Previous Article | Next Article 
Applied and Environmental Microbiology, July 1999, p. 3129-3133, Vol. 65, No. 7
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Identification and Characterization of a Flagellin
Gene from the Endosymbiont of the Hydrothermal Vent Tubeworm
Riftia pachyptila
Deborah S.
Millikan,
Horst
Felbeck, and
Jeffrey L.
Stein*
Marine Biology Research Division, Scripps
Institution of Oceanography, University of California, San Diego,
La Jolla, California 92093-0202
Received 30 December 1998/Accepted 16 April 1999
 |
ABSTRACT |
The bacterial endosymbionts of the hydrothermal vent tubeworm
Riftia pachyptila play a key role in providing their host
with fixed carbon. Results of prior research suggest that the symbionts are selected from an environmental bacterial population, although a
free-living form has been neither cultured from nor identified in the
hydrothermal vent environment. To begin to assess the free-living potential of the symbiont, we cloned and characterized a flagellin gene
from a symbiont fosmid library. The symbiont fliC gene has a high degree of homology with other bacterial flagellin genes in the
amino- and carboxy-terminal regions, while the central region was found
to be nonconserved. A sequence that was homologous to that of a
consensus
28 RNA polymerase recognition site lay
upstream of the proposed translational start site. The symbiont protein
was expressed in Escherichia coli, and flagella were
observed by electron microscopy. A 30,000-Mr
protein subunit was identified in whole-cell extracts by Western blot
analysis. These results provide the first direct evidence of a motile
free-living stage of a chemoautotrophic symbiont and support the
hypothesis that the symbiont of R. pachyptila is acquired
with each new host generation.
 |
INTRODUCTION |
Symbioses between chemoautotrophic
bacteria and marine invertebrates are found in a wide variety of marine
environments including deep-sea hydrothermal vents, sewage outfalls,
anoxic basins, seagrass beds, and coralline sands (reviewed in
references 12, 15, and 33). The
hydrothermal vent tubeworm Riftia pachyptila is one of the
most conspicuous vent animals and is an example of an organism involved
in a highly specialized symbiotic association. The adult tubeworm of
this species lacks a mouth and digestive system (24) and is
never found without symbionts. Early studies showed that
chemoautotrophic bacteria are found within bacteriocyte cells localized
in a specialized organ called the trophosome (6, 11).
Because the symbionts of R. pachyptila have eluded
cultivation, their classification has been based principally on rRNA
sequence analysis (9, 28, 44). The symbionts of R. pachyptila, as with all of the thioautotrophic symbionts examined
to date, unambiguously belong to the gamma subdivision of the proteobacteria.
Indirect evidence suggests that the development and survival of
R. pachyptila is entirely dependent on the acquisition of symbionts from a free-living bacterial population via horizontal transmission. In situ probing studies have failed to detect symbionts in R. pachyptila gametes (5). While adult
tubeworms lack a mouth and digestive system (23), young
juveniles possess a transient mouth and a ciliated gut but lack
symbiont-containing tissues (22, 25). Additionally, it
appears that the chemoautotrophic symbionts have not coevolved with
their vestimentiferan hosts (13, 29). Furthermore, our
recent evidence suggests that the symbionts possess functional
mechanisms for sensing and responding to their environment through
two-component regulatory systems (21). Taken together, these
results suggest the presence and importance of a free-living
protosymbiont. However, such an organism has yet to be identified from
the hydrothermal vent environment.
An obvious feature required to establish contact with and eventually
invade a host cell is motility mediated by flagella. Motility and
flagellum-associated structures are important colonization factors in a
number of bacterial symbionts and pathogens of animals (16, 17,
32, 35, 37, 40, 41) and of plants (2, 4, 8). Motility
is a complex phenotype, which in Escherichia coli requires
the coordinated expression of more than 60 genes contained in at least
13 operons in order to synthesize and rotate the E. coli
flagellar apparatus (30). Flagellin molecules, encoded by
the fliC gene, are the subunits which polymerize to form
filaments of the bacterial flagellum. Flagellin proteins from diverse
bacterial species commonly share conserved amino acid residues, making
it possible to identify flagellin genes by sequence similarity.
For the lack of cultivated symbionts and the failure to identify a
free-living protosymbiont from the hydrothermal vent environment we
used alternative methods to investigate the potential of the symbionts
to colonize their host. Recent findings of functional two-component
regulatory systems (21) suggest that the presence of
motility genes are likely and support our approach. We report here the
identification of a symbiont flagellin gene and its characterization by
expression in E. coli.
 |
MATERIALS AND METHODS |
PCR amplification of a flagellin gene from R. pachyptila symbiont DNA.
The following degenerate primers
were designed by aligning conserved sequences of known enteric FliC
genes: 5'-ATGGCACAAGTCATTAATACmAAC-3' and
5'-GCCTGCTGsAkAATCTGCGCTTT-3'. The primers align with the 5'
and 3' terminal regions of known flagellin genes. PCR was performed with 1 ng of purified R. pachyptila symbiont genomic DNA per
µl by using standard reagents and reaction conditions (30 cycles of
92°C for 90 s, 50°C for 90 s, and 72°C for 2 min)
(42). Amplification products were cloned and sequenced to
confirm their similarity to flagellin sequences.
Hybridization of the symbiont fosmid library.
The
preparation of the symbiont fosmid library was previously reported
(21). The 1,500-member fosmid library consists of clones
that contain DNA inserts of 35 to 45 kbp. The hybridization of the
library with labeled amplification products was performed by using
standard methods (42). The hybridization was analyzed by
autoradiography and confirmed by Southern hybridization of restriction-digested positive fosmid clones. A 3.8-kbp
EcoRI-digested DNA fragment present in all 11 positive
fosmids was subcloned into the plasmid pBluescript (Stratagene, La
Jolla, Calif.) and sequenced (ABI Sequencer 480).
Expression of R. pachyptila symbiont flagellin in
motility mutant E. coli.
DNA from fosmid 1O9 was digested
with EcoRI, and a 3.8-kbp DNA fragment shown to contain the
flagellar gene was cloned into pBluescript (Stratagene) resulting in
pDH90. Two primers, fliC-for (TAGGAGAAAAGCTTTGGCACTCGT
[FTF-F, 24-mer]) and fliC-rev
(AGATCACCCGGATCCCGGTCGATG [FTF-R, 24-mer]),
were used to PCR amplify the flagellin gene from symbiont genomic DNA.
Both primers were designed such that restriction sites (underlined)
were created in the PCR amplification. The resulting 874-bp
amplification product was directionally cloned into pBluescript,
resulting in pDH95. Plasmid pMS1 containing the Salmonella
H2 gene was used as a positive control for complementation by a
homologous gene (lab strain from M. Simon). The resulting constructs
were then transferred into E. coli motility mutant strains
JA11, CSH4, and RP4770. E. coli JA11 has the 5'
flagellin-encoding gene fliC of E. coli
(26) deleted, and strain CSH4 contains an uncharacterized
mutation of the fliC gene (43a).
Motility experiments.
The motility of the fliC
mutant strains containing fosmid clones pDH90 and pDH95 was observed
both by microscopy and by assessing motility on swarm agar plates.
Motility was determined by measuring the movement of bacterial cells on
swarm agar plates containing 1% tryptone, 0.5% NaCl, and 0.25% agar.
The optical density at 600 nm was determined for cultures grown
overnight and for cultures at the mid-exponential phase. Equivalent
numbers of cells in 2-µl volumes were spotted in the centers of swarm
agar plates, and movement away from the center was measured after
24 h at 30°C.
Purification of flagellar filaments.
E. coli JA11
carrying the plasmid pMS1 or pFOS1O9 was grown in 500-ml cultures to
mid-log growth. The bacterial cells were pelleted (8,500 × g for 15 min at 4°C) and resuspended in phosphate-buffered saline (42). Flagella were sheared from the bacteria in a
Waring blender set at high speed for 1 min, and the bacterial cells
were pelleted (5,500 × g for 10 min at 4°C). The
supernatant was collected, and the flagella were pelleted by
ultracentrifugation (40,000 rpm in a VTi65 rotor [Beckman] for 2 h at 10°C). The flagella were resuspended overnight in water and
denatured in sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) sample buffer.
Electron microscopy.
Electron microscopy was performed
with a JEOL(Tokyo, Japan) microscope, and negatively stained
cells were prepared as described previously (31).
Alternatively, grids were prepared by ultracentrifugation of cells
directly onto copper grids (40,000 rpm in a SWTi65 rotor for 1 h
at 10°C).
SDS-PAGE and Western immunoblotting.
SDS-PAGE was performed
by using standard protocols (42). Transferred proteins were
reacted with monoclonal antibody 15D8 (1:500 dilution) in 5% milk at
35°C for 2 h, to allow the antibody to bind to specific
proteins. The antibody 15D8 recognizes a conserved epitope in
flagellins expressed by E. coli and other members of the
family Enterobacteriaceae (14). To detect the
antigen-antibody complexes, horseradish peroxidase conjugated to goat
anti-mouse immunoglobulin G was diluted 1:10,000 in 5% milk and
incubated with the blots for 2 h at 35°C. The blots were treated
for 5 min at room temperature with a chemiluminescent substrate
following the manufacturer's suggestions (Super Signal; Pierce). The
developed blots were immediately exposed on autoradiographic film.
Nucleotide sequence accession number.
The nucleotide
sequence for the R. pachyptila symbiont fliC
gene encoding a protein similar to enteric bacterial flagellin proteins
is available from the GenBank database under accession no. AF105060.
 |
RESULTS |
Probing the symbiont fosmid library resulted in the identification
of 11 clones containing similar 40- to 45-kbp inserts with an
overlapping 3.8-kbp EcoRI fragment that hybridized to
the putative fliC amplification product (data not shown). Southern
hybridization of R. pachyptila symbiont genomic DNA
confirmed the origin of the amplification product to be the trophosome
symbiont and showed hybridization of a single EcoRI
DNA fragment, indicating that a single copy of the gene is present in
the genome. Two fosmids, pFOS1O9 and pFOS2G9, and a subclone of
the 3.8-kbp fragment (pDH90) were chosen for further work.
Analysis of the DNA sequence revealed three open reading frames (ORFs)
(Fig. 1), one of which revealed high
sequence similarity to previously characterized flagellin-encoding
(fliC) genes. The second ORF consists of 846 nucleotides,
starting with ATG and ending with the termination codon, TAA. A
putative stem-loop structure (GCATCCGGGTGATCTAGCCCGGATGCAC)
is found 13 nucleotide bases downstream of the termination codon,
which could act as a transcriptional terminator (39). The
inspection of the upstream region of this ORF revealed a 5'-AGGAG
region which resides 8 bases upstream from the putative ATG
translational start site and which resembles the AGGAGG
E. coli Shine-Dalgarno ribosome-binding site consensus sequence. A comparison of the region upstream with corresponding regions in other bacteria showed that this region contains a putative promoter recognized by RpoF (
28) containing RNA
polymerases. This flagellar gene-specific RNA polymerase is responsible
for the expression of flagellar genes in other bacteria
(19). The putative symbiont fliC promoter (TAAA-N15-GCCGTTAC) contains a single mismatch
compared to the Salmonella typhimurium H1 promoter
(TAAA-N15-GCCGATAC) sequence and two
mismatches compared to the E. coli consensus
28 promoter
(TAAA-N15-GCCGATAA) sequence.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 1.
Restriction map of the symbiont fliC gene
region from the fosmid clone pFOS1O9. The size and transcriptional
direction of the rbfC, fliC, and flaG
genes are shown by arrows. The fliC fragments cloned for the
expression study are indicated below the appropriate sequence.
|
|
The deduced amino acid sequence of the second ORF predicts a protein of
281 amino acids with a molecular mass of 29,422 Da. The sequence
contains 82% similar and 65% identical amino acids throughout the
amino-terminal (amino acids 1 to 106) and carboxy-terminal (amino acids
197 to 280) domains of the FliC protein from Legionella micdadei.
L. micdadei was chosen for comparison since it belonged to the
gamma subdivision of the proteobacteria and showed the highest sequence
similarity to the symbiont protein. In addition, sequence information
on more closely related marine bacteria is unavailable. Sequences
throughout the entire length of the predicted symbiont protein are
approximately 50% similar to the flagellin proteins of L. micdadei, E. coli, Pseudomonas aeruginosa,
and Aeromonas salmonicida.
Plasmids containing the complete symbiont fliC gene under
the control of the IPTG
(isopropyl-
-D-thiogalactopyranoside)-inducible lac promoter (pDH95) or its native promoter (pDH90) were
expressed in motility mutant E. coli JA11
(
fliC). This strain was chosen because the mutation is
stable and well characterized and the strain is impaired in
recombination (26). A plasmid containing the S. typhimurium H2 gene, pMS1, was chosen as a positive control for
complementation by a heterologous gene. On swarm plates, cells expressing the symbiont fliC gene did not show significant
swarming ability; however, the cells appeared motile by light
microscopy. Further inspection by electron microscopy revealed the
presence of flagella. JA11 cells containing a vector alone (pBS or
pBAC) never showed flagella (Fig. 2A),
while JA11 cells containing the positive control pMS1 gene showed
flagella (Fig. 2D).

View larger version (139K):
[in this window]
[in a new window]
|
FIG. 2.
Electron microscopy of motility mutant E. coli JA11 expressing the flagellin gene from the R. pachyptila symbiont. JA11 cells contained the following plasmids:
pBluescript (vector control) (A); pDH90, containing the R. pachyptila symbiont fliC gene (FliCRS) (B);
pDH95 (FliCRS) (C); and pMS1, containing the
Salmonella H2 flagellin gene (FliCST) (D). Cells
at the mid-exponential phase were prepared for electron microscopy by
negative staining with 0.5% uranyl acetate. Bar, 500 nm.
|
|
To support the observation of symbiont flagella by electron microscopy,
we performed Western blot analysis. The Western blot shown in Fig.
3 demonstrates the recognition of the
symbiont flagellin by a monoclonal antibody (15D8) that specifically
recognizes a conserved epitope in flagellins expressed by E. coli and other members of the family Enterobacteriaceae
(14). A 30,000-Mr protein in
whole-cell purifications of JA11 cells containing plasmids with the
symbiont flagellin gene (pDH90 or pDH95) reacted with the antibody
(FliCRS) (Fig. 3, lanes 4 and 5, respectively). As expected, a 51,000-Mr protein corresponding to
the E. coli flagellin subunit was not detected. The antibody
did react with a 55,000-Mr species in both
high-speed pellets and whole-cell preparations of JA11 containing the
plasmid pMS1 encoding the S. typhimurium flagellin gene
(FliCST) (Fig. 3, lanes 1 and 2, respectively). The vector
control JA11 (pBS) showed no reactivity with the antibody (Fig. 3, lane
3).

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 3.
Immunoblots showing reactivity of the
anti-FliCE antibody (15D8) with purified
Salmonella H2 flagellin (lane 1) and E. coli JA11
containing pMS1 (lane 2), pBluescript (lane 3), pDH90 (lane 4), or
pDH95 (lane 5).
|
|
 |
DISCUSSION |
The chemoautotrophic bacterial symbionts of the hydrothermal vent
tubeworm R. pachyptila are likely acquired from the
environment and thus must be able to adapt outside the host prior to
inoculation of the tubeworm gut. We have identified a flagellin gene
from the symbiont and have begun to characterize the flagellin
expressed in an E. coli host system. The alignment of the
predicted symbiont amino acid sequence with those of other bacterial
flagellin proteins shows that the structure of this protein is highly
conserved within the amino- and carboxy-terminal regions. These
conserved regions have been shown to be necessary for the export and
polymerization of the flagellin subunits (20).
Interestingly, the symbiont fliC gene product is lacking a
large portion of the central domain, compared to the sequence of other
flagellin proteins. It is unclear what effect if any the loss of the
central domain would have on flagellar assembly or function; however,
this region can be replaced with an unrelated sequence or can be
removed without a loss of motility in other bacteria (27,
34).
To better understand the structure of the symbiont flagellum, we
expressed the flagellin gene and attempted to complement motility in
several nonmotile E. coli
fliC or
fliC-negative strains. The expression of the symbiont
fliC gene in cells of the E. coli motility mutant
strain JA11 was shown by the presence of flagella observed by electron
microscopy. However, the expression was at a low frequency, since
approximately 5% of the recombinant cells appeared to be flagellated.
It is possible that FliCRS production is toxic to E. coli, as supported by earlier findings in which the complete
flagellin gene from L. micdadei and Treponema
pallidum could not be expressed in E. coli (3,
36). Alternatively, the observed low-level expression may be due
to the failure of the symbiont flagellin to be recognized for filament
export or assembly, and thus the intracellular accumulation of
flagellin could result in feedback control of operon expression. For
this reason we investigated the expression of the symbiont protein by
Western analysis with whole-cell extracts. The results indicated that a
30,000-Mr protein, of a size similar to that
expected for the symbiont flagellin (Mr, 29,422)
was identified in whole-cell extracts, suggesting the observed flagella
is comprised of symbiont flagellin subunits.
Considering the high degree of similarity between the symbiont
fliC gene product and the amino acid sequence of other
bacterial flagellins, it seems reasonable to assume that the protein
encoded by this gene serves a similar flagellar structural function in the symbiont. Additionally, the identification of a conserved regulatory sequence motif (
28 promoter) upstream of the
symbiont gene strongly suggests that the symbiont flagellin is
regulated by a conserved mechanism (19). In other bacterial
species, flagella expression is controlled by environmental signals
(7, 10, 18, 38, 43). It is unclear what parameters would
regulate the expression for a deep-sea chemoautotrophic symbiont, and
such studies clearly must await the culturing of such organisms. In a
number of nonpathogenic associations between animals and motile
bacteria, flagella are required for invasion but are lost shortly after
colonization of the host animal (12, 16, 41, 45). It is
unknown what down-regulates flagellar expression for a symbiont or what
regulates the expression of flagella once the bacteria are released
from the host animal (41). In at least some cases this
repression may be the result of a modulation of motility gene
regulation such as that controlling both flagella synthesis and
virulence determinants in Bordetella (1).
We hypothesize that motility is an important phenotype for the R. pachyptila symbiont by comparison to analogous types of associations in which motility is essential for symbiont colonization. Our assessment of the potential for motility of this symbiont and more
recent evidence for the presence and function of chemotaxis genes
(31a) lend direct support to the hypothesis that the
symbionts are acquired by their host with each new generation. Studies
such as this one will enable us to begin to assess the function of this
uncultivated symbiont outside its host organism.
 |
ACKNOWLEDGMENTS |
We thank Peter Feng, Reid Johnson, and Sandy J. Parkinson for
their generous gifts of antibody, plasmid, and strains, respectively.
This work was supported by National Science Foundation grant
OCE93-14525 to H.F. and a Patricia Roberts Harris graduate fellowship to D.S.M.
 |
FOOTNOTES |
*
Corresponding author. Present address: Quorum
Pharmaceuticals, 13525 Samantha Ave., San Diego, CA 92129. Phone: (619)
538-5780. Fax: (619) 538-5009. E-mail: jstein{at}qpharm.com.
Formerly published as D. S. Hughes.
 |
REFERENCES |
| 1.
|
Ackerley, B. J.,
D. M. Monack,
S. Falkow, and J. F. Miller.
1992.
The bvg locus negatively controls motility and synthesis of flagella in Bordetella bronchiseptica.
J. Bacteriol.
174:980-990[Abstract/Free Full Text].
|
| 2.
|
Ames, P., and K. Bergman.
1981.
Competitive advantage provided by bacterial motility in the formation of nodules by Rhizobium meliloti.
J. Bacteriol.
148:728-729[Abstract/Free Full Text].
|
| 3.
|
Bangsborg, J. M.,
P. Hindersson,
G. Shand, and N. Hoiby.
1995.
The Legionella micdadei flagellin: expression in Escherichia coli K12 and DNA sequence of the gene.
APMIS
103:869-877[Medline].
|
| 4.
|
Caetano-Anolles, G.,
L. G. Wall,
A. T. De Micheli,
E. M. Macchi,
W. D. Bauer, and G. Favelukes.
1988.
Role of motility and chemotaxis in efficiency of nodulation by Rhizobium meliloti.
Plant Physiol.
86:1228-1235[Abstract/Free Full Text].
|
| 5.
|
Cary, S. C.,
W. Warren,
E. Anderson, and S. J. Giovannoni.
1993.
Identification and localization of bacterial endosymbionts in specialized hydrothermal vent taxa with symbiont-specific polymerase chain reaction amplification and in situ hybridization techniques.
Mol. Mar. Biol. Biotechnol.
2:51-62[Medline].
|
| 6.
|
Cavanaugh, C. M.,
S. L. Gardiner,
M. L. Jones,
H. W. Jannasch, and J. B. Waterbury.
1981.
Procaryotic cells in the hydrothermal vent tubeworm.
Science
213:340-342[Abstract/Free Full Text].
|
| 7.
|
Chen, L., and J. D. Helmann.
1994.
The Bacillus subtilis D-dependent operon encoding the flagellar proteins FliD, FliS, and FliT.
J. Bacteriol.
176:3093-3101[Abstract/Free Full Text].
|
| 8.
|
Chesnokova, O.,
J. B. Coutinho,
I. H. Khan,
M. S. Mikhail, and C. I. Kado.
1997.
Characterization of flagella genes of Agrobacterium tumefaciens, and the effect of a bald strain on virulence.
Mol. Microbiol.
23:579-590[Medline].
|
| 9.
|
Distel, D. L.,
D. J. Lane,
G. J. Olsen,
S. J. Giovannoni,
B. Pace,
D. A. Stahl, and H. Felbeck.
1988.
Sulfur-oxidizing bacterial endosymbionts: analysis of phylogeny and specificity by 16S rRNA sequences.
J. Bacteriol.
170:2506-2510[Abstract/Free Full Text].
|
| 10.
|
Edelstein, P. H.,
K. B. Beer, and E. D. DeBoynton.
1987.
Influence of growth temperature on virulence of Legionella pneumophila.
Infect. Immun.
55:2701-2705[Abstract/Free Full Text].
|
| 11.
|
Felbeck, H.
1981.
Chemoautotrophic potential of the hydrothermal vent tubeworm, Riftia pachyptila Jones (Vestimentifera).
Science
213:336-338[Abstract/Free Full Text].
|
| 12.
|
Felbeck, H., and D. L. Distel.
1991.
Procaryotic symbionts of marine invertebrates, p. 3891-3906.
In
A. Ballows, H. G. Trüper, M. Dworkin, W. Harder, and K. H. Schleifer (ed.), The procaryotes. Springer Verlag, New York, N.Y.
|
| 13.
|
Feldman, R. A.,
M. B. Black,
S. C. Cary,
R. A. Lutz, and R. C. Vrijenhoek.
1997.
Molecular phylogenetics of bacterial endosymbionts and their vestimentiferan hosts.
Mol. Mar. Biol. Biotechnol.
6:268-277[Medline].
|
| 14.
|
Feng, P.,
J. R. Sugasawara, and A. Schantz.
1990.
Identification of a common enterobacterial flagellin epitope with a monoclonal antibody.
J. Gen. Microbiol.
136:337-342[Medline].
|
| 15.
|
Fisher, C. R.
1990.
Chemoautotrophic and methanotrophic symbioses in marine invertebrates.
Rev. Aquat. Sci.
2:399-436.
|
| 16.
|
Graf, J.,
P. V. Dunlap, and E. G. Ruby.
1994.
Effect of transposon-induced motility mutations on colonization of the host light organ by Vibrio fischeri.
J. Bacteriol.
176:6986-6991[Abstract/Free Full Text].
|
| 17.
|
Grant, C. C. R.,
M. E. Konkel,
W. Cieplak, Jr., and L. S. Tompkins.
1993.
Role of flagella in adherence, internalization, and translocation of Campylobacter jejuni in nonpolarized and polarized epithelial cell cultures.
Infect. Immun.
61:1764-1771[Abstract/Free Full Text].
|
| 18.
|
Guzzo, A.,
C. Diorio, and M. S. Dubow.
1991.
Transcription of the Escherichia coli fliC gene is regulated by metal ions.
Appl. Environ. Microbiol.
57:2255-2259[Abstract/Free Full Text].
|
| 19.
|
Helmann, J. D.,
F. R. Masiarz, and M. J. Chamberlin.
1988.
Isolation and characterization of the Bacillus subtilis 28 factor.
J. Bacteriol.
170:1560-1567[Abstract/Free Full Text].
|
| 20.
|
Homma, M.,
H. Fuita,
S. Yamaguchi, and T. Lino.
1987.
Regions of Salmonella typhimurium flagellin essential for its polymerization and excretion.
J. Bacteriol.
169:291-296[Abstract/Free Full Text].
|
| 21.
|
Hughes, D. S.,
H. Felbeck, and J. L. Stein.
1997.
A histidine protein kinase homolog from the endosymbiont of the hydrothermal vent tubeworm Riftia pachyptila.
Appl. Environ. Microbiol.
63:3494-3498[Abstract].
|
| 22.
|
Jones, M., and S. Gardiner.
1989.
On the early development of the vestimentiferan tube worm Ridgeia sp. and observations on the nervous system and trophosome of Ridgeia sp. and Riftia pachyptila.
Biol. Bull. (Woods Hole)
177:254-276[Abstract/Free Full Text].
|
| 23.
|
Jones, M. L.
1981.
Riftia pachyptila Jones: observations on the vestimentiferan worm from the Galapagos rift.
Science
213:333-336[Abstract/Free Full Text].
|
| 24.
|
Jones, M. L.
1988.
The Vestimentifera, their biology, systematic and evolutionary patterns.
Oceanol. Acta
8:69-82.
|
| 25.
|
Jones, M. L., and S. L. Gardiner.
1988.
Evidence for a transient digestive tract in Vestimentifera.
Proc. Biol. Soc. Wash.
101:423-433.
|
| 26.
|
Kawagishi, I.,
V. Muller,
A. W. Williams,
V. M. Irikura, and R. M. Macnab.
1992.
Subdivision of flagellar region III of the Escherichia coli and Salmonella typhimurium chromosomes and identification of two additional flagellar genes.
J. Gen. Microbiol.
138:1051-1065[Medline].
|
| 27.
|
Kuwajima, G.
1988.
Construction of a minimum-sized functional flagellin of Escherichia coli.
J. Bacteriol.
170:3305-3309[Abstract/Free Full Text].
|
| 28.
|
Lane, D. J.,
D. A. Stahl,
G. J. Olsen, and N. R. Pace.
1985.
Analysis of hydrothermal vent-associated symbionts by ribosomal RNA sequences.
Biol. Soc. Wash. Bull.
6:389-400.
|
| 29.
|
Laue, B. E., and D. C. Nelson.
1997.
Sulfur-oxidizing symbionts have not co-evolved with their hydrothermal vent tube worm hosts: an RFLP analysis.
Mol. Mar. Biol. Biotechnol.
6:180-188[Medline].
|
| 30.
|
Macnab, R. M.
1996.
Flagella and motility, p. 123-145.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. American Society for Microbiology, Washington, D.C.
|
| 31.
|
McCarter, L.,
M. Hilmen, and M. Silverman.
1988.
Flagellar dynamometer controls swarmer cell differentiation of V. parahaemolyticus.
Cell
54:345-351[Medline].
|
| 31a.
| Millikan, D. S., et al. Unpublished data.
|
| 32.
|
Nachamkin, I.,
X.-H. Yang, and N. J. Stern.
1993.
Role of Campylobacter jejuni flagella as colonization factors for three-day-old chicks: analysis with flagellar mutants.
Appl. Environ. Microbiol.
59:1269-1273[Abstract/Free Full Text].
|
| 33.
|
Nelson, D. C., and C. R. Fisher.
1995.
Chemoautotrophic and methanotrophic endosymbiotic bacteria at deep-sea vents and seeps, p. 125-167.
In
D. M. Karl (ed.), The microbiology of deep-sea hydrothermal vents. CRC Press, Inc., Boca Raton, Fla.
|
| 34.
|
Newton, S. M. C.,
C. O. Jacob, and B. A. D. Stocker.
1989.
Immune response to cholera toxin epitope inserted in Salmonella flagellin.
Science
244:70-72[Abstract/Free Full Text].
|
| 35.
|
Norqvist, A., and H. Wolf-Watz.
1993.
Characterization of a novel chromosomal virulence locus involved in expression of a major surface flagellar sheath antigen of the fish pathogen Vibrio anguillarum.
Infect. Immun.
61:2434-2444[Abstract/Free Full Text].
|
| 36.
|
Norris, S. J., and the Treponema pallidum Polypeptide Research Group.
1993.
Polypeptides of Treponema pallidum: progress toward understanding their structural, functional, and immunologic roles.
Microbiol. Rev.
57:750-779[Abstract/Free Full Text].
|
| 37.
|
O'Toole, R.,
D. L. Milton, and H. Wolf-Watz.
1996.
Chemotactic motility is required for invasion of the host by the fish pathogen Vibrio anguillarum.
Mol. Microbiol.
19:625-637[Medline].
|
| 38.
|
Ott, M.,
P. Messner,
J. Hessemann,
R. Marre, and J. Hacker.
1991.
Temperature-dependent expression of flagella in Legionella.
J. Gen. Microbiol.
137:1955-1961[Medline].
|
| 39.
|
Platt, T.
1986.
Transcription termination and the regulation of gene expression.
Annu. Rev. Biochem.
55:339-372[Medline].
|
| 40.
|
Richardson, K.
1991.
Roles of motility and flagellar structure in pathogenicity of Vibrio cholerae: analysis of motility mutants in three animal models.
Infect. Immun.
59:2727-2736[Abstract/Free Full Text].
|
| 41.
|
Ruby, E. G., and L. M. Asato.
1993.
Growth and flagellation of Vibrio fischeri during initiation of the sepiolid squid light organ symbiosis.
Arch. Microbiol.
159:160-167[Medline].
|
| 42.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 43.
|
Silverman, M., and M. Simon.
1974.
Characterization of Escherichia coli mutants that are insensitive to catabolite repression.
J. Bacteriol.
120:1196-1203[Abstract/Free Full Text].
|
| 43a.
| Silverman, M. Personal communication.
|
| 44.
|
Stahl, D. A.,
D. J. Lane,
G. J. Olsen, and N. R. Pace.
1984.
Analysis of hydrothermal vent-associated symbionts by ribosomal RNA sequences.
Science
224:409-411[Abstract/Free Full Text].
|
| 45.
|
Tebo, B. M.,
D. S. Linthicum, and K. H. Nealson.
1979.
Luminous bacteria and light-emitting fish: ultrastructure of the symbiosis.
BioSystems
11:269-280[Medline].
|
Applied and Environmental Microbiology, July 1999, p. 3129-3133, Vol. 65, No. 7
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Thornhill, D. J., Wiley, A. A., Campbell, A. L., Bartol, F. F., Teske, A., Halanych, K. M.
(2008). Endosymbionts of Siboglinum fiordicum and the Phylogeny of Bacterial Endosymbionts in Siboglinidae (Annelida). Biol. Bull.
214: 135-144
[Abstract]
[Full Text]
-
Vrijenhoek, R. C., Duhaime, M., Jones, W. J.
(2007). Subtype Variation Among Bacterial Endosymbionts of Tubeworms (Annelida: Siboglinidae) from the Gulf of California. Biol. Bull.
212: 180-184
[Full Text]
-
Handelsman, J.
(2004). Metagenomics: Application of Genomics to Uncultured Microorganisms. Microbiol. Mol. Biol. Rev.
68: 669-685
[Abstract]
[Full Text]
-
Arora, S. K., Bangera, M., Lory, S., Ramphal, R.
(2001). A genomic island in Pseudomonas aeruginosa carries the determinants of flagellin glycosylation. Proc. Natl. Acad. Sci. USA
98: 9342-9347
[Abstract]
[Full Text]