Previous Article | Next Article ![]()
Applied and Environmental Microbiology, August 1999, p. 3293-3297, Vol. 65, No. 8
Department of Microbiology, University of
Bergen, N-5020 Bergen, Norway
Received 15 January 1999/Accepted 7 May 1999
The impact of heavy-metal contamination on archaean communities was
studied in soils amended with sewage sludge contaminated with heavy
metals to varying extents. Fluorescent in situ hybridization showed a
decrease in the percentage of Archaea from 1.3% ± 0.3% of 4',6-diamidino-2-phenylindole-stained cells in untreated soil to
below the detection limit in soils amended with heavy metals. A
comparison of the archaean communities of the different plots by
denaturing gradient gel electrophoresis revealed differences in the
structure of the archaean communities in soils with increasing heavy-metal contamination. Analysis of cloned 16S ribosomal DNA showed
close similarities to a unique and globally distributed lineage of the
kingdom Crenarchaeota that is phylogenetically distinct
from currently characterized crenarchaeotal species.
The presence of heavy metals in
sewage sludge is often the main determinant restricting the application
of sewage sludge to agricultural soil (28). After detailed
assessments of the uptake and transfer of heavy metals into the food
chain via crops, the Commission of the European Communities has set
limits on the amount of selected heavy metals that can be added to
agricultural soils receiving sewage sludge (8). However,
even heavy-metal contamination that is below the upper limit set by the
European Commission can have an effect on microbial community structure
(1, 12, 13, 16, 32).
Many studies have focused on the effects of heavy metal on bacterial
community structure (1, 16, 20, 30, 32, 34). However, no
investigations have studied the effect of heavy-metal discharge on the
archaean community. Until a few years ago, the domain
Archaea was considered to consist only of methanogens that live under strict anoxic conditions and extremophiles that inhabit inhospitable environments (36, 39). Recent studies have
shown that Archaea are also present in nonextreme
environments, including marine (10, 11, 14, 27, 38a),
freshwater (18), and terrestrial (3, 4, 21)
ecosystems. This suggests that the Archaea also have
ecological significance in nonextreme environments. Phylogenetic
analysis of Archaea from nonextreme environments has
revealed that they form a new cluster within the kingdom
Crenarchaeota and are only distantly related to
hitherto-described crenarchaea, as determined by 16S rRNA gene
sequences. This group is now called the nonthermophilic
Crenarchaeota and consists of at least four distinct
phylogenetic clusters (4). All gene sequences isolated from
soil are found in one of these clusters.
In this study, we analyzed the long-term effect of heavy metals on the
archaean community in contaminated samples from five experimental field
plots (Braunschweig, Germany) that received, between 1980 and 1991, different amounts of sludge and heavy metals (6). Using
molecular methods such as fluorescent in situ hybridization (FISH) and
denaturing gradient gel electrophoresis (DGGE), we analyzed differences
in the abundance and diversity of Archaea in both
heavy-metal-contaminated soil and uncontaminated soil. A
comparative sequence analysis of 16S ribosomal DNA (rDNA)
libraries showed that Archaea from
heavy-metal-contaminated soils cluster within the group of terrestrial
nonthermophilic Crenarchaeota.
Soil characteristics and samples.
Soil samples, down to a
10-cm depth, were collected at the end of November 1994 from an
experimental field site in Braunschweig, Germany. The plots were
characterized by the following amendments: (i) N fertilization, (ii)
low sludge and low metal, (iii) low sludge and high metal, (iv) high
sludge and low metal, and (v) high sludge and high metal (Table
1). All plots had been planted with
spring rape. The soil, with a matrix consisting of 5% clay, 50% silt,
and 45% sand, received either 100 or 300 m3 of unamended
or amended sludge ha
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Abundance and Diversity of Archaea in
Heavy-Metal-Contaminated Soils
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
1 year
1 between
1980 and 1991 (Table 1). The amended sludge was spiked with heavy
metals (Cd, Cu, Ni, and Zn) to increase the heavy-metal load to the
upper limit set by the European Commission (6). During
sampling, no pronounced differences in organic C (Table 1) were noticed
among these soils, although the increase in total concentrations of
heavy metals Cd, Cu, Ni, and Zn from the original, noncontaminated soil
to the soil with the highest metal amendment was accompanied by a
decrease in pH from 7.1 to 5.3 (Table 1).
TABLE 1.
Soil characteristics
FISH.
Soil samples of 5 g each were fixed in 4%
paraformaldehyde-phosphate-buffered saline (0.13 M NaCl, 7 mM
Na2HPO4, and 3 mM NaH2PO4 [pH 7.2] in water) on ice for 3 h (17). The suspensions were centrifuged at 4,000 × g for 5 min, and the pellets were subsequently washed with
phosphate-buffered saline, resuspended in 20 ml of 96% ethanol, and
stored at
20°C at a concentration of 25 mg of soil (wet weight)
ml
1. Before application to slides, 40 µl of the cell
suspension was dispersed in 960 µl of 0.1% sodium pyrophosphate in
distilled water by mild sonication for 30 s at a setting of 8 (B-12 sonifier; Branson, Danbury, Conn.) (40). Twenty
microliters was subsequently spotted onto gelatin-coated slides [0.1%
gelatin, 0.01% KCr(SO4)2], dried at 45°C
for 30 min, and finally dehydrated sequentially in 50, 80, and 96%
ethanol for 3 min (each).
1 and stored at
20°C. Hybridization was
performed in 9 µl of hybridization buffer (0.9 M NaCl, 20 mM
Tris-HCl, 5 mM EDTA, 0.01% sodium dodecyl sulfate [SDS] [pH 7.2])
in the presence of 20% formamide, 1 µl of the probe (25 ng
µl
1), and 1 µl of 4',6-diamidino-2-phenylindole
(DAPI) (200 ng/µl) at 42°C for 2 h (40). The slides
were washed in buffer containing 20 mM Tris-HCl, 10 mM EDTA, 0.01%
SDS, and 308 mM NaCl for 15 min at 48°C, rinsed in distilled water,
and air dried (40).
Slides were mounted with AF1 solution (Citifluor, Canterbury, United
Kingdom), and the preparations were examined with a Zeiss Axiophot
microscope fitted for epifluorescence with a high-pressure mercury bulb
(50 W), Zeiss 02 filter sets (G365, FT395, and LP420), and HQ-Cy3
filters (G535/50, FT565, and BT 610175; AHF Analysentechnik, Tübingen, Germany) at 1,000× magnification. DAPI-stained
bacteria, Archaea, and cells hybridizing with the probe in
20 fields, selected at random and covering an area of 0.01 mm2 each, were counted. The fields were selected from a
sample distributed over eight circular areas of 53 mm2 each.
DNA extraction.
DNA used for PCR amplification and cloning
was isolated by direct lysis of the Archaea in the soil. Ten
grams of soil was homogenized for 1 min in a Waring blender with 100 ml
of Crombach buffer (9). Lysis was performed according to the
method of Torsvik et al. (38). Ten milliliters of the soil
homogenate was lysed by the addition of 5 mg of lysozyme (Sigma
Chemical Co.) ml
1. After 1 h at 37°C, 0.2 mg of
proteinase K (Sigma) ml
1 was added, and the suspension
was further incubated at 37°C for 0.5 h. Thereafter, SDS was
added to a final concentration of 1%. The mixture was then heated to
65°C for 15 min before the lysate was cleared by centrifugation at
10,000 × g for 10 min. The lysate was purified with
the Wizard total DNA cleanup system from Promega (Madison, Wisc.).
PCR. Part of the 16S rDNA was amplified from the total archaean DNA by PCR, with the GeneAmp 9600 thermocycler from Perkin-Elmer (Norwalk, Conn.). The primer sequences used for amplification were PRA46f (37) and PRU517r (22). The 100-µl reaction mixture contained the following: sterile distilled water, PCR buffer (standard 10× PCR buffer; Perkin-Elmer), 0.16% bovine serum albumin, deoxynucleoside triphosphates (each at 200 nM), primers (each at 100 µM), 2.5 U of Taq DNA polymerase (Perkin-Elmer), and template amplicon (1.9 ng). After an initial denaturation step at 95°C for 5 min, the reaction mixture was run for 30 cycles of 95°C for 0.5 min, 53°C for 0.5 min, and 72°C for 1.0 min, followed by 72°C for 6 min.
For DGGE analysis, amplicons from the PCR described above were used as templates in a new PCR with the primer PARC340f (complementing a region conserved among the Archaea [29]) and the universal primer PARC519r (29) with a GC clamp at the 5' end. This seminested PCR format was necessary to obtain a sufficient amount of product for the DGGE. The 50-µl reaction mixture contained the following: sterile distilled water, PCR buffer (standard 10× PCR buffer; Perkin-Elmer), 0.16% bovine serum albumin, deoxynucleoside triphosphates (each at 200 nM), primers (each at 1 µM), 2.5 U of AmpliTaq Gold DNA polymerase (Perkin-Elmer), and template amplicon (1.9 ng). After an initial denaturation step at 96°C for 9 min, the reaction mixture was run for 35 cycles of 95°C for 0.5 min, 53°C for 1.3 min, and 72°C for 0.5 min, followed by 72°C for 6 min.DGGE. DGGE was performed with a Hoefer SE600 gel electrophoresis unit. PCR products were loaded onto 8% acrylamide gels (bisacrylamide gel stock solution, 37:5:1; Bio-Rad Laboratories, Inc.) and run with 0.5× TAE buffer (1× TAE is 0.04 M Tris base, 0.02 M sodium acetate, and 1.0 mM EDTA [pH adjusted to 7.4]). DGGE gels contained a 20 to 60% gradient of urea-formamide solution increasing in the direction of electrophoresis. A 100% urea-formamide solution is defined as 40% (vol/vol) formamide plus 7.0 M urea. DGGE was conducted at 60°C at a voltage of 20 V for 10 min and thereafter at 200 V for 3 h. The gels were stained for 1 h with a 1:10,000 dilution of SYBR Green II (Molecular Probes, Eugene, Oreg.) in 0.5× TAE buffer before photographing.
Cloning and restriction fragment length polymorphism.
PCR
products from the primary PCRs were purified by preparative gel
electrophoresis (1% low-melting-point NuSieve agar; FMC Bioproducts,
Rockland, Maine), followed by purification with the PCR cleanup kit
from Promega. The products were concentrated by precipitation by a
standard procedure with sodium acetate (3 M) and 70% ethanol
(31). Cloning into the pMOSBlue T vector was performed as described by the manufacturer (Amersham International Plc., Little Chalfont, Buckinghamshire, England). The clones were screened for
complementation by using X-Gal
(5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside) and
IPTG (isopropyl-
-D-thiogalactopyranoside)
(31). One hundred micrograms of ampicillin per milliliter
was added to Luria agar plates (10 g of tryptone, 5 g of yeast
extract, 10 g of NaCl, 15 g of agar, 1,000 ml of distilled
water) for the selection of positive clones. Approximately 150 blue
colonies were picked from each cloning reaction from the two soil
treatments. A total of 300 blue colonies were screened for positive
inserts by PCR with T7 (TAATACGACTCACTATAGGG) and U-19mer
(GTTTTCCCAGTCACGACGT) primers (Amersham). PCR was performed
as described above but in a total volume of 50 µl with 1.25 U of
Taq DNA polymerase (Perkin-Elmer). Template was added as
whole cells. The products were verified by gel electrophoresis.
1. The
restriction products were visualized by UV excitation (Electronic Dual
Light transilluminator; Ultra Lum, Carson, Calif.) and a charge-coupled
device camera (Ultra Lum).
Sequence analysis. A total of 11 of the cloned amplicons with different restriction patterns and containing 16S rDNA from the low-sludge-low-metal and high-sludge-high-metal soils were sequenced. Plasmid DNA was prepared from the clones by using the Qiaprep Plasmid Miniprep kit (Qiagen, Inc., Chatsworth, Calif.). Sequencing was performed by the Advanced Biotechnology Centre (Charing Cross and Westminster Centre, London, England). The whole insert, approximately 450 bp, was sequenced by using the T7 primer as a sequencing primer. These sequences were checked for chimeric artifacts by the CHECK-CHIMERA service provided by the Ribosomal Database Project (23). Sequences were aligned with the PILEUP program of the Genetics Computer Group Software package. Distance matrices and phylogenetic trees were made by using the CLUSTAL W program. The sequences were taxonomically assigned by using the nucleotide database at GenBank and BLAST (National Center for Biotechnology Information).
| |
RESULTS AND DISCUSSION |
|---|
|
|
|---|
Application of DGGE revealed differences in the archaean community structure with increased heavy-metal contamination (Fig. 1). While the control soil resulted in a banding pattern of 12 bands, the low-metal soils, A and B, gave patterns of 6 bands each. However, soils amended with large amounts of heavy metals (C and D) gave banding patterns of 11 bands each. Two distinct bands (positions 5.2 and 9.6) were detected in all five plots (Fig. 1). The A and B soils showed similar banding patterns, except for one band that was unique to soil A (position 10.0) and another band that was unique to soil B (position 2.2) (Fig. 1). Likewise, the C and D soils also showed some similarities in DGGE banding patterns (Fig. 1). Three distinct bands (positions 4.3, 4.6, and 6.2) were detected only in these two plots. In addition, soils C and D each showed some faint, but unique, bands (positions 2.5, 3.1, 4.1, 8.4, and 8.9). Only one distinct band was detected in the metal-contaminated soil (position 7.4). The banding patterns from the low-sludge-low-metal plot (A) and the low-sludge-high-metal plot (B) were different from the control soil. The control, A, and B soils were somewhat similar with respect to pH (Table 1). Thus, the differences detected in the archaean community structure between the control soil and soils A and B could in part be attributed to the increase in the concentration of the heavy metals or the addition of sludge. These results were confirmed by another study showing a substantial reduction in total bacterial diversity between the control soil and soil A (low sludge-low metal) (32).
|
The pHs of the A and B soils were in the same range as that of the control soil, while the pHs of the C and D soils were substantially lower (Table 1). The overall differences in the banding patterns between the control and A and B soils on one hand and the C and D soils on the other hand might therefore not be the effect of heavy metals alone but also that of an increase in the amount of sludge or a lowering in the pH (Table 1). pH has a great effect on the solubility of heavy metals (15). A twofold increase in heavy metals (Cd, Ni, and Zn) in solution, for example, has been observed after a one-unit decrease in pH (7, 33). However, differences in the banding patterns between the two low-sludge soils (A and B) and between the two high-sludge soils (C and D) must be attributed to the effect of heavy metals alone (Fig. 1).
FISH with probe ARCH915 showed that the number of Archaea belonging to this domain decreased from 1.3% ± 0.3% of the DAPI-stained cells in the control soil to numbers below the detection limit set at <1% of the DAPI-stained cells in contaminated soils (5, 40). This indicates that the heavy metals were somewhat toxic to the growth or survival of some of the Archaea. The numbers of Archaea observed in this study are in accordance with numbers found in other studies of soil ecosystems (5, 40).
Phylogenetic analysis of the Archaea 16S rDNA clone libraries revealed from 95 to 98% sequence similarity to a novel group within the kingdom Crenarchaeota (2), also known as the nonthermophilic Crenarchaeota (4). Members within this group of Archaea have recently been detected from different environmental sources (4, 18, 19, 24, 26, 27), and they were shown to be phylogenetically distinct from currently characterized crenarchaeotal species. Phylogenetic analysis of the clones from these studies has shown that the clones belong to at least four groups, which appear to have a common ancestry (4). The sequences in this study feel into three groups within the terrestrial cluster of Crenarchaeota. Two groups (clones a-195a, a-161d, a-177a, and a-176a) were similar to clones from an agricultural soil in Wisconsin (U62811 and U62814) (2), while the third group (a-9a, a-10a, a-18a, and a-3a) showed sequence similarities to clones found in freshwater sediments (U59973) (18) (Fig. 2). In another study, sequences from freshwater sediments were also shown to group within the terrestrial cluster of nonthermophilic Crenarchaeota (4).
|
Compared to noncontaminated soil, a significant reduction in the percentage of Archaea, as well as qualitative differences in the archaean community structure, was observed even at heavy-metal concentrations below the upper limit set by the European Commission. Molecular approaches have demonstrated that nonthermophilic Crenarchaeota are found in diverse environments and are globally distributed (2-4, 10, 18, 21, 24). Nonthermophilic Crenarchaeota have not been reported to occur in heavy-metal-contaminated soil. The findings in this study, that heavy metals were somewhat toxic to the growth or survival of some of the Archaea, may contribute to our knowledge about the ecological role of this novel group of organisms. Little is still known about their physiological characteristics and ecological significance, and further investigations are needed to fully comprehend their ecological importance.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by grants from the EC projects Microbial Diversity and Functions in Metal Contaminated Soils and High Resolution Automated Microbial Identification-2.
We also thank Bruce Knight (IACR-Rothamsted, Harpenden, Herts, United Kingdom) for measuring the heavy-metal concentrations in the soils used in the present study.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Dept. of Microbiology, University of Bergen, Jahnebakken 5, N-5020 Bergen, Norway. Phone: 47 55 584646. Fax: 47 55 589671. E-mail: Ruth.Sandaa{at}im.uib.no.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Bååth, E.,
M. Díaz-Raviña,
ÅA. Frostegård, and C. D. Campbell.
1998.
Effect of metal-rich sludge amendments on the soil microbial community.
Appl. Environ. Microbiol.
64:238-245 |
| 2. |
Birtrim, S. B.,
T. J. Donohue,
J. Handelsman,
G. P. Roberts, and R. M. Goodman.
1997.
Molecular phylogeny of archaea from soil.
Proc. Natl. Acad. Sci. USA
94:277-282 |
| 3. | Borneman, J., and E. W. Triplett. 1997. Molecular microbial diversity in soils from eastern Amazonia: evidence for unusual microorganisms and microbial population shifts associated with deforestation. Appl. Environ. Microbiol. 63:2647-2653[Abstract]. |
| 4. |
Buckley, D. H.,
J. R. Graber, and T. M. Schmidt.
1998.
Phylogenetic analysis of nonthermophilic members of the kingdom Crenarchaeota and their diversity and abundance in soils.
Appl. Environ. Microbiol.
64:4333-4339 |
| 5. | Chatzinotas, A., R.-A. Sandaa, W. Schönhuber, R. I. Amann, L. F. Daae, V. Torsvik, J. Zeyer, and D. Hahn. 1998. Analysis of broad-scale differences in microbial communities of two pristine forest soils. Syst. Appl. Microbiol. 21:588-592[Medline]. |
| 6. | Chaudri, A. M., S. P. McGrath, K. E. Giller, E. Rietz, and D. R. Sauerbeck. 1993. Enumeration of indigenous Rhizobium leguminosarum biovar trifolii in soils previously treated with metal-contaminated sewage sludge. Soil Biol. Biochem. 25:301-309. |
| 7. | Christensen, T. H. 1984. Cadmium soil sorption at low concentrations. I. Effect of time, cadmium load, pH and calcium. Water Air Soil Pollut. 21:105-114. |
| 8. | Commission of the European Communities. 1986. Council directive of 12 June 1986 on the protection of the environment, and in particular of the soil, when sewage sludge is used in agriculture. Journal of the European Communities No. L 181/6 (86/278/EEC). |
| 9. | Crombach, W. H. J. 1972. DNA base composition of soil arthrobacters and other coryneforms from cheese and sea fish. Antonie Leeuwenhoek J. Microbiol. 38:105-120. |
| 10. |
DeLong, E. F.
1992.
Archaea in coastal marine environments.
Proc. Natl. Acad. Sci. USA
89:5685-5689 |
| 11. | DeLong, E. F., K. Y. Wu, B. B. Prézelin, and R. V. M. Jovine. 1994. High abundance of archaea in Antarctic marine picoplankton. Nature 371:695-697[Medline]. |
| 12. |
Frostegåard, Å.,
A. Tunlid, and E. Bååth.
1993.
Phospholipid fatty acid composition, biomass, and activity of microbial communities from two soil types experimentally exposed to different heavy metals.
Appl. Environ. Microbiol.
59:3605-3617 |
| 13. | Frostegåard, A., A. Tunlid, and E. Bååth. 1996. Changes in microbial community structure during long-term incubation in two soils experimentally contaminated with metals. Soil Biol. Biochem. 28:55-63. |
| 14. | Fuhrman, J. A., K. McCallum, and A. A. Davis. 1992. Novel major archaebacterial group from marine plankton. Nature 356:148-149[Medline]. |
| 15. | Giller, K. E., E. Witter, and S. P. McGrath. 1998. Toxicity of heavy metals to microorganisms and microbial processes in agricultural soils: a review. Soil Biol. Biochem. 30:1389-1414. |
| 16. | Griffiths, B. S., M. Diaz-Raviña, K. Ritz, J. W. McNicol, N. Ebblewhite, and E. Bååth. 1997. Community DNA hybridization and %G+C profiles of microbial communities from heavy metal polluted soils. FEMS Microbiol. Ecol. 24:103-112. |
| 17. |
Hahn, D.,
R. I. Amann,
W. Ludwig,
A. D. L. Akkermans, and K.-H. Schleifer.
1992.
Detection of microorganisms in soil after in situ hybridization with rRNA-targeted, fluorescently labelled oligonucleotides.
J. Gen. Microbiol.
138:879-887 |
| 18. | Hershberger, K. L., S. M. Barns, A.-L. Reysenbach, S. C. Dawson, and N. R. Pace. 1996. Wide diversity of Crenarchaeota. Nature 384:420[Medline]. |
| 19. | Jurgens, G., K. Lindström, and A. Saano. 1997. Novel group within the kingdom Crenarchaeota from boreal forest soil. Appl. Environ. Microbiol. 63:803-805[Abstract]. |
| 20. | Kandeler, E., C. Kampichler, and O. Horak. 1996. Influence of heavy metals on the functional diversity of soil microbial communities. Biol. Fertil. Soils 23:299-306. |
| 21. | Kudo, Y., S. Shibata, T. Miyaki, T. Aono, and H. Oyaizu. 1997. Peculiar archaea found in Japanese paddy soils. Biosci. Biotechnol. Biochem. 61:917-920[Medline]. |
| 22. |
Lane, D. J.,
B. Pace,
G. J. Olsen,
D. A. Stahl,
M. L. Sogin, and N. R. Pace.
1985.
Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses.
Proc. Natl. Acad. Sci. USA
82:6955-6959 |
| 23. |
Maidak, B. L.,
G. J. Olsen,
N. Larsen,
R. Overbeek,
M. J. McCaughey, and C. R. Woese.
1997.
The RDP (Ribosomal Database Project).
Nucleic Acids Res.
25:109-111 |
| 24. | Massana, R., A. E. Murray, C. M. Preston, and E. F. DeLong. 1997. Vertical distribution and phylogenetic characterization of marine planktonic Archaea in the Santa Barbara Channel. Appl. Environ. Microbiol. 63:50-56[Abstract]. |
| 25. | McGrath, S. P., and C. H. Cunliffe. 1985. A simplified method for the extraction of the metals Fe, Zn, Cu, Ni, Cd, Pb, Cr, Co and Mn from soils and sewage sludges. J. Sci. Food Agric. 36:794-798. |
| 26. | Moyer, C. L., J. M. Tiedje, F. C. Dobbs, and D. M. Karl. 1998. Diversity of deep-sea hydrothermal vent Archaea at Loihi Seamount, Hawaii. Deep-Sea Res. 45:303-317. |
| 27. |
Murray, A. E.,
C. M. Preston,
R. Massana,
L. T. Taylor,
A. Blakis,
K. Wu, and E. F. DeLong.
1998.
Seasonal and spatial variability of bacterial and archaeal assemblages in the coastal waters near Anvers Island, Antarctica.
Appl. Environ. Microbiol.
64:2585-2595 |
| 28. | Obbard, J. P., and K. C. Jones. 1993. The use of the cotton-strip assay to assess cellulose decomposition in heavy metal-contaminated sewage sludge-amended soils. Environ. Pollut. 81:173-178. |
| 29. | Øvreåas, L., L. Forney, F. L. Daae, and V. Torsvik. 1997. Distribution of bacterioplankton in meromictic Lake Sælenvannet, as determined by denaturing gradient gel electrophoresis of PCR-amplified gene fragments coding for 16S rRNA. Appl. Environ. Microbiol. 63:3367-3373[Abstract]. |
| 30. | Roane, T. M., and S. T. Kellogg. 1996. Characterization of bacterial communities in heavy metal contaminated soils. Can. J. Microbiol. 42:593-603[Medline]. |
| 31. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 32. | Sandaa, R.-A., V. Torsvik, Ø. Enger, F. L. Daae, T. Castberg, and D. Hahn. Unpublished data. |
| 33. | Sanders, J. R., S. P. McGrath, and T. M. Adams. 1986. Zinc, copper and nickel concentrations in ryegrass grown on sludge-contaminated soils of different pH. J. Sci. Food Agric. 37:961-968. |
| 34. | Smit, E., P. Leeflang, and K. Wernars. 1997. Detection of shifts in microbial community structure and diversity in soil caused by copper contamination using amplified ribosomal DNA restriction analysis. FEMS Microbiol. Ecol. 23:249-261. |
| 35. | Stahl, D. A., and R. I. Amann. 1991. Development and application of nucleic acid probes, p. 205-248. In E. Stackebrandt, and M. Goodfellow (ed.), Nucleic acid techniques in bacterial systematics. John Wiley & Sons, New York, N.Y. |
| 36. | Tindal, B. J. 1992. The archaebacteria, p. 677-808. In A. Balows, H. G. Trüper, M. Dworkin, W. Harder, and K.-H. Schleifer (ed.), The prokaryotes. Springer-Verlag, New York, N.Y. |
| 37. | Torsvik, T., V. Torsvik, J. Keswani, and W. B. Whitman. Unpublished data. |
| 38. |
Torsvik, V.,
J. Goksøyr, and F. L. Daae.
1990.
High diversity in DNA of soil bacteria.
Appl. Environ. Microbiol.
56:782-787 |
| 38a. |
van der Maarel, M. J. E. C.,
R. R. E. Artz,
R. Haanstra, and L. J. Forney.
1998.
Association of marine archaea with the digestive tracts of two marine fish species.
Appl. Environ. Microbiol.
64:2894-2898 |
| 39. |
Woese, C. R.,
O. Kandler, and L. M. Wheelis.
1990.
Towards a natural system of organisms: proposal for the domains Archaea, Bacteria, and Eucarya.
Proc. Natl. Acad. Sci. USA
87:4576-4579 |
| 40. | Zarda, B., D. Hahn, A. Chatzinotas, W. Schönhuber, A. Neef, R. I. Amann, and J. Zeyer. 1997. Analysis of bacterial community structure in bulk soil by in situ hybridization. Arch. Microbiol. 168:185-192. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»