18.
|
Lai, X., and L. O. Ingram.
1993.
Cloning and sequencing of a cellobiose phosphotransferase system operon from Bacillus stearothermophilus XL-65-6 and functional expression in Escherichia coli.
J. Bacteriol.
175:6441-6450[Abstract/Free Full Text].
|
| 19.
|
Lopilato, J. E.,
J. L. Garwin,
S. D. Emr,
T. J. Silhavy, and J. R. Beckwith.
1984.
D-Ribose metabolism in Escherichia coli K-12: genetics, regulation, and transport.
J. Bacteriol.
158:665-673[Abstract/Free Full Text].
|
| 20.
|
Miller, K.
1987.
Gel electrophoresis of RNA.
Focus
9:14-15.
|
| 21.
|
Mourez, M.,
M. Hofnung, and E. Dassa.
1997.
Subunit interactions in ABC transporters: a conserved sequence in hydrophobic membrane proteins of periplasmic permeases defines an important site of interaction with the ATPase subunits.
EMBO J.
16:3066-3077[Medline].
|
| 22.
|
Mowbray, S. L., and L. B. Cole.
1992.
1.7 A X-ray structure of the periplasmic ribose receptor from Escherichia coli.
J. Mol. Biol.
225:155-175[Medline].
|
| 23.
|
Murray, M.
1986.
Use of sodium trichloroacetate and mung bean nuclease to increase sensitivity and precision during transcript mapping.
Anal. Biochem.
158:165-170[Medline].
|
| 24.
|
Nieto, C.,
M. Espinosa, and A. Puyet.
1997.
The maltose/maltodextrin regulon of Streptococcus pneumoniae.
J. Biol. Chem.
272:30860-30865[Abstract/Free Full Text].
|
| 25.
|
Oka, A.,
H. Sugisaki, and M. Takanami.
1981.
Nucleotide sequence of the kanamycin resistance transposon Tn903.
J. Mol. Biol.
147:217-226[Medline].
|
| 26.
|
Parker, L. L., and B. G. Hall.
1990.
Characterization and nucleotide sequence of the cryptic cel operon of Escherichia coli K12.
Genetics
124:455-471[Abstract].
|
| 27.
|
Pearson, W. R., and D. J. Lipman.
1988.
Improved tools for biology sequence comparison.
Proc. Natl. Acad. Sci. USA
85:2444-2448[Abstract/Free Full Text].
|
| 28.
|
Sahm, K.,
M. Matuschek,
H. Müller,
W. J. Mitchell, and H. Bahl.
1996.
Molecular analysis of the amy gene locus of Thermoanaerobacterium thermosulfurigenes EM1 encoding starch-degrading enzymes and a binding protein-dependent maltose transport system.
J. Bacteriol.
178:1039-1046[Abstract/Free Full Text].
|
| 29.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 30.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 31.
|
Saurin, W.,
W. Köster, and E. Dassa.
1994.
Bacterial binding protein-dependent permeases: characterization of distinctive signatures for functionally related integral cytoplasmic membrane proteins.
Mol. Microbiol.
12:993-1004[Medline].
|
| 32.
|
Schlochtermeier, A.,
F. Niemeyer, and H. Schrempf.
1992.
Biochemical and electron microscopic studies of the Streptomyces reticuli cellulase (Avicelase) in its mycelium-associated and extracellular forms.
Appl. Environ. Microbiol.
58:3240-3248[Abstract/Free Full Text].
|
| 33.
|
Schlochtermeier, A.,
S. Walter,
J. Schröder,
M. Moormann, and H. Schrempf.
1992.
The gene encoding the cellulase (Avicelase) cel1 from Streptomyces reticuli and analysis of protein domains.
Mol. Microbiol.
6:3611-3621[Medline].
|
| 34.
|
Schlösser, A., and H. Schrempf.
1996.
A lipid-anchored binding protein is a component of an ATP-dependent cellobiose/-triose transport system from the cellulose degrader Streptomyces reticuli.
Eur. J. Biochem.
242:332-338[Medline].
|
| 35.
|
Schlösser, A.,
T. Kampers, and H. Schrempf.
1997.
The Streptomyces ATP-binding component MsiK assists in cellobiose and maltose transport.
J. Bacteriol.
179:2092-2095[Abstract/Free Full Text].
|
| 36.
|
Schumacher, M. A.,
K. Y. Choi,
H. Zalkin, and R. G. Brennan.
1994.
Crystal structure of LacI member, PurR, bound to DNA: minor groove binding by helices.
Nature
266:763-770.
|
| 37.
|
Strohl, W. R.
1992.
Compilation and analysis of DNA sequences associated with apparent streptomycete promoters.
Nucleic Acids Res.
20:961-974[Abstract/Free Full Text].
|
| 38.
|
Sutcliffe, I. C., and R. R. B. Russell.
1995.
Lipoproteins of gram-positive bacteria.
J. Bacteriol.
177:1123-1128[Free Full Text].
|
| 39.
|
Tam, R., and M. H. Saier.
1993.
Structural, functional, and evolutionary relationships among extracellular solute-binding receptors of bacteria.
Microbiol. Rev.
57:320-346[Abstract/Free Full Text].
|
| 40.
|
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354[Abstract/Free Full Text].
|
| 41.
|
van Wezel, G. P.,
J. White,
P. Young,
P. W. Postma, and M. J. Bibb.
1997.
Substrate induction and glucose repression of maltose utilization by Streptomyces coelicolor A3(2) is controlled by malR, a member of the lacI-galR family of regulatory genes.
Mol. Microbiol.
23:537-549[Medline].
|
| 42.
|
van Wezel, G. P.,
J. White,
M. J. Bibb, and P. W. Postma.
1997.
The malEFG gene cluster of Streptomyces coelicolor A3(2): characterization, disruption and transcriptional analysis.
Mol. Gen. Genet.
254:604-608[Medline].
|
| 43.
|
Vyas, N. K.,
M. N. Vyas, and F. A. Quiocho.
1991.
Comparison of the periplasmic receptors for L-arabinose, D-glucose/D-galactose, and D-ribose. Structural and functional similarity.
J. Biol. Chem.
266:5226-5237[Abstract/Free Full Text].
|
| 44.
|
Wachinger, G.,
K. Bronnenmeier,
W. L. Staudenbauer, and H. Schrempf.
1989.
Identification of mycelium-associated cellulase from Streptomyces reticuli.
Appl. Environ. Microbiol.
55:2653-2657[Abstract/Free Full Text].
|
| 45.
|
Walter, S., and H. Schrempf.
1996.
Physiological studies of cellulase (Avicelase) synthesis in Streptomyces reticuli.
Appl. Environ. Microbiol.
62:1065-1069[Abstract].
|
| 46.
|
Weickert, M. J., and S. Adhya.
1992.
A family of bacterial regulators homologous to Gal and Lac repressors.
J. Biol. Chem.
267:15869-15874[Abstract/Free Full Text].
|
| 47.
|
Yanisch-Perron, C.,
J. Vieira, and J. Messing.
1985.
Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.
Gene
33:103-119[Medline].
|
Applied and Environmental Microbiology, June 1999, p. 2636-2643, Vol. 65, No. 6
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Nataf, Y., Yaron, S., Stahl, F., Lamed, R., Bayer, E. A., Scheper, T.-H., Sonenshein, A. L., Shoham, Y.
(2009). Cellodextrin and Laminaribiose ABC Transporters in Clostridium thermocellum. J. Bacteriol.
191: 203-209
[Abstract]
[Full Text]
-
Saito, A., Fujii, T., Shinya, T., Shibuya, N., Ando, A., Miyashita, K.
(2008). The msiK gene, encoding the ATP-hydrolysing component of N,N'-diacetylchitobiose ABC transporters, is essential for induction of chitinase production in Streptomyces coelicolor A3(2). Microbiology
154: 3358-3365
[Abstract]
[Full Text]
-
Titgemeyer, F., Amon, J., Parche, S., Mahfoud, M., Bail, J., Schlicht, M., Rehm, N., Hillmann, D., Stephan, J., Walter, B., Burkovski, A., Niederweis, M.
(2007). A Genomic View of Sugar Transport in Mycobacterium smegmatis and Mycobacterium tuberculosis. J. Bacteriol.
189: 5903-5915
[Abstract]
[Full Text]
-
Lykidis, A., Mavromatis, K., Ivanova, N., Anderson, I., Land, M., DiBartolo, G., Martinez, M., Lapidus, A., Lucas, S., Copeland, A., Richardson, P., Wilson, D. B., Kyrpides, N.
(2007). Genome Sequence and Analysis of the Soil Cellulolytic Actinomycete Thermobifida fusca YX. J. Bacteriol.
189: 2477-2486
[Abstract]
[Full Text]
-
Hillerich, B., Westpheling, J.
(2006). A New GntR Family Transcriptional Regulator in Streptomyces coelicolor Is Required for Morphogenesis and Antibiotic Production and Controls Transcription of an ABC Transporter in Response to Carbon Source. J. Bacteriol.
188: 7477-7487
[Abstract]
[Full Text]
-
Diaz, M., Esteban, A., Fernandez-Abalos, J. M., Santamaria, R. I.
(2005). The high-affinity phosphate-binding protein PstS is accumulated under high fructose concentrations and mutation of the corresponding gene affects differentiation in Streptomyces lividans. Microbiology
151: 2583-2592
[Abstract]
[Full Text]
-
Bertram, R., Schlicht, M., Mahr, K., Nothaft, H., Saier, M. H. Jr., Titgemeyer, F.
(2004). In Silico and Transcriptional Analysis of Carbohydrate Uptake Systems of Streptomyces coelicolor A3(2). J. Bacteriol.
186: 1362-1373
[Abstract]
[Full Text]
-
Tsujibo, H., Kosaka, M., Ikenishi, S., Sato, T., Miyamoto, K., Inamori, Y.
(2004). Molecular Characterization of a High-Affinity Xylobiose Transporter of Streptomyces thermoviolaceus OPC-520 and Its Transcriptional Regulation. J. Bacteriol.
186: 1029-1037
[Abstract]
[Full Text]
-
Seo, J.-W., Ohnishi, Y., Hirata, A., Horinouchi, S.
(2002). ATP-Binding Cassette Transport System Involved in Regulation of Morphological Differentiation in Response to Glucose in Streptomyces griseus. J. Bacteriol.
184: 91-103
[Abstract]
[Full Text]
-
Koning, S. M., Elferink, M. G. L., Konings, W. N., Driessen, A. J. M.
(2001). Cellobiose Uptake in the Hyperthermophilic Archaeon Pyrococcus furiosus Is Mediated by an Inducible, High-Affinity ABC Transporter. J. Bacteriol.
183: 4979-4984
[Abstract]
[Full Text]
-
Hülsmann, A., Lurz, R., Scheffel, F., Schneider, E.
(2000). Maltose and Maltodextrin Transport in the Thermoacidophilic Gram-Positive Bacterium Alicyclobacillus acidocaldarius Is Mediated by a High-Affinity Transport System That Includes a Maltose Binding Protein Tolerant to Low pH. J. Bacteriol.
182: 6292-6301
[Abstract]
[Full Text]
-
Spiridonov, N. A., Wilson, D. B.
(2000). A celR Mutation Affecting Transcription of Cellulase Genes in Thermobifida fusca. J. Bacteriol.
182: 252-255
[Abstract]
[Full Text]