Previous Article | Next Article 
Applied and Environmental Microbiology, September 1999, p. 3908-3914, Vol. 65, No. 9
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Comparison of Ribotyping, Randomly Amplified Polymorphic DNA
Analysis, and Pulsed-Field Gel Electrophoresis in Typing of
Lactobacillus rhamnosus and L. casei
Strains
Soile
Tynkkynen,1,*
Reetta
Satokari,2
Maria
Saarela,2
Tiina
Mattila-Sandholm,2 and
Maija
Saxelin1
Valio Ltd. Research and Development
Centre,1 FIN-00039 Valio, and VTT
Biotechnology and Food Research, FIN-02044 VTT,2
Finland
Received 10 November 1998/Accepted 27 May 1999
 |
ABSTRACT |
A total of 24 strains, biochemically identified as members of the
Lactobacillus casei group, were identified by PCR with
species-specific primers. The same set of strains was typed by randomly
amplified polymorphic DNA (RAPD) analysis, ribotyping, and pulsed-field gel electrophoresis (PFGE) in order to compare the discriminatory power
of the methods. Species-specific primers for L. rhamnosus and L. casei identified the type strain L. rhamnosus ATCC 7469 and the neotype strain L. casei
ATCC 334, respectively, but did not give any signal with the recently
revived species L. zeae, which contains the type strain
ATCC 15820 and the strain ATCC 393, which was previously classified as
L. casei. Our results are in accordance with the suggested
new classification of the L. casei group. Altogether, 21 of
the 24 strains studied were identified with the species-specific
primers. In strain typing, PFGE was the most discriminatory method,
revealing 17 genotypes for the 24 strains studied. Ribotyping and RAPD
analysis yielded 15 and 12 genotypes, respectively.
| |
INTRODUCTION |
Lactobacilli have a worldwide
industrial use as starters in the manufacturing of fermented milk
products. Moreover, some Lactobacillus strains have
probiotic characteristics and are therefore included in fresh fermented
products or used in capsular health products, such as freeze-dried
powder. The use of some Lactobacillus strains as probiotics
is based on studies which show that these species belong to the normal
intestinal flora and that the strains have beneficial effects on human
and animal health (for reviews, see references 16
and 19). Lactobacillus rhamnosus and
L. casei do not belong to the group of primary starters used
in the dairy industry, but these species include many important
probiotic strains, e.g., L. casei Shirota (26)
and L. rhamnosus GG (20). These species are also
naturally found in raw milk and in high numbers in cheese after it
ripens (8, 15).
Traditionally, the identification of lactobacilli has been based mainly
on fermentation of carbohydrates, morphology, and Gram staining, and
these methods are still used. However, in recent years, the taxonomy
has changed considerably with the increasing knowledge of the genomic
structure and phylogenetic relationships between
Lactobacillus spp. (14, 24, 30). The
identification of some Lactobacillus species by biochemical
methods alone is not reliable (6, 14, 22), as evidenced by
the L. casei group (21, 32). The L. casei group includes L. casei, L. paracasei, L. rhamnosus, and L. zeae; the rejection of
L. paracasei and its inclusion in L. casei has
been proposed (7, 9, 10, 17).
Probiotic health products can contain, perhaps due to the lack of good
identification methods, Lactobacillus species other than
those declared on the product specifications (13, 14, 32).
Difficulty in identification has also been reported for clinical
isolates (21, 32). The need for rapid and reliable species-specific identification, e.g., by PCR, is obvious. Recently, species-specific oligonucleotide primers for L. paracasei
and L. rhamnosus were described (1, 29).
The identification of lactobacilli at the strain level is important for
their industrial use. The biotechnology industry needs tools to
monitor, e.g., the use of patented strains or to distinguish probiotic
strains from natural isolates in the host gastrointestinal tract. As
for safety aspects, it is crucial to be able to compare clinical
isolates and biotechnological strains and also to monitor the genetic
stability of the strains (11, 14). Genotypic methods used
for strain typing are typically PCR methods (e.g., randomly amplified
polymorphic DNA [RAPD] analysis) or variations of restriction enzyme
analysis (e.g., pulsed-field gel electrophoresis [PFGE] and
ribotyping) (30). In RAPD analysis (31), short
arbitrary sequences are used as primers in PCR, which yields
strain-specific amplification product patterns. In PFGE and ribotyping
analysis, genomic DNA is digested with restriction enzymes. In PFGE
(23), rare-cutting enzymes are used and large genomic
fragments are separated, while in ribotyping (25), rRNA
genes and/or their spacer regions are used as probes that hybridize
with genomic restriction fragments. These basic methodological
differences may cause divergences in typing results.
The aims of this study were (i) to compare the identification of
L. casei and L. rhamnosus strains by the API 50 CHL test and by species-specific PCR and (ii) to compare PFGE, RAPD
analysis, and ribotyping techniques for the discrimination of closely
related L. casei and L. rhamnosus strains.
| |
MATERIALS AND METHODS |
Bacterial strains and growth conditions.
The bacterial
strains used throughout the study are listed in Table
1. The strains were maintained at
80°C and subcultured in MRS broth or on MRS agar plates (LabM,
Bury, England) anaerobically at 37°C. An API 50 CHL kit and APILAB
Plus software using the API 50 CHL version 4.0 database
(bioMérieux, Lyon, France) were used to identify strains
biochemically.
L. rhamnosus and L. paracasei
species-specific PCR.
Template DNA for the L. rhamnosus
species-specific PCR was extracted as described previously
(1) or, alternatively, PCR was performed with a fresh single
colony grown overnight. The L. rhamnosus species-specific
PCR assay described by Alander et al. (1) was used. The
sequences of the primer pair (Table 2, RhaI) designed into the 16S rRNA gene were
5'CTTGCATCTTGATTTAATTTTG3' (forward) and
5'CCGTCAATTCCTTTGAGTTT3' (reverse). The specificity of the
primer pair was defined by the forward primer, and the expected PCR
product size was 863 bp. The primers were made with a PCR Mate 391 DNA
synthesizer (Perkin-Elmer Applied Biosystems, Foster City, Calif.)
according to the manufacturer's instructions. Taq DNA
polymerase and PCR buffer (final concentrations of 10 mM Tris-HCl, 1.5 mM MgCl2, and 50 mM KCl [pH 8.3]) were obtained from
Boehringer Mannheim (Mannheim, Germany). The amount of Taq DNA polymerase used was 2.0 U in a total reaction volume of 100 µl.
The concentration of each primer was 0.5 µM, and that of each deoxynucleotide (Finnzymes Oy, Espoo, Finland) was 200 µM. The amount
of template used was 1 µl of an appropriate dilution of the extracted
DNA. A Gene Amp PCR System 9600 apparatus (Perkin-Elmer Applied
Biosystems) was used for the PCR cycling. Initial denaturation was
carried out at 94°C for 5 min, followed by a touch-down thermocycling program with 30 amplification cycles (annealing for 30 s at 62°C in cycles 1 to 10, 60°C in cycles 11 to 20, and 58°C in cycles 21 to 30; extension for 1 min at 72°C; and denaturation for 40 s at
94°C) and final extension for 10 min at 72°C. Reaction mixtures were subsequently cooled to 4°C. The PCR products were analyzed by
agarose gel electrophoresis with 1% agarose in 0.5× Tris-borate-EDTA (10× is 89 mM Tris, 89 mM boric acid, and 25 mM EDTA [pH 8.0]) (TBE)
buffer and ethidium bromide staining.
Other sets of species-specific primers, designed into the 16S-23S
ribosomal DNA (rDNA) spacer region, were used to identify
L. rhamnosus (Table
2, RhaII) and
L. paracasei (Table
2,
Cas)
as described previously (
29). Primer
5'CAGACTGAAAGTCTGACGG3'
was used with primers
5'GCGATGCGAATTTCTATTATT3' and 5'GCGATGCGAATTTCTTTTTC3'
to amplify
L. rhamnosus and
L. paracasei
species-specific sequences,
respectively. PCR amplification was
performed with a DyNAzyme
DNA polymerase kit (Finnzymes Oy) according
to the instructions
of the manufacturer. The PCR buffer contained 10 mM
Tris-HCl,
1.5 mM MgCl
2, 50 mM KCl, and 0.1% Triton X-100
(pH 8.8). The primers
were used at 1 µM and deoxynucleotides were
used at 200 µM. Initial
denaturation was at 94°C for 2 min, and the
thermocycling program
was 94°C for 1 min, 55°C for 1 min, and
72°C for 1 min. With both
the
L. rhamnosus and
L. paracasei primers, two PCR products of
350 and 185 bp were
amplified.
RAPD genotyping.
Template DNA for RAPD analysis was
extracted from lactobacilli according to a modification of the method
of Bollet et al. (4). Briefly, bacterial cells from a plate
of a single-colony subculture of lactobacilli on MRS agar were
harvested and transferred to Eppendorf tubes containing 100 µl of
Tris-EDTA (TE) buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). Tubes were
vortexed well, 50 µl of 10% sodium dodecyl sulfate was added, and
after vortexing, the tubes were incubated for 30 min at 65°C. The
bacterial suspension was centrifuged (2,200 × g for 5 min),
the supernatant was discarded, and the Eppendorf tubes containing the
cells were heated in a microwave oven for 5 min at a power of 650 W. The pellets were dissolved in 500 µl of TE buffer, and a 1:100
dilution of cell lysate in water was used as a template in RAPD
analysis. RAPD analysis was performed in a 50-µl reaction volume
consisting of 200 µM deoxynucleoside triphosphate (Finnzymes Oy) a
0.4 µM concentration of random sequence primer 5'AGTCAGCCAC3',
10 mM Tris-HCl (pH 8.3), 50 mM KCl, 4 mM MgCl2, 2.5 U
of Taq DNA polymerase (Boehringer Mannheim), and 5 µl of
template. The temperature profile in the Gene Amp PCR System 9600 thermocycler was 35 cycles as follows: 94°C for 1 min, 32°C for 2 min, and 72°C for 2 min. The initial denaturation was performed at
94°C for 5 min, and the final extension was done at 72°C for 5 min.
Amplification products were analyzed electrophoretically in 1%
(wt/vol) agarose gels containing ethidium bromide (0.5 µg/ml) and
visualized under UV light. RAPD profiles of the strains were visually
compared, and every clearly distinguishable profile was considered one
RAPD genotype (A1, etc.)
Ribotyping.
Ribotyping was performed by the automated
ribotyping device RiboPrinter microbial characterization system
(Qualicon, Wilmington, Del.). Standard reagents were used in all steps
of the analysis. The method involves the release of DNA from cells,
EcoRI digestion of chromosomal DNA, and the separation of
the resulting fragments by agarose gel electrophoresis, followed by
Southern hybridization probing with the rrnB rRNA operon
from Escherichia coli (5) as a chemiluminescent
probe. Images were acquired with a charge-coupled-device camera and
processed by RiboPrinter analysis software that normalizes fragment
pattern data for band intensity and relative band position compared to
the molecular weight marker. Similar fingerprint patterns (similarity
of >0.95) were automatically clustered into ribogroups (R1, etc.). All
strains were ribotyped at least twice to ensure the reproducibility of
the fingerprint patterns.
PFGE.
The preparation of genomic DNA in situ in agarose
blocks was performed by a slight modification of the method of
Tanskanen et al. (27). Lactobacillus strains were
grown to an A600 of 0.6 in MRS broth containing
1% glycine to facilitate lysis. Chloramphenicol (100 µg/ml) was
added, and incubation was continued for 1 to 2 h. Cells were
harvested from 1.5 ml of culture, washed with 10 mM Tris-20 mM
NaCl-50 mM EDTA (pH 7.2), and suspended in 300 µl of the same
buffer. The suspension was heated in 50°C, and 300 µl of 2%
agarose in 0.5× TBE buffer at the same temperature was added before
solidifying the suspension in molds. The agarose blocks were incubated
overnight at 37°C in lysis buffer, 6 mM Tris-1 M NaCl-100 mM
EDTA-1% sarcosyl-0.2% deoxycholate (pH 7.6), containing 2.5 mg of
lysozyme (Sigma, St. Louis, Mo.) per ml and 20 U of mutanolysin (Sigma)
per ml. Proteinase K (1 mg/ml) treatment was performed in 100 mM
EDTA-1% sarcosyl-0.2% deoxycholate buffer (pH 8.0) for 18 h at
50°C. The agarose blocks were washed four times for 1 h per wash
with 20 mM Tris-50 mM EDTA (pH 8.0), the two first washes containing 1 mM phenylmethylsulfonyl fluoride (Sigma). Before restriction enzyme
digestion, the agarose blocks were washed twice for 1 h per wash
with TE buffer and then balanced for 1 h in an appropriate
restriction enzyme buffer. Restriction enzyme digestions with
NotI and SfiI were performed overnight at 37°C.
Electrophoresis was carried out with a CHEF DR II apparatus (Bio-Rad,
Hercules, Calif.) in 1% PFGE certified agarose (Bio-Rad) with 0.5×
TBE buffer. The pulse time was 1 to 15 s, the current was 5 V/cm,
the temperature was 14°C, and the running time was 22 h. The
agarose gel was stained with ethidium bromide (0.5 µg/ml) and
visualized under UV light. The PFGE profiles of the strains were
visually compared, and every clearly distinguishable profile was
considered one NotI or SfiI genotype. The final
classification of PFGE genotypes (P1, etc.) combines the separate
results obtained with these two restriction enzymes.
| |
RESULTS |
Identification of bacterial species.
Biochemical
identification of species was performed with an API 50 CHL kit. The
identification results given by APILAB Plus software with the API 50 CHL version 4.0 database are shown in Table 1. For 13 strains,
identification levels from good to excellent were obtained, and
identification levels of 11 strains were considered doubtful or
unacceptable due to atypical fermentation reactions.
The ribosomal intergenic regions are reported to be more variable
between species than are the 16S or 23S RNA genes (
2).
Therefore, two sets of
L. rhamnosus species-specific
oligonucleotide
primers were used to identify bacterial strains; the
first pair
of primers was designed into 16S rDNA (
1) and the
second into
the 16S-23S rDNA spacer region (
29). Both
L. rhamnosus primer
pairs gave PCR products of expected
sizes with all strains except
L. zeae ATCC 15820,
L. rhamnosus VS 1033,
L. paracasei VS 1023,
and
L. casei ATCC 393, ATCC 334, and ATCC 4646 (Table
2). The
L. paracasei species-specific primers produced PCR products of
expected sizes with
L. paracasei VS 1023 and
L. casei ATCC 334
and ATCC 4646. All three of these strains were
classified as
L. casei since the rejection of
L. paracasei has been proposed (
9,
10,
17); further, only
the name
L. casei is used. The
L. zeae type
strain, ATCC 15820, and
L. casei ATCC 393, which was
recently
reclassified as
L. zeae (
10,
17), were
not identified by either
L. rhamnosus- or
L. casei-specific primers.
L. rhamnosus VS 1033
gave an
API 50 CHL profile (Table
1) and was earlier identified
as belonging to
the
L. casei group by 16S rRNA sequencing (unpublished
results). It did not, however, give positive results with either
of the
L. rhamnosus or
L. casei primers. This very
likely indicates
that this strain also belongs to
L. zeae.
PCR identifications
of bacterial strains with the
L. rhamnosus and
L. casei species-specific
oligonucleotide
primers are in Table
2.
RAPD analysis.
Twelve RAPD genotypes (A1 to A12) were detected
among the 24 Lactobacillus strains. Genotypes A1 (Fig.
1, lanes 1 to 6), A2 (lanes 7 to 12), A3
(lanes 13 and 14), and A5 (lanes 15 and 18) were represented by six,
six, two, and two strains, respectively, whereas the remaining eight
strains each had a unique RAPD genotype (Fig. 1 and Table
3). All L. rhamnosus strains
(Fig. 1, lanes 1 to 18) except for VS 1033 (Fig. 1, lane 20) produced a
strong 1-kb amplification product that was either missing or weak in the L. zeae (Fig. 1, lanes 21 and 22) and L. casei (Fig. 1, lanes 19, 23, and 24) strains.
View larger version (82K):
[in this window]
[in a new window]
|
FIG. 1.
RAPD patterns and genotypes (in parentheses) of the
strains. Lanes: 1 to 18, L. rhamnosus GG (A1), VS 1031 (A1),
VS 1032 (A1), VS 1034 (A1), VS 1017 (A1), VS 1018 (A1), ATCC 7469 (A2),
ATCC 11443 (A2), E-78080 (A2), VS 872 (A2), VS 495 (A2), VS 1022 (A2),
VS 1020 (A3), VS 1021 (A3), E-97800 (A4), VS 1030 (A5), Lactophilus
(A6), and VS 1019 (A5), respectively; 19, L. casei VS 1023 (A7); 20, L. rhamnosus VS 1033 (A8); 21, L. zeae
ATCC 15820 (A9); 22, L. casei ATCC 393 (A10); 23, L. casei ATCC 334 (A11); 24, L. casei ATCC 4646 (A12); 25, molecular weight marker (in kilobase pairs).
|
|
Ribotyping.
Ribotyping with the EcoRI restriction
enzyme produced 15 distinct fingerprint patterns for the 24 strains
studied (Fig. 2 and Table 3). The triple
band located between 4.8 and 6.2 kb seemed to be a feature typical of
the L. rhamnosus fingerprint patterns; 16 of the 18 L. rhamnosus strains (identified by species-specific PCR) gave this
type of fingerprint (Fig. 2, R1 to R4, R6, R7, and R9). L. casei VS 1023 (R11), ATCC 334 (R13), and ATCC 4646 (R14)
(identified by species-specific PCR) shared bands of approximately 4.2 and 6.5 kb; in addition, strains VS 1023 (R11) and ATCC 334 (R13)
shared bands of approximately 5 and 7 kb. The band pattern of L. rhamnosus VS 1030 (R8) resembled those of strains of both L. rhamnosus and L. casei. L. zeae ATCC 15820 (R15) and L. casei ATCC 393 (R12), which was proposed to
belong to L. zeae (10, 17), had bands of
approximately 1, 3.5, and 7 kb and a double band between 4.5 and 5.5 kb
in common. VS 1033 (R10), which we suggest belongs to L. zeae according to the results of species-specific PCR, shared the
bands of approximately 1 and 3.5 kb and the larger band of the double
band between 4.5 and 5.5 kb with the L. zeae strains. The
fingerprint of L. rhamnosus VS 1020 (R5) did not show
similarity to any other fingerprints. Strains belonging to the same
species were found to also share bands of >10 kb (Fig. 2). These bands
are not listed individually because it was difficult to estimate the
sizes of the bands with the coarse scale.
View larger version (87K):
[in this window]
[in a new window]
|
FIG. 2.
RiboPrint patterns of L. rhamnosus, L. casei, and L. zeae strains. The patterns are composites
of several individual patterns. Ribotypes: R1, L. rhamnosus
GG, VS 1032, VS 1034, VS 1018, VS 1031, and VS 1017; R2, L. rhamnosus ATCC 7469, ATCC 11443, and E-78080; R3, L. rhamnosus VS 872 and VS 1022; R4, L. rhamnosus VS 495;
R5, L. rhamnosus VS 1020; R6, L. rhamnosus VS
1021; R7, L. rhamnosus E-97800 and VS 1019; R8, L. rhamnosus VS 1030; R9, L. rhamnosus Lactophilus; R10,
L. rhamnosus VS 1033; R11, L. casei VS 1023; R12,
L. casei ATCC 393; R13, L. casei ATCC 334; R14,
L. casei ATCC 4646; R15, L. zeae ATCC 15820.
|
|
PFGE.
L. rhamnosus genomic DNA digested with
SfiI and NotI yielded fragments of approximately
23 to 250 and 4 to 250 kb, respectively (Fig.
3 and 4).
SfiI revealed 16 (S1 to S16) and NotI revealed 15 (N1 to N15) distinct genotypes. Combining the results (Table 3), 17 distinct genotypes (P1 to P17) were found in the 24 Lactobacillus strains studied. Thirteen unique genotypes
were found, and genotypes P1, P4, P5, and P8 were represented by four,
three, two, and two strains, respectively (Table 3). All L. rhamnosus and L. zeae strains produced a typical double
band (approximately 250 kb) and, possibly, additional bands with
restriction enzyme SfiI (Fig. 3a and b). NotI cut
L. rhamnosus genomic DNA more often, and similar kinds of
typical bands were not distinguishable (Fig. 4a and b). With the
L. casei strains, a typical restriction pattern was not produced by either enzyme (Fig. 3c and 4c).
View larger version (236K):
[in this window]
[in a new window]
|
FIG. 3.
PFGE profiles and genotypes (in parentheses) of the
strains as determined with restriction enzyme SfiI. (a)
Lanes: 1 to 9, L. rhamnosus GG (S1), ATCC 7469 (S2), ATCC
11443 (S2), E-78080 (S2), VS 872 (S2), E-97800 (S3), VS 1030 (S4), VS
1033 (S5), and VS 1021 (S6), respectively; 10, L. zeae ATCC
15820 (S7). (b) Lanes: 1 to 10, L. rhamnosus VS 1031 (S8),
VS 1032 (S1), VS 1034 (S1), Lactophilus (S9), VS 495 (S10), VS 1017 (S11), VS 1018 (S1), VS 1019 (S12), VS 1020 (S6), and VS 1022 (S2),
respectively. (c) Lanes: 1 to 4, L. casei VS 1023 (S13),
ATCC 393 (S14), ATCC 334 (S15), and ATCC 4646 (S16), respectively.
|
|
View larger version (259K):
[in this window]
[in a new window]
|
FIG. 4.
PFGE profiles and genotypes (in parentheses) of the
strains as determined with restriction enzyme NotI. (a)
Lanes: 1 to 9, L. rhamnosus GG (N1), ATCC 7469 (N2), ATCC
11443 (N2), E-78080 (N2), VS 872 (N3), E-97800 (N4), VS 1030 (N5), VS
1033 (N6), and VS 1021 (N7), respectively; 10, L. zeae ATCC
15820 (N8). (b) Lanes: 1 to 10, L. rhamnosus VS 1031 (N1),
VS 1032 (N1), VS 1034 (N1), Lactophilus (N9), VS 495 (N10), VS 1017 (N11), VS 1018 (N1), VS 1019 (N5), VS 1020 (N7), and VS 1022 (N3),
respectively. (c) Lanes: 1 to 4, L. casei VS 1023 (N12),
ATCC 393 (N13), ATCC 334 (N14), and ATCC 4646 (N15), respectively.
|
|
L. rhamnosus GG (Fig.
3a, lane 1, and 4a, lane 1), VS 1032 (Fig.
3b, lane 2, and 4b, lane 2), VS 1034 (Fig.
3b, lane 3, and
4b,
lane 3), and VS 1018 (Fig.
3b, lane 7, and 4b, lane 7) had
identical
PFGE profiles with both enzymes and could not be distinguished
from
each other (Table
3, genotype P1). The
SfiI-produced
profiles
of
L. rhamnosus VS 1017 (Fig.
3b, lane 6) and VS
1031 (Fig.
3b,
lane 1) differed from those of the previous group by one
and two
extra bands, respectively. Another group with identical PFGE
profiles
(Table
3, genotype P4) with both enzymes consisted of
L. rhamnosus ATCC 7469 (Fig.
3a, lane 2, and 4a, lane 2), ATCC 11443 (Fig.
3a, lane 3, and 4a, lane 3), and E-78080 (Fig.
3a, lane 4, and
4a, lane 4). The third group with identical PFGE patterns (Table
3,
genotype P5) contained
L. rhamnosus VS 872 (Fig.
3a, lane
5, and 4a, lane 5) and VS 1022 (Fig.
3b, lane 10, and 4b, lane
10), and
the last group (Table
3, genotype P7) contained strains
L. rhamnosus VS 1021 (Fig.
3a, lane 9, and 4a, lane 9) and VS
1020 (Fig.
3b, lane 9, and 4b, lane 9). All the other PFGE profiles
of the
L. rhamnosus strains were unique. The
L. casei
and
L. zeae strains all had unique
profiles.
| |
DISCUSSION |
Polyphasic taxonomy, which integrates phenotypic,
genotypic, and phylogenetic information, has changed the classification of lactobacilli in recent years (for a review, see reference
30). Reliable identifications of some species are
not obtained by traditional biochemical methods alone; genotypic
methods are needed as well. This may cause problems for routine
laboratories performing analyses if reliable and easy genetic methods,
e.g., species-specific PCR, are not available.
We tested two pairs of recently published L. rhamnosus
specific primers, one pair complementary to 16S rDNA and the other complementary to the spacer between 16S and 23S rDNA. Similar results
were obtained with the primer pairs, and their specificity to the
studied strains was good. No PCR signal was obtained with either
L. rhamnosus- or L. casei-specific primers for
L. zeae ATCC 15820 or L. casei ATCC 393, which
was recently reclassified as L. zeae. Neotype strain
L. casei ATCC 334 and the L. rhamnosus type
strain, ATCC 7469, were correctly identified with their
species-specific primers. Primers specific for L. zeae are
needed for the complete identification of this bacterial group. All the
strains studied were identified as belonging to the L. casei
group, i.e., to L. casei, L. rhamnosus, or
L. zeae, by the API 50 CHL test. However, the exact
identifications of these closely related species were not reliable.
Identifications of 11 strains were doubtful or unacceptable, and one
strain, L. casei ATCC 393 (reclassified as L. zeae), was misidentified as L. rhamnosus with a good
identification level.
At the species level, RAPD analysis yielded typical amplification
products of 1 kb from all L. rhamnosus strains except for VS
1033, whose identification by the API 50 CHL test was unacceptable; we
suggest that VS 1033 belongs to L. zeae, according to the
results of species-specific PCR. The band representing the 1-kb
amplification product was missing or weak with the L. casei
and L. zeae strains. Ribotyping revealed a triple band
(between 4.8 and 6.2 kb) which seems to be typical for most L. rhamnosus strains. In PFGE, all L. rhamnosus and
L. zeae strains yielded a typical double band (over 250 kb)
when cut with SfiI, while no typical bands were distinguished by NotI. Typical bands in the fingerprints are
very helpful but, of course, are not adequate alone for the
identification of L. rhamnosus.
For strain typing, PFGE was the most discriminating method; it revealed
17 genotypes of the 24 strains studied, while 15 and 12 genotypes were
distinguished by ribotyping and RAPD analysis, respectively. PFGE was
performed with two enzymes, SfiI and NotI, which
increased its discrimination capability. However, even if the results
obtained with SfiI (which revealed 16 genotypes) or NotI (15 genotypes) are considered separately, PFGE remains
the most discriminating or at least as discriminating as ribotyping. All non-L. rhamnosus strains (according to species-specific
PCR) were distinguished from the L. rhamnosus strains by all
three methods. The 18 L. rhamnosus strains were typed into
11 (10 genotypes by SfiI and 9 by NotI), 9, and 6 genotypes by PFGE, ribotyping, and RAPD analysis, respectively. Table 3
shows that some L. rhamnosus strains were typed as belonging
to the same genotype group by all three methods, which can be
considered a very reliable identification. Based on our experience,
PFGE analysis alone, performed with two or three appropriate enzymes,
can be used for reliable strain typing. In several
Lactobacillus studies, PFGE has been shown to be the most
powerful method for strain typing (3, 12, 18), and it is
also used in epidemiological studies (28). However, it is a
laborious and expensive method; therefore, only a limited number of
samples can be analyzed. Screening new primers in RAPD analysis and
using other restriction enzymes in ribotyping could possibly increase
their specificity for strain typing. Ribotyping can be done
automatically (RiboPrinter) and is therefore easily applied, but the
equipment is rather expensive. RAPD analysis is a rapid and cheap
method, but careful optimization is needed to ensure the repeatability
of the results.
To conclude, species-specific PCR, due to rapid and easy performance,
is a very useful method for identifying species of the L. casei group. RAPD analysis, ribotyping, and PFGE are all primarily typing methods, but they do have the potential to also give
species-specific information. Highly standardized and automated
ribotyping could be suitable in forming large databases, giving rise to
the possibility of using a typing method for identification purposes.
Principal identification is still based on microbiological and
biochemical methods, but for thorough analysis, conventional
identification methods should be combined with genotypic methods.
| |
ACKNOWLEDGMENTS |
This work was partly supported by EU grant no. FAIR-CT96-1028.
Tuula Vähäsöyrinki is acknowledged for valuable
technical help in PFGE experiments.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Valio Ltd.
Research and Development Centre, P.O. Box 30, FIN-00039 Valio, Finland. Phone: 358 10381 3125. Fax: 358 10381 3129. E-mail:
soile.tynkkynen{at}valio.fi.
| |
REFERENCES |
| 1.
|
Alander, M.,
R. Satokari,
R. Korpela,
M. Saxelin,
T. Vilpponen-Salmela,
T. Mattila-Sandholm, and A. von Wright.
1999.
Persistence of colonization of human colonic mucosa by a probiotic strain, Lactobacillus rhamnosus GG, after oral consumption.
Appl. Environ. Microbiol.
65:351-354[Abstract/Free Full Text].
|
| 2.
|
Barry, T.,
G. Colleran,
M. Glennon,
L. K. Dunican, and F. Gannon.
1991.
The 16S/23S ribosomal spacer region as a target for DNA probes to identify eubacteria.
PCR Methods Appl.
1:51-56[Medline].
|
| 3.
|
Björkroth, J.,
J. Ridell, and H. Korkeala.
1996.
Characterization of Lactobacillus sake strains associating with production of ropy slime by randomly amplified polymorphic DNA (RAPD) and pulsed-field gel electrophoresis (PFGE) patterns.
Int. J. Food Microbiol.
31:59-68[Medline].
|
| 4.
|
Bollet, C.,
M. J. Gevaudan,
X. de Lamballerie,
C. Zandotti, and P. de Micco.
1991.
A simple method for the isolation of chromosomal DNA from gram positive or acid fast bacteria.
Nucleic Acids Res.
19:1955[Free Full Text].
|
| 5.
|
Brosius, J.,
A. Ullrich,
M. A. Raker,
A. Gray,
T. J. Dull,
R. R. Gutell, and H. F. Noller.
1981.
Construction and fine mapping of recombinant plasmids containing the rrnB ribosomal RNA operon of E. coli.
Plasmid
6:112-118[Medline].
|
| 6.
|
Charteris, W. P.,
P. M. Kelly,
L. Morelli, and J. K. Collins.
1997.
Selective detection, enumeration and identification of potentially probiotic Lactobacillus and Bifidobacterium species in mixed bacterial populations.
Int. J. Food Microbiol.
35:1-27[Medline].
|
| 7.
|
Collins, M. D.,
B. A. Phillips, and P. Zanoni.
1989.
Deoxyribonucleic acid homology studies of Lactobacillus casei, Lactobacillus paracasei sp. nov., subsp. paracasei and subsp. tolerans, and Lactobacillus rhamnosus sp. nov., comb. nov.
Int. J. Syst. Bacteriol.
39:105-108.
|
| 8.
|
Crow, V. L.,
T. Coolbear,
P. K. Gopal,
F. G. Martley,
L. L. McKay, and H. Riepe.
1995.
The role of autolysis of lactic acid bacteria in the ripening of cheese.
Int. Dairy J.
5:855-875.
|
| 9.
|
Dellaglio, F.,
L. M. T. Dicks,
M. du Toit, and S. Torriani.
1991.
Designation of ATCC 334 in place of ATCC 393 (NCDO 161) as the neotype strain of Lactobacillus casei subsp. casei and rejection of the name Lactobacillus paracasei (Collins et al., 1989).
Int. J. Syst. Bacteriol.
41:340-342[Abstract/Free Full Text].
|
| 10.
|
Dicks, L. M. T.,
E. M. du Plessis,
F. Dellaglio, and E. Lauer.
1996.
Reclassification of Lactobacillus casei subsp. casei ATCC 393 and Lactobacillus rhamnosus ATCC 15820 as Lactobacillus zeae nom. rev., designation of ATCC 334 as the neotype of L. casei subsp. casei, and rejection of the name Lactobacillus paracasei.
Int. J. Syst. Bacteriol.
46:337-340[Abstract/Free Full Text].
|
| 11.
|
Donohue, D. C., and S. Salminen.
1996.
Safety of probiotic bacteria.
Asia Pac. J. Clin. Nutr.
5:25-28.
|
| 12.
|
Ferrero, M.,
C. Cesena,
L. Morelli,
G. Scolari, and M. Vescovo.
1996.
Molecular characterization of Lactobacillus casei strains.
FEMS Microbiol. Lett.
140:215-219.
|
| 13.
|
Holzapfel, W. H.,
P. Haberer,
J. Snel,
U. Schillinger, and J. H. J. Huis in't Veld.
1998.
Overview of gut flora and probiotics.
Int. J. Food Microbiol.
41:85-101[Medline].
|
| 14.
|
Klein, G.,
A. Pack,
C. Bonaparte, and G. Reuter.
1998.
Taxonomy and physiology of probiotic lactic acid bacteria.
Int. J. Food Microbiol.
41:103-125[Medline].
|
| 15.
|
Lindberg, A.-M.,
A. Christiansson,
E.-O. Rukke,
T. Eklund, and G. Molin.
1996.
Bacterial flora of Norwegian and Swedish semi-hard cheese after ripening, with special reference to Lactobacillus.
Neth. Milk Dairy J.
50:563-572.
|
| 16.
|
Marteau, P., and J.-C. Rambaud.
1993.
Potential of using lactic acid bacteria for therapy and immunomodulation in man.
FEMS Microbiol. Rev.
12:207-220[Medline].
|
| 17.
|
Mori, K.,
K. Yamazaki,
T. Ishiyama,
M. Katsumata,
K. Kobayashi,
Y. Kawai,
N. Inoue, and H. Shinano.
1997.
Comparative sequence analyses of the genes coding for 16S rRNA of Lactobacillus casei-related taxa.
Int. J. Syst. Bacteriol.
47:54-57[Abstract/Free Full Text].
|
| 18.
|
Roussel, Y.,
C. Colmin,
J. M. Simonet, and B. Decaris.
1993.
Strain characterization, genome size and plasmid content in the Lactobacillus acidophilus group (Hansen and Mocquot).
J. Appl. Bacteriol.
74:549-556[Medline].
|
| 19.
|
Salminen, S.,
E. Isolauri, and E. Salminen.
1996.
Clinical uses of probiotics for stabilizing the gut mucosal barrier: successful strains and future challenges.
Antonie Leeuwenhoek
70:347-358[Medline].
|
| 20.
|
Saxelin, M.
1997.
Lactobacillus GG a human probiotic strain with thorough clinical documentation.
Food Rev. Int.
13:293-313.
|
| 21.
|
Saxelin, M.,
H. Rautelin,
S. Salminen, and P. H. Mäkelä.
1996.
Safety of commercial products with viable Lactobacillus strains.
Infect. Dis. Clin. Pract.
5:331-335.
|
| 22.
|
Schleifer, K.-H.,
M. Ehrmann,
C. Beimfohr,
E. Brockmann,
W. Ludwig, and R. Amann.
1995.
Application of molecular methods for the classification and identification of lactic acid bacteria.
Int. Dairy J.
5:1081-1094.
|
| 23.
|
Schwartz, D. C., and C. R. Cantor.
1984.
Separation of yeast chromosome sized DNAs by pulsed-field gradient gel electrophoresis.
Cell
37:67-75[Medline].
|
| 24.
|
Stiles, M. E., and W. H. Holzapfel.
1997.
Lactic acid bacteria of foods and their current taxonomy.
Int. J. Food Microbiol.
36:1-29[Medline].
|
| 25.
|
Stull, T. L.,
J. J. LiPuma, and T. D. Edlind.
1988.
A broad-spectrum probe for molecular epidemiology of bacteria: ribosomal RNA.
J. Infect. Dis.
157:280-286[Medline].
|
| 26.
|
Sugita, T., and M. Togawa.
1994.
Efficacy of Lactobacillus preparation Biolactis powder in children with rotavirus enteritis.
Jpn. J. Pediatr.
47:2755-2762.
|
| 27.
|
Tanskanen, E. I.,
D. L. Tulloch,
A. J. Hillier, and B. E. Davidson.
1990.
Pulsed-field gel electrophoresis of SmaI digests of lactococcal genomic DNA, a novel method of strain identification.
Appl. Environ. Microbiol.
56:3105-3111[Abstract/Free Full Text].
|
| 28.
|
Tenover, F. C.,
R. D. Arbeit,
R. V. Goering,
P. A. Mickelsen,
B. E. Murray,
D. H. Persing, and B. Swaminathan.
1995.
Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing.
J. Clin. Microbiol.
33:2233-2239[Medline].
|
| 29.
|
Tilsala-Timisjärvi, A., and T. Alatossava.
1997.
Development of oligonucleotide primers from 16S-23S rRNA intergenic sequences for identifying different dairy and probiotic lactic acid bacteria by PCR.
Int. J. Food Microbiol.
35:49-56[Medline].
|
| 30.
|
Vandamme, P.,
B. Pot,
M. Gillis,
P. De Vos,
K. Kersters, and J. Swings.
1996.
Polyphasic taxonomy, a consensus approach to bacterial systematics.
Microbiol. Rev.
60:407-438[Abstract/Free Full Text].
|
| 31.
|
Welsh, J., and M. McClelland.
1990.
Fingerprinting genomes using PCR with arbitrary primers.
Nucleic Acids Res.
18:7213-7218[Abstract/Free Full Text].
|
| 32.
|
Zhong, W.,
K. Millsap,
H. Bialkowska-Hobrzanska, and G. Reid.
1998.
Differentiation of Lactobacillus species by molecular typing.
Appl. Environ. Microbiol.
64:2418-2423[Abstract/Free Full Text].
|
Applied and Environmental Microbiology, September 1999, p. 3908-3914, Vol. 65, No. 9
0099-2240/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Hatakka, K., Mutanen, M., Holma, R., Saxelin, M., Korpela, R.
(2008). Lactobacillus rhamnosus LC705 Together with Propionibacterium freudenreichii ssp shermanii JS Administered in Capsules Is Ineffective in Lowering Serum Lipids. J. Am. Coll. Nutr.
27: 441-447
[Abstract]
[Full Text]
-
Coudeyras, S., Marchandin, H., Fajon, C., Forestier, C.
(2008). Taxonomic and Strain-Specific Identification of the Probiotic Strain Lactobacillus rhamnosus 35 within the Lactobacillus casei Group. Appl. Environ. Microbiol.
74: 2679-2689
[Abstract]
[Full Text]
-
Naser, S. M., Dawyndt, P., Hoste, B., Gevers, D., Vandemeulebroecke, K., Cleenwerck, I., Vancanneyt, M., Swings, J.
(2007). Identification of lactobacilli by pheS and rpoA gene sequence analyses. Int. J. Syst. Evol. Microbiol.
57: 2777-2789
[Abstract]
[Full Text]
-
Harrow, S. A., Ravindran, V., Butler, R. C., Marshall, J. W., Tannock, G. W.
(2007). Real-Time Quantitative PCR Measurement of Ileal Lactobacillus salivarius Populations from Broiler Chickens To Determine the Influence of Farming Practices. Appl. Environ. Microbiol.
73: 7123-7127
[Abstract]
[Full Text]
-
Diancourt, L., Passet, V., Chervaux, C., Garault, P., Smokvina, T., Brisse, S.
(2007). Multilocus Sequence Typing of Lactobacillus casei Reveals a Clonal Population Structure with Low Levels of Homologous Recombination. Appl. Environ. Microbiol.
73: 6601-6611
[Abstract]
[Full Text]
-
Cai, H., Rodriguez, B. T., Zhang, W., Broadbent, J. R., Steele, J. L.
(2007). Genotypic and phenotypic characterization of Lactobacillus casei strains isolated from different ecological niches suggests frequent recombination and niche specificity. Microbiology
153: 2655-2665
[Abstract]
[Full Text]
-
Wang, L.-T., Lee, F.-L., Tai, C.-J., Yokota, A., Kuo, H.-P.
(2007). Reclassification of Bacillus axarquiensis Ruiz-Garcia et al. 2005 and Bacillus malacitensis Ruiz-Garcia et al. 2005 as later heterotypic synonyms of Bacillus mojavensis Roberts et al. 1994. Int. J. Syst. Evol. Microbiol.
57: 1663-1667
[Abstract]
[Full Text]
-
Ben Amor, K., Vaughan, E. E., de Vos, W. M.
(2007). Advanced Molecular Tools for the Identification of Lactic Acid Bacteria. J. Nutr.
137: 741S-747S
[Abstract]
[Full Text]
-
Desai, A. R., Shah, N. P., Powell, I. B.
(2006). Discrimination of Dairy Industry Isolates of the Lactobacillus casei Group.. J DAIRY SCI
89: 3345-3351
[Abstract]
[Full Text]
-
Vancanneyt, M., Huys, G., Lefebvre, K., Vankerckhoven, V., Goossens, H., Swings, J.
(2006). Intraspecific Genotypic Characterization of Lactobacillus rhamnosus Strains Intended for Probiotic Use and Isolates of Human Origin. Appl. Environ. Microbiol.
72: 5376-5383
[Abstract]
[Full Text]
-
Capra, M. L., del L. Quiberoni, A., Ackermann, H.-W., Moineau, S., Reinheimer, J. A.
(2006). Characterization of a new virulent phage (MLC-A) of Lactobacillus paracasei.. J DAIRY SCI
89: 2414-2423
[Abstract]
[Full Text]
-
De Vuyst, L., Schrijvers, V., Paramithiotis, S., Hoste, B., Vancanneyt, M., Swings, J., Kalantzopoulos, G., Tsakalidou, E., Messens, W.
(2002). The Biodiversity of Lactic Acid Bacteria in Greek Traditional Wheat Sourdoughs Is Reflected in Both Composition and Metabolite Formation. Appl. Environ. Microbiol.
68: 6059-6069
[Abstract]
[Full Text]
-
Simpson, P. J., Stanton, C., Fitzgerald, G. F., Ross, R. P.
(2002). Genomic Diversity within the Genus Pediococcus as Revealed by Randomly Amplified Polymorphic DNA PCR and Pulsed-Field Gel Electrophoresis. Appl. Environ. Microbiol.
68: 765-771
[Abstract]
[Full Text]
-
ANNUK, H., HYNES, S. O., HIRMO, S., MIKELSAAR, M., WADSTROM, T.
(2001). Characterisation and differentiation of lactobacilli by lectin typing. J Med Microbiol
50: 1069-1074
[Abstract]
[Full Text]
-
Okatani, A. T., Uto, T., Taniguchi, T., Horisaka, T., Horikita, T., Kaneko, K.-I., Hayashidani, H.
(2001). Pulsed-Field Gel Electrophoresis in Differentiation of Erysipelothrix Species Strains. J. Clin. Microbiol.
39: 4032-4036
[Abstract]
[Full Text]
-
Hatakka, K., Savilahti, E., Ponka, A., Meurman, J. H, Poussa, T., Nase, L., Saxelin, M., Korpela, R.
(2001). Effect of long term consumption of probiotic milk on infections in children attending day care centres: double blind, randomised trial. BMJ
322: 1327-1327
[Abstract]
[Full Text]
-
Simpson, K. L., Pettersson, B., Priest, F. G.
(2001). Characterization of lactobacilli from Scotch malt whisky distilleries and description of Lactobacillus ferintoshensis sp. nov., a new species isolated from malt whisky fermentations. Microbiology
147: 1007-1016
[Abstract]
[Full Text]
-
Okatani, A. T., Hayashidani, H., Takahashi, T., Taniguchi, T., Ogawa, M., Kaneko, K.-i.
(2000). Randomly Amplified Polymorphic DNA Analysis of Erysipelothrix spp.. J. Clin. Microbiol.
38: 4332-4336
[Abstract]
[Full Text]
Top
Abstract
Introduction
