INTRODUCTION

Top Abstract Introduction Materials and Methods References

The ABC superfamily of transporters has been extensively studied, and members have been identified in most bacteria, archaea, and eukaryotes (9). Uptake of a large variety of nutrients seems to be the most obvious task of these systems. Moreover, ABC transporters are involved in the export of drugs or virulence factors, such as hemolysin, extracellular proteases, and toxins; signal transduction; plant host-bacterial-parasite interaction; antigen presentation in immune cells; transport of pheromones; and sporulation of gram-positive bacteria (3, 7).

Members of the family of binding protein-dependent systems have so far been identified only in prokaryotes (3, 7). These multicomponent systems consist of two membrane-inserted subunits, two components inside the cytoplasm that carry the ATP binding site, and the binding protein located outside the cytoplasm. The binding proteins are responsible for the substrate specificity of the ABC transporter. In gram-negative bacteria, the binding protein is a soluble periplasmic protein, whereas in gram-positive bacteria and archaea, it is a lipoprotein exposed to the cell surface (38).

Streptomyces reticuli is a soil bacterium which hydrolyzes crystalline cellulose (Avicel) due to the action of an exoglucanase (Avicelase, Cel1) (32, 33, 44). The generated cellobiose and cellotriose are taken up via an inducible, binding protein-dependent ABC transporter (cellobiose/cellotriose ABC transport system [34]). The corresponding cellobiose/cellotriose binding protein was shown to be a lipoprotein anchored to the cytoplasmic membrane. This protein was extracted from membranes of S. reticuli and purified to homogeneity; it binds to cellobiose and cellotriose with equally high affinities (34). The ATP-hydrolyzing subunit of the cellobiose/cellotriose ABC transporter is MsiK (35). The msiK gene is a homologue of a previously described Streptomyces lividans msiK (15). MsiK from both Streptomyces species assists two different ABC transporters, one for maltose and one for cellobiose and cellotriose. Earlier studies have indicated that the chromosomally located msiK gene of S. reticuli is not situated in the vicinity of genes encoding the other components of the cellobiose/cellotriose ABC transport system (35).

In this report we characterize the additional clustered genes of the cellobiose/cellotriose transport system from S. reticuli. Further physiological, immunological, transcriptional, and mutational experiments elucidate details of the cellobiose/cellotriose ABC transport system.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods References

Bacterial strains, plasmids, and culture conditions. The wild-type strain S. reticuli Tü45 (DSM 40776; German Collection of Microorganism and Cell Cultures, Braunschweig, Germany) described by Wachinger et al. (44) was obtained from H. Zähner, Tübingen, Germany. The Escherichia coli plasmids pUC18 and pUC19 (47) were used as cloning vectors for DNA sequence analysis and for disruption of the cebE gene. The aminoglycoside 3'-phosphotransferase gene (25) from pUC4K, supplied by Pharmacia, was used for gene disruption experiments. The E. coli K-12 strain DH5 containing the plasmids used in this study was grown in Luria-Bertani medium with 100 µg of ampicillin ml¹ (with pUC derivatives) or 50 µg of kanamycin ml¹ (with pUC4K derivatives) (29). S. reticuli was cultivated in pH-stable minimal medium (45) supplemented with the appropriate carbon source (1%, wt/vol) and 10 mM (NH₄)₂SO₄ as a nitrogen source. For protoplast preparation S. reticuli was grown in complete medium (Oxoid tryptone-soy broth [20 g liter¹], yeast extract [5 g liter¹], sucrose [100 g liter¹], MgCl₂ [10 g liter¹]).

DNA preparation and manipulations. Genomic DNA from S. reticuli was isolated as described previously (12). Plasmids were isolated from E. coli with the aid of a midi plasmid kit (Qiagen GmbH, Hilden, Germany). Restriction enzyme digestions, ligation reactions, and analyses of DNA with nucleases and polymerases were carried out by standard procedures (29). PCR amplification of S. reticuli chromosomal DNA was performed with the oligonucleotides CB1, 5'-GGACATCAACATCAAGGAGAA-3', and CB2, 5'-CTCCTTSCCSAGGTCSACGAA-3', the former corresponding to the DINIKEN motif of amino acids located within the signature sequence of CebE (see Fig. 3). PCR was done under standard conditions (1) but in the presence of 5% dimethyl sulfoxide in a total volume of 50 µl. The mixture was covered with 30 µl of mineral oil and subjected to 30 cycles of 1 min at 96°C, 1 min at 52°C, and 1 min at 72°C. PCR products were purified with a QIAquick PCR purification kit (Qiagen GmbH), cloned into plasmid pUC18 with the aid of a Sure Clone ligation kit (Pharmacia, Freiburg, Germany), and subjected to nucleotide sequencing.

Preparation and screening of subgenomic DNA libraries. Total DNA (200 µg) from S. reticuli was cleaved with BamHI, and the resulting fragments were separated on an agarose gel. Fragments of about 1.5 to 2 kb were eluted with a QIAEX II gel extraction kit and ligated to BamHI-digested and dephosphorylated pUC18. The ligation mixtures were transformed to E. coli DH5 by electroporation with an Electroporator II from Invitrogen (NV Leek, The Netherlands). Ampicillin-resistant transformants were tested for the presence of the desired cebE gene by colony hybridization at 54°C overnight with the digoxigenin-labelled PCR fragment (DNA labelling and detection kit; Boehringer, Mannheim, Germany). Three additional subgenomic DNA libraries consisting of SstII (1 to 1.5 kb), ScaI-HindIII (2 to 2.5 kb), and BamHI (2 to 2.5 kb) were generated in pUC18 and screened as described above.

DNA sequence analysis. DNA sequencing of both strands of the ceb region was performed with double-stranded DNA based on the dideoxy chain termination method (30) with a Cy5 Autoread sequencing kit, Cy5-dATP labelling mix (Pharmacia), and universal or specific primers (MWG-Biotech, Ebersberg, Germany). Sequencing reactions were run on an ALFexpress sequencer from Pharmacia. The DNA and protein sequences were analyzed with the GENMON program (GBF, Braunschweig, Germany), as well as the Genetics Computer Group sequence analysis software package (version 8.0; Biotechnology Center, University of Wisconsin, Madison). Reading frames were determined with the GCWIND program (D. Shields, Dublin, Ireland) on the basis of the codon usage preference in Streptomyces DNA. The predicted proteins were scanned for similarities to sequences in the SWISS-PROT and EMBL databases with the FASTA and BLITZ algorithms (27). Membrane-spanning segments were predicted by the TMpred program according to the method of Hoffman and Stoffel (10).

Determination of amino acid sequences. Purified CebE protein (2 mg) was incubated overnight at 30°C with 20 mM CNBr in 80% (vol/vol) formic acid and subsequently evaporated to dryness. Resulting peptides were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (15%, wt/vol, acrylamide) and transferred onto a polyvinylidene difluoride membrane (Immobilon P; Millipore GmbH, Eschborn, Germany) as described previously (11). After Coomassie brilliant blue staining, different protein bands were excised and NH₂-terminal amino acids were determined by Edman degradation by R. Schmid, University of Osnabrück, Osnabrück, Germany.

Generation of MsiK antibodies and Western blot analysis. A DNA fragment (372 bp) encoding the C terminus of MsiK was amplified with the primers MsiK1 (CTGTCCAACCTGGACGCCAAG) and MsiK2 (GTGCTCGGGGCGGACGCCGAC) with chromosomal DNA of S. reticuli and cloned into SmaI-restricted pUC18. From this plasmid the PCR fragment was isolated as a BamHI-KpnI fragment (383 bp) and recloned with pQE31 (Qiagen). The resulting construct, pMS131, contained the desired part of msiK with six codons encoding histidines at its 5' end. Strain SG13009 (Qiagen) transformed with pMS131 produced the His tag MsiK fusion protein in inclusion bodies. Once we obtained and solubilized the inclusion bodies, the fusion protein was purified by affinity chromatography with Ni²⁺-nitrilotriacetic acid according to the instructions of the manufacturer (Qiagen). Antiserum was obtained by immunization of a rabbit with the purified six-His-MsiK fusion protein (Eurogentec, Seraing, Belgium). Western blot analyses were conducted as described previously (40) with a 1:10,000 dilution of antibodies raised against His-tagged MsiK or a 1:100,000 dilution of antibodies raised against CebE (34).

Construction of a cebE disruption mutant. The cebE gene in pCB40 was cleaved by NaeI, resulting in an internal cebE deletion of 1,037 bp. Overhangs of the remaining plasmid were filled in with the Klenow enzyme and deoxynucleoside triphosphates and ligated to a PstI fragment from pUC4K (Pharmacia) comprising the kanamycin resistance (aphI) gene (25). The resulting construct was named pCB41. Protoplasts of S. reticuli were generated (12) and transformed with pCB41, which was isolated from the dam and dcm methylation-deficient E. coli strain JM110. Transformants were selected by overlaying regenerating protoplasts with agar (0.75%) containing kanamycin (20 µg/ml).

RNA isolation and Northern blot analysis. Total RNA was isolated from S. reticuli with acid guanidinium thiocyanate-phenol-chloroform (6). For Northern blot analysis, RNA (15 µg per slot) was separated in formaldehyde gels (1) and transferred onto nylon membranes by vacuum blotting (LKB 2016 VacuGene; Pharmacia). RNA molecular weight marker I (0.3 to 6.9 kb) from Boehringer was used for size determination. The molecular weight markers were stained on the surface of the nylon filter with 0.2% methylene blue in 0.2 M sodium acetate (pH 4.7) (20). Hybridization was performed at 64°C for 20 h in a solution containing 5× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 0.1% SDS, 100 µg of salmon sperm DNA ml¹, and 5× Denhardt's reagent (29) with randomly [-³²P]dCTP-labelled DNA fragments (Rediprime DNA labelling system; Amersham, Freiburg, Germany). The membrane was washed twice in 2× SSC-0.1% SDS for 5 min and twice in 0.1× SSC-0.1% SDS for 30 min and subjected to autoradiography at 70°C.

S1 nuclease mapping of transcription start sites. The probes were generated by PCR amplification of a 396-bp fragment with pCB20 as the template and 10 pmol of the synthetic oligonucleotides E101 (for the cebE probe) and R103 (for the cebR probe) (see Fig. 2). Primers were labelled with [-³²P]ATP and T4 polynucleotide kinase (1) and used for PCRs with the corresponding unlabelled primer. Labelled PCR products were purified with a QIAquick PCR purification kit (Qiagen). For every S1 nuclease protection reaction, 50 µg of RNA was hybridized to ~10⁵ Cerenkov counts of the PCR fragment in Na-TCA buffer (23) min¹ at 45°C for 6 h, after denaturation at 65°C for 15 min. Hybridization products were digested with S1 nuclease (Gibco, Life Technologies, Karlsruhe, Germany) as outlined by the manufacturer. Undigested radiolabelled DNA was precipitated with ethanol and run on a 6% polyacrylamide gel. The dried gel was subjected to autoradiography at 70°C. Sequence ladders were generated by the dideoxy chain termination method with the labelled primers R103 and E101 and with pCB20 as a template.

Nucleotide sequence accession number. The nucleotide sequence data reported in this article are stored in the EMBL database under the accession no. AJ009797 and AJ009798.

	RESULTS AND DISCUSSION

Cloning of the cebREFG cluster and the bglC gene. As the NH₂-terminal amino acids of the purified CebE protein (34) could not be obtained by Edman degradation, several internal peptides were generated by CNBr treatment. After separation by SDS-PAGE, NH₂-terminal amino acids were determined from three peptides (see Fig. 2) and used to deduce corresponding oligonucleotides. These, in turn, were used to generate fragments from total S. reticuli DNA in PCRs. The obtained fragments were cloned into pUC18, and their nucleotide sequences were determined. From the construct which comprises a fragment encoding a portion of the CebE protein (pCB1) (Fig. 1A), the PCR fragment was reisolated, labelled, and used to screen a subgenomic S. reticuli DNA library in E. coli DH5 (containing 1.5- to 2-kb BamHI genomic S. reticuli fragments in pUC18). Several clones were identified by colony hybridization, and their plasmids were analyzed. Sequencing revealed that an inserted 1.7-kb BamHI fragment was the desired one (Fig. 1). As genomic S. reticuli SstII (1.2 kb) and HindIII-ScaI (2.4 kb) fragments hybridized with the 1.7-kb BamHI fragment, corresponding subgenomic libraries were generated in pUC18 and the desired overlapping fragments were gained (Fig. 1). The genomic 2.3-kb BamHI fragment was obtained with the 1.2-kb SstII probe in a manner similar to that described above.

View larger version (18K): [in this window] [in a new window]   FIG. 1.   Constructs and organization of genes. (A) Initial PCR product and maps of the cloned chromosomal fragments in pUC18. (B) Arrangement of genomic cebREFG and bglC. The restriction sites relevant for cloning are shown. The probes used for transcription analysis are shown above the genes (). Arrows mark the positions of transcripts. Predicted transcription terminators are indicated by stem-loop structures. orf, open reading frame.

Determination of the sequence and its analysis. The sequences of the cloned overlapping fragments were determined. FRAME analysis (2) of the assembled 5,448-bp DNA fragment revealed the presence of five reading frames, whose codon usage was found to be typical of GC-rich Streptomyces DNA. The sequence of the first reading frame comprises 1,056 bp with a G+C content of 74 mol%. A start codon (ATG), a putative ribosome binding site, and a stop codon (TGA) were identified (Fig. 2). The deduced amino acid sequence of this open reading frame encodes a 39-kDa protein of 351 amino acids (aa). It was named CebR, as within its NH₂ terminus a helix-turn-helix (HTH)-containing region characteristic of DNA binding proteins was identified (46). The deduced CebR is most closely related to GalR (38% of its amino acid residues are identical) and RbsR from E. coli (37% of its amino acid residues are identical), the latter representing a repressor of the ribose ABC transport operon (19). GalR and RbsR are both members of the LacI-GalR regulatory family. Interestingly, only 32% of CebR's amino acid residues are identical to those of the recently identified Streptomyces coelicolor A3(2) MalR regulator of the operon for a maltose ABC transporter (41).

View larger version (56K): [in this window] [in a new window]   FIG. 2.   Partial nucleotide sequences and deduced amino acid sequences of cebREFG and bglC. The deduced amino acid sequences are given in the one-letter code below the nucleotide (nt) sequence, and nucleotide numbers are shown on the right. The putative ribosome binding sites (rbs) are in white letters on a black background, and predicted terminators are indicated by arrows above the sequence. The transcriptional start sites are in boldface type and are marked by asterisks followed by arrows indicating the direction of transcription (tE, transcription start site for cebE; tR1 and tR2, transcription start sites for cebR). The sequence similar to that of the Streptomyces class E promoter is marked by a line above the sequence. The oligonucleotides R103 and E101 used for S1 nuclease mapping are represented by broken lines. The predicted HTH motif in the deduced CebR protein is underscored, and the putative operator sequence for CebR binding is boxed (OCebR). The signal peptide of CebE followed by the recognition sequence for the cleavage site of lipoprotein signal peptidase is double underscored. The NH2-terminal amino acids of peptides from the purified CebE and BglC proteins determined by Edman degradation are in boldface type. Most of the sequence within the structural genes has been omitted, as is indicated by dots and double-slashed bars.

View larger version (32K): [in this window] [in a new window]   FIG. 3.   Alignments of signature sequences from binding proteins. The numbers indicate the positions of the amino acids. The highly conserved lysine (R) residue (according to the work of Tam and Saier [39]) is given in boldface type, and residues conserved in CebE are underlined. Sr, S. reticuli; Sc, S. coelicolor A3(2); Ec, E. coli; Sp, Streptococcus pneumoniae; Sm, Streptococcus mutans; Tt, Thermoanaerobacterium thermosulfurigenes; MalE, MalX, and AmyE, maltose and maltodextrin binding proteins; UgpB, sn-glycerol-3-phosphate binding protein; MsmE, multiple-sugar binding protein.

Transcriptional experiments. Hybridization experiments with total RNA isolated from cellobiose-grown S. reticuli mycelia revealed the formation of a polycistronic transcript (4.9 kb) comprising cebEFG and bglC. Additionally, shorter transcripts corresponding to cebEFG (3.1 kb), cebEF (2.3 kb), and cebE (1.5 and 1 kb) were detected. The small transcript (1.5 kb) corresponding to the cebE gene attained up to 20-fold higher levels of transcription than the 4.9- and 3.1-kb transcripts. During cultivation with glucose, almost no cebEFG or bglC transcripts were found (Fig. 4). The large amount of the 1.5-kb cebE transcript corresponds to the high levels of CebE protein present within membranes of S. reticuli during cultivation on cellobiose (34). The size of the 1.5-kb cebE transcript is in agreement with the distance from the cebE transcription start site (nucleotide 1244) (Fig. 2) to the predicted terminator following the stop codon of cebE (nucleotides 2749 to 2787). An additionally predicted terminator within the cebE gene corresponds to the 1.0-kb cebE transcript. However, a truncated CebE protein of the corresponding size (30 kDa) was not identified immunologically, suggesting that this small transcript is not translated under the conditions used or that it represents a degraded RNA form.

View larger version (35K): [in this window] [in a new window]   FIG. 4.   Transcription studies of the ceb operon and msiK gene. Total RNA (15 µg) from mycelia grown in the presence of glucose (lanes 1) and cellobiose (lanes 2) was separated electrophoretically. After transfer of the RNA to a nylon membrane, the strips were hybridized with the indicated 32P-labelled probes and exposed to X-ray films. The X-ray film of the cebR Northern blot analysis was exposed eight times longer than the others. Transcript sizes (in kilobases) are given on the left.

View larger version (85K): [in this window] [in a new window]   FIG. 5.   Mapping of the transcription initiation sites of cebE and cebR. RNA (50 µg) prepared from mycelia of S. reticuli grown in the presence of cellobiose was hybridized to 0.1 pmol of the 32P-labelled cebR (A) or cebE (B) probes, and S1 nuclease treatment (lanes S) was done as described in Materials and Methods. ACGT indicates the cebR and cebE nucleotide sequence ladders. The asterisks mark the most probable transcription start sites.

Production of CebE and MsiK. Antibodies raised against the C-terminal part of MsiK and the mature CebE (34) were used to monitor the levels of corresponding proteins during cultivation on minimal media containing different saccharides (Fig. 6). S. reticuli was found to produce CebE only if it was grown in the presence of cellobiose (not with glucose, maltose, or sucrose). When, however, cellobiose and one of the above-mentioned saccharides were added together to the culture medium, the level of CebE attained was nearly that ascertained for mycelia grown only with cellobiose.

View larger version (46K): [in this window] [in a new window]   FIG. 6.   Synthesis of CebE and MsiK proteins. Wild-type S. reticuli was grown in minimal medium with the following saccharide(s) at 0.5% (wt/vol) each: glucose (lane 1), cellobiose (lane 2), cellobiose plus glucose (lane 3), cellobiose plus maltose (lane 4), cellobiose plus sucrose (lane 5), maltose (lane 6), and sucrose (lane 7). Mycelia were disrupted by sonification, and 20 µg of protein per lane was separated by SDS-PAGE (17). Immunodetection of CebE (A) and MsiK (B) proteins was performed as outlined previously (35).

Construction of an S. reticuli cebE mutant. The cebE gene was inactivated by insertion mutagenesis. The aphI gene from Tn903 (25) was inserted into the pUC18-borne cebE gene with an internal deletion of an NaeI fragment (1,037 bp). After the S. reticuli wild type was transformed with the resulting plasmid, pCB41, several resistant colonies growing with 20 µg of kanamycin per ml were found. Following a double crossover between the genomic cebE gene and the cebE-homologous flanking portions of the aphI gene on pCB41, the aphI gene was found to disrupt the reading frame of the cebE gene, which was confirmed by Southern hybridization. The mRNA of this kanamycin-resistant S. reticuli mutant lacks all transcripts corresponding to cebEFG and bglC, showing that the insertion of the aphI gene in cebE had an effect on the transcription of genes located downstream from it. As expected, the CebE protein was not detectable immunologically within cell extracts prepared from the cebE mutant. In minimal medium supplemented with glucose, the cebE mutant grew with the same doubling time as that of the wild-type strain (3 h). In cellobiose-containing minimal medium, the growth rate of the wild-type strain was not affected but the cebE mutant strain grew quite poorly (Fig. 7A). Unlike with the wild type, no or only very little cellobiose was taken up by mycelia of the cebE mutant during short-term uptake experiments (Fig. 7B). However, after prolonged incubation (exceeding 10 min), small amounts of ¹⁴C label were detected. Previously (8) we had shown that S. reticuli produces extracellular and intracellular -glucosidase activities (detected by hydrolysis of p-nitrophenyl--D-glucopyranoside). Inspection of the cebE mutant revealed that the -glucosidase activities were comparable to those of the progenitor strain (data not shown). Thus, we suspect that part of the ¹⁴C-labelled cellobiose was cleaved to glucose.

View larger version (14K): [in this window] [in a new window]   FIG. 7.   Characterization of the cebE mutant. (A) Physiological experiments. Spores (106/ml) of the wild type () and the cebE disruption mutant () were inoculated into minimal medium containing 0.5% (wt/vol) Casamino Acids and glucose or cellobiose. After 24 h, the mycelia were washed twice with minimal medium lacking Casamino Acids, and after the addition of cellobiose, the growth could be monitored photometrically (optical density at 600 nm [OD600]), due to the finely dispersed hyphae. (B) Cellobiose uptake experiments. Mycelia from the S. reticuli wild type () or the cebE mutant () were grown in minimal medium containing Casamino Acids (0.5%) and cellobiose for 16 h, and then the mycelia were washed twice with 50 mM potassium phosphate buffer, pH 7.0. Uptake of [14C]cellobiose (5 µM) was determined as described previously (34). As a control, the uptake of cellobiose was determined in wild-type () mycelia cultivated with glucose. dw, dry weight.