 |
INTRODUCTION |
The gram-positive, food-borne
pathogen Listeria monocytogenes is able to tolerate
environmental stresses, such as reduced water activity and temperature
extremes (5, 6, 16, 45). This high degree of adaptability is
one reason that the pathogen can be difficult to control in a number of
foods, since treatments used in food processing and preservation
utilize the very environmental stresses to which L. monocytogenes shows resistance. Hence, the focus of research in a
number of laboratories is the molecular mechanism by which L. monocytogenes adapts to environmental stresses. One area in
particular that has received considerable attention is the mechanism of
adaptation to osmotic stress. It has been shown that L. monocytogenes responds to elevated osmolarity in the environment
by the intracellular accumulation of compatible solutes, called
osmolytes. These osmolytes function in the cytosol by counterbalancing
the external osmolarity without adversely affecting macromolecular
structure or function (7, 47). Glycine betaine and
carnitine, which are highly effective osmolytes in certain bacteria
(7), were also found to protect L. monocytogenes against osmotic stress (3, 21, 39). However, these osmolytes were found to play the additional role of chill stress protectant in
L. monocytogenes, a function which thus far is known to
occur only in this pathogen (21).
The accumulation of glycine betaine and carnitine is achieved by
osmotically activated and chill-activated transport from the medium
rather than by de novo synthesis by the cell (21, 31, 39).
Recent research on the characterization of these transport systems has
shown that carnitine is accumulated via an ATP-dependent transport
system (44), while glycine betaine uptake proceeds by
symport with Na+ (11). This absolute requirement
for Na+ was detected in vesicles; it was not observed in
whole cells (20). In addition, the Na+-coupled
transport system in vesicles showed classical Arrhenius behavior with
temperature and did not appear to be activated by cold (11).
These observations suggested that more than one transport system is
responsible for stress-activated glycine betaine accumulation in
L. monocytogenes.
In this article, we describe the isolation of a glycine betaine
transport mutant of L. monocytogenes from a
Tn917-LTV3 transposon insertional library and report the
nucleotide sequences of genes encoding a glycine betaine transport
system distinct from that described by Gerhardt et al. (11).
| |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and culture conditions.
L.
monocytogenes strains used in this work were the wild-type isolate
10403S (41) and its derivatives, DP-L1044
(hly::Tn917-LTV3) (41) and
LTG59 (this work). L. monocytogenes cultures were maintained on solid trypticase soy agar medium at 4°C, and brain heart infusion (BHI) (Difco) broth was used as rich medium. Luria-Bertani broth (37) was used to maintain Escherichia coli
strains. When defined medium was required, the medium described by Pine
and coworkers (33, 34) containing 0.5% glucose but lacking
choline (modified Pine's medium) was used. M63 (30) was
used as the defined medium for E. coli WG439 (putP
proP proU) (8). [Methyl-14C]glycine
betaine was prepared by the oxidation of
[methyl-14C]choline (NEN Research Products)
(32). Kanamycin (50 µg/ml), ampicillin (50 µg/ml), and
chloramphenicol (10 µg/ml) were used as appropriate.
Measurements of growth rate and glycine betaine transport.
Growth rates of bacterial cultures were determined by turbidimetry as
previously described (21). Experimental treatments were
carried out at least in duplicate. Except where noted, glycine betaine
transport rates were determined in duplicate by using [methyl-14C]glycine betaine as described previously
(21). In experiments designed to determine the monovalent
cation requirement, cultures were grown in K+-deficient
modified Pine's medium with 4% NaCl or in Na+-deficient
modified Pine's medium supplemented with 4% KCl. Cultures were
harvested by centrifugation and resuspended to 1/10 of their original
volumes in ACES (N-[2-acetamido]-2-aminoethanesulfonic acid) buffer (pH 6.75) containing the same concentration of chloride salt as the growth medium. Transport assays were initiated by the
addition of 100 µM [14C]glycine betaine, and protein
concentrations were determined by the method of Lowry et al.
(27).
Isolation of glycine betaine transport-deficient mutants.
Glycine betaine transport-deficient mutants were isolated from a pool
of transposon insertional mutants of L. monocytogenes 10403S
containing Tn917-LTV3 (4) (provided by B. Walsh,
University of California, Davis). This transposon confers resistance to
chloramphenicol and kanamycin in L. monocytogenes and
contains a promoterless lacZ gene, polylinker cloning sites,
and ColE1 replication functions which allow direct cloning of the
L. monocytogenes chromosomal DNA adjacent to the proximal
side of lacZ (4). The pool was subjected to three
rounds of penicillin enrichment in BHI medium containing 8% NaCl and 1 µg of penicillin per ml. Mutants were initially screened for growth
on solid modified Pine's medium, for resistance to chloramphenicol,
and for the inability to be rescued by 100 µM glycine betaine when
stressed by 8% NaCl. Putative transport mutants were subsequently
analyzed for growth in liquid medium in the presence and absence of
added NaCl and glycine betaine and for the uptake of
[14C]glycine betaine. One mutant, strain LTG59, which
exhibited reduced osmotic tolerance and a reduced rate of glycine
betaine uptake was used for DNA sequence analysis and further studies.
DNA isolation and sequence analysis.
The nucleotide sequence
of the L. monocytogenes LTG59 genomic DNA flanking the
transposon was determined as follows. First, L. monocytogenes genomic DNA proximal to lacZ was cloned
into E. coli DH5
(37), taking advantage of the
ColE1 replication functions of Tn917-LTV3. Standard methods
(37) were used for digestion with restriction enzymes,
ligation, and gel electrophoresis, except where noted. Genomic DNA of
mutant strain LTG59 was extracted as described by Flamm et al.
(10) and was digested with XbaI, which restricts
the transposon at the polylinker site (4). The desired DNA
fragment, which was approximately 17 kb in length, was identified by
probing with a 3-kb BglII fragment of the kanamycin resistance gene (neo) derived from Tn5 (provided
by B. Walsh). DNA hybridization was detected by chemiluminescence with
an ECL gene detection kit (Amersham) and nitrocellulose membranes
(Schleicher and Schuell) according to the manufacturers' instructions.
XbaI-digested genomic DNAs from 10403S and DP-L1044 were
used as negative and positive controls, respectively.
The digested DNA was precipitated by the addition of ethanol and then
brought to a concentration of 1 µg/ml in ligation reaction buffer
(4). Five units of T4 DNA ligase (BRL-GIBCO) was added, and
the mixture was incubated at 26°C overnight to allow the DNA to
self-ligate. The DNA was precipitated by the addition of ethanol, redissolved in Tris-EDTA buffer (pH 8.0), and used to transform E. coli DH5 by electroporation with a gene pulser
(Bio-Rad, Richmond, Calif.) according to the manufacturer's
recommendations. E. coli transformants containing the
desired plasmid (designated pLTG59X) were selected by kanamycin
resistance, and the presence of the transposon fragment in pLTG59X was
confirmed by Southern blot analysis with the probe for neo
as described above.
L. monocytogenes genomic DNA was sequenced in both the
forward and reverse directions by the Molecular Genetics
Instrumentation Facility at the University of Georgia with an Applied
Biosystems (ABI) 373 Sequencer and Taq terminator chemistry.
Primers were synthesized with an ABI 394 DNA-RNA oligonucleotide
synthesizer at the Protein Structure Laboratory of the University of
California, Davis. The first primer used, F1
(GTTAAATGTACAAAATAACAGCGA), was derived from the sequence of
Tn917-LTV3, on the proximal side of lacZ and
about 70 bp from its end (38).
To obtain the nucleotide sequence flanking the other side of the
transposon insertion, inverse PCR was carried out with a PTC-200
thermal cycler (MJ Research) using EcoRI-digested genomic DNA of strain 10403S as a template. Conditions used for PCR
amplifications are described in reference 37. The
size of the PCR-amplified DNA fragment was 1.5 kb, although the size
expected from analysis of restriction endonuclease digests was about 7 kb. Apparently, a region of homology to one of the primers occurred
within the DNA fragment, generating a smaller fragment which was
amplified more efficiently. In view of this anomaly, a second
amplification was performed with primers F11
(TGAACCACTTTTTGAGTAAATCATTTTTTG) and B9
(CAATAACTTGCCCAGTTAACGTGAGCGAAT), which yielded a 3.5-kb fragment. Both fragments were used in the determination of the nucleotide sequence of the entire coding region.
Analysis of the nucleotide sequence was performed with DNAsis version 3 software (Hitachi Software Engineering Co.). Peptide homology searches
were carried out at the National Center for Biotechnology Information
by using the BLAST programs.
Cloning the glycine betaine transport genes and complementation
of E. coli WG439.
A 3,456-bp fragment of genomic
L. monocytogenes DNA was amplified by PCR with primers G5
(GGGAATTCCCACTTTTGAGTAAATCATT), which contains a terminal
EcoRI site followed by the sequence located 389 bp upstream
from the start codon of the first open reading frame, and G3
(GGCTGCAGATGCATCTTCCTCCTAG), which contains a terminal PstI site and the complementary DNA sequence located 116 bp
downstream from the stop codon of the third open reading frame. The
amplified DNA fragment was ligated with pUC18 (43) at the
EcoRI and PstI sites, and the resulting
recombinant plasmid (pGBU18) was used to transform E. coli
WG439 by electroporation. Transformants were selected by ampicillin
resistance and were screened for glycine betaine transport and osmotic
tolerance in M63 medium supplemented with NaCl and glycine betaine as
described in the legend of Fig. 7. The identity of the insert in pUC18
was verified by DNA sequence analysis with the G3 and G5 primers and
M13 forward and reverse primers (Pharmacia Biotech).
Nucleotide sequence accession number.
The nucleotide
sequences of L. monocytogenes gbuA, gbuB, and gbC
and flanking regions have been deposited in GenBank under accession no.
AF039835.
| |
RESULTS |
Isolation and analysis of glycine betaine transport-deficient
mutants.
Mutants impaired in their ability to transport glycine
betaine were isolated from a pool of Tn917-LTV3 L. monocytogenes mutants by screening for the loss of glycine
betaine-dependent salt tolerance. Of approximately 3,600 mutants that
were screened, 17 that displayed both a reduction in growth under
osmotic stress conditions and a reduction in osmoregulated glycine
betaine uptake were isolated. In addition, each mutant yielded a 17-kb
DNA fragment that hybridized with the neo probe for
Tn917-LTV3 after digestion with XbaI (data not
shown); therefore, only one mutant, LTG59, was used for further studies. The growth characteristics in liquid medium of mutant LTG59
were compared to those of the parent strain 10403S and strain DP-L1044,
a derivative of 10403S that contains the transposon Tn917-LTV3 in the hly locus (41) (Fig.
1). At 8% NaCl and 100 µM glycine
betaine, the growth rate of the mutant strain LTG59 was about one-half
that of the parent strains 10403S and DP-L1044, and the lag phase was
twofold longer than those of the other strains. No differences in
growth rates were observed among the strains in unstressed cultures
grown at 30°C, nor were differences observed in cultures stressed
with NaCl in the absence of glycine betaine (data not shown).
View larger version (15K):
[in this window]
[in a new window]
|
FIG. 1.
Growth characteristics of L. monocytogenes
LTG59. Cultures of 10403S ( ), DP-L1044 ( ), and the glycine
betaine transport mutant LTG59 ( ) were grown in BHI and inoculated
into modified Pine's medium (1% inoculum). These cultures were grown
to late log phase and used to inoculate (1%) modified Pine's medium
containing 100 µM glycine betaine. Cultures were grown at 30°C with
8% NaCl (A) or at 7°C without added NaCl (B). The ranges of
duplicate values are indicated by error bars.
|
|
At 7°C, the growth rate of LTG59 was slightly lower (0.023 generation
h
1) than those of 10403S and DP-L1044 (0.027 generation
h1), but the lag phases were indistinguishable (Fig. 1B).
Hence, the effect of this mutation on chill tolerance is more subtle than it is on the osmotic tolerance of the cell.
Uptake rates of [14C]glycine betaine by LTG59, 10403S,
and DP-L1044 were measured in modified Pine's medium with 8% NaCl and at 7°C without additional salt (Fig.
2). While the glycine betaine uptake rate
of DP-L1044 was identical to that of the parent strain 10403S (45 nmol
of glycine betaine min1 mg of cellular
protein1), the uptake rate of the mutant strain LTG59 (11 nmol of glycine betaine min1 mg of cellular
protein1) was about fourfold lower than that of either of
the other two strains in osmotically stressed cells (Fig. 2A). The
effect of the mutation on chill-stimulated uptake was more pronounced
than that on salt-activated uptake (Fig. 2B). For example, the rate of
glycine betaine uptake by LTG59 (3.0 nmol of glycine betaine min1 mg of cellular protein1) was
about eightfold lower than the rate by 10403S (25 nmol of glycine
betaine min1 mg of cellular
protein1). Taken together, the results of growth rate and
uptake rate experiments indicate that the mutant strain LTG59 is
impaired in the transport of glycine betaine at elevated osmolarity and at decreased temperature and that this mutation decreases the ability
of the strain to tolerate elevated osmolarity and, to some extent, low
temperature.
View larger version (15K):
[in this window]
[in a new window]
|
FIG. 2.
Glycine betaine transport activity of L. monocytogenes LTG59. Uptake of 100 µM [14C]glycine
betaine was measured in 10403S (), DP-L1044 (), and the mutant
LTG59 () grown to late log phase in modified Pine's medium at
30°C with 8% NaCl (A) or at 7°C without added NaCl (B). Transport
was assayed as described in Materials and Methods. The ranges of
duplicate values are indicated by error bars.
|
|
The fact that glycine betaine transport was not completely blocked is
consistent with our previous finding that glycine betaine transport in
L. monocytogenes may be the result of two transport systems:
one uptake system which is responsible for most of the observed glycine
betaine transport and another which has an absolute requirement for
Na+ (11). It is therefore possible that the
Tn917-LTV3 insertion eliminated the major activity but left
the Na+-dependent activity intact. To determine if
Na+ was required for the residual glycine betaine uptake
activity observed in LTG59, uptake was assayed in ACES buffer
containing 4% KCl or NaCl as the stressing salt (Fig.
3). While a deficiency in Na+
did not significantly affect the rate of glycine betaine uptake in
10403S, it did reduce the rate of uptake in LTG59 to about 1% that of
the parent strain 10403S, indicating that nearly all of the residual
activity observed in LTG59 is dependent on Na+.
View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3.
Effect of Na+ and K+ deficiency
on the uptake of glycine betaine in L. monocytogenes
strains. Cultures of 10403S ( , ) and LTG59 (, ) were grown
and assayed for [14C]glycine betaine uptake in either 4%
KCl (open symbols) or 4% NaCl (closed symbols) as described in
Materials and Methods. The ranges of duplicate values are indicated by
error bars.
|
|
Nucleotide sequence analysis of the L. monocytogenes
DNA fragment encoding the glycine betaine transport system.
Analysis of the nucleotide sequence of the L. monocytogenes
DNA fragment flanking Tn917-LTV3 in strain LTG59 revealed
the presence of three open reading frames (Fig.
4) with G+C contents of 39.8%, which is
not atypical for members of the genus Listeria (9). The open reading frames are oriented in the same
direction and are 1,194 (gbuA), 849 (gbuB), and
903 bp (gbuC) in length. The first open reading frame,
gbuA, and the third open reading frame, gbuC,
have an unusual translational start codon, TTG, a point that is
discussed below. Also, the three open reading frames are closely
arranged. The end of gbuA overlaps the beginning of gbuB by 8 bp, and the intergenic distance between
gbuB and gbuC is 13 bp, suggesting that the three
open reading frames are genetically arranged in an operon. Consistent
with this suggestion is the fact that a region upstream from the first
open reading frame is homologous to the promoter sequences of the
opuA and proU operons (18, 28).
Furthermore, a palindromic region 7 to 59 bp downstream of the stop
codon of gbuC that could function as a transcription terminator was found (data not shown).
View larger version (7K):
[in this window]
[in a new window]
|
FIG. 4.
Physical map of the cloned L. monocytogenes
gbu region. The locations of the three open reading frames
(gbuA, gbuB, and gbuC) and the
direction of transcription are indicated by horizontal arrows. The
start codon of gbuB overlaps with the stop codon of
gbuA by 8 bp, and the intergenic distance between
gbuB and gbuC is 13 bp. The sequence of the
putative promoter is shown with the  35 and 10 regions underlined.
The position of the Tn917-LTV3 insertion is indicated by the
vertical arrow. Also shown are restriction sites for
HindIII (H), BamHI (B), EcoRI (E),
and XbaI (X).
|
|
A comparison of the deduced amino acid sequences of the three open
reading frames with known protein sequences yielded the strongest
homologies to two known glycine betaine transporters: OpuA from
Bacillus subtilis (18) and ProU from E. coli (12). These transporters belong to the superfamily
of ATP-dependent transport systems, which in bacteria usually consist
of three kinds of protein subunits: an ATPase, a transmembrane protein, and a substrate-binding protein (1). The ATPase and
transmembrane protein components form a membrane complex, while the
substrate-binding protein is a soluble protein residing in the
periplasm in gram-negative bacteria. In the absence of a periplasm, the
substrate-binding protein is necessarily tethered to the cytoplasmic
membrane of gram-positive bacteria (42). The open reading
frame gbuA is predicted to encode a highly hydrophilic
protein 397 amino acid residues in length (Mr,
43,624). Inspection of the deduced amino acid sequence of GbuA revealed
60.2 and 48.1% identities to OpuAA and ProV, respectively, which have
been proposed to form the ATPase subunit of OpuA and ProU. Moreover,
the GbuA sequence contains the Walker A and B motifs and Loop 3 (Fig.
5), the
highly conserved sequences of the ATPase subunit of these transporters
(15), providing further evidence that GbuA is the ATPase
subunit.
View larger version (131K):
[in this window]
[in a new window]
|
FIG. 5.
Alignment of the deduced amino acid sequences encoded by
gbu from L. monocytogenes with the homologous
systems from B. subtilis and E. coli. Identical
amino acids are shaded in black, and conservative substitutions are in
gray. (A) The sequence of GbuA is compared with those of OpuAA from
B. subtilis and ProV from E. coli. The Walker
motifs A and B, two highly conserved sequences found in ATP-dependent
transporters, are underlined. Another highly conserved region, Loop 3, is indicated by a double underline. (B) Comparison of GbuB with the
corresponding OpuAB protein from B. subtilis and ProW
protein of E. coli. (C) Comparison of GbuC with the glycine
betaine binding protein OpuAC from B. subtilis and ProX
protein from E. coli. The position of the predicted cleavage
site of the signal peptide is indicated by the vertical line (between
residues 20 and 21 of GbuC).
|
|
The gbuB open reading frame encodes a hydrophobic protein
282 amino acid residues in length (Mr, 30,917).
Analysis of the hydropathic characteristics of the amino acid sequence
indicates that the protein contains six segments with sufficient
hydrophobicity and length to span the membrane (Fig.
6) (24). Consistent with transmembrane proteins in general, these hydrophobic regions occur in
sections of the sequence that are predicted to be largely helical (36). In addition, the deduced amino acid sequence is
homologous to OpuAB (54.6% identity) from B. subtilis and
ProW (44.7% identity) from E. coli, which are the
transmembrane protein components of their respective transporters (Fig.
5). The gbuB gene product is therefore proposed to form a
transmembrane channel.
View larger version (17K):
[in this window]
[in a new window]
|
FIG. 6.
Hydropathy profiles of GbuA, GbuB, and GbuC. The
hydrophobicity of the protein is represented as a hydropathy index,
computed by using the method of Kyte and Doolittle (24). A
window of 20 amino acids was used.
|
|
The final open reading frame, gbuC, is predicted to encode a
relatively hydrophilic, 300-amino-acid protein
(Mr, 33,274) which is presumed to be the
substrate-binding protein. The L. monocytogenes sequence has
significantly greater homology to OpuAC (Fig. 5) (51.0% identity) than
to ProX (14.7% identity), as expected considering the differing
structural requirements of the binding protein in gram-positive versus
-negative bacteria. It is noteworthy that a 20-amino-acid region at the
N terminus of GbuC contains a high proportion of hydrophobic residues
(Fig. 6), characteristic of signal peptides. Furthermore, both GbuC and
OpuAC contain the signal peptide consensus sequence (Leu-Ala-Ala-Cys)
of substrate-binding proteins from gram-positive bacteria (19,
42). This sequence is of particular significance, since in this
class of proteins, proteolytic cleavage has been shown to occur between
Ala and Cys to provide an N-terminal Cys, the point of attachment of
the protein to the cellular membrane (19, 42).
Functional complementation of E. coli WG439.
To
verify that gbu from L. monocytogenes encodes a
glycine betaine transport system, complementation experiments were
carried out with E. coli WG439, a strain which is devoid of
glycine betaine transport activity, and pGBU18, which harbors the
gbu genes. Osmotically stressed transformants containing
pGBU18 effectively transported glycine betaine (Fig.
7A), but unstressed transformants did not (data not shown). The enhancement of glycine betaine-dependent osmotic
tolerance of the culture by pGBU18 was also observed (Fig. 7B). At 0.7 M NaCl and 100 µM glycine betaine, growth was observed in strain
WG439(pGBU18) but not in WG439(pUC18) or in untransformed cells. In the
absence of glycine betaine in the stressing medium, none of the strains
grew, and in the absence of NaCl stress, all three strains grew at
approximately the same rate (0.95 to 1.0 generation h1).
Hence, it appears that not only was glycine betaine uptake activity
detectable but also it was sufficient to confer osmotic tolerance upon
the complemented strain.
View larger version (13K):
[in this window]
[in a new window]
|
FIG. 7.
Restoration of the glycine betaine-dependent osmotic
tolerance phenotype in E. coli WG439 transformants. For
glycine betaine transport experiments (A), cultures grown aerobically
at 37°C in M63 medium supplemented with ampicillin were used to
inoculate M63 containing 0.4 M NaCl and ampicillin. After several hours
of growth, 100 µM [14C]glycine betaine was added to
initiate transport. For growth rate experiments (B), cultures were
grown in M63 containing 0.7 M NaCl and 1 mM glycine betaine and
ampicillin. The strains used were WG439 (), WG439(pUC18) (), and
WG439(pGBU18) (). The ranges of duplicate values are indicated by
error bars.
|
|
| |
DISCUSSION |
The intracellular accumulation of glycine betaine in L. monocytogenes contributes significantly to the osmotic tolerance
of the cell (3, 21). Furthermore, the accumulation is
effected by transport of this osmolyte from the growth medium (21,
31) or food substrate (39). Previously we showed that
osmoregulated glycine betaine uptake is coupled to Na+
transport (11) but that an additional transporter in
L. monocytogenes was likely. Evidence of a second glycine
betaine transport system in L. monocytogenes that belongs to
the superfamily of ATP-dependent transporters and is not
Na+ dependent has been provided in this report.
The deduced amino acid sequences of the three open reading frames
showed extensive homology with OpuA from B. subtilis and somewhat less homology with ProU from E. coli. Both of these
systems are ATP-dependent glycine betaine transporters. In addition,
the nucleotide sequence revealed that the three open reading frames are
in close proximity. In fact, the end of gbuA overlaps the start of gbuB by 8 nucleotides. Interestingly,
proU, which encodes a second betaine transporter from
B. subtilis (26), and proU from
E. coli (12) both show similar overlaps between
their first and second open reading frames. Whether these overlaps are
indicative of regulatory elements or are examples of genetic economy
(22) is unclear at this time. Another unusual feature is the
TTG start codon of gbuA and gbuC. While this
start codon is rare, it has been reported for L. monocytogenes (25, 29). Moreover, 13% of all genes in
B. subtilis start with the TTG codon (23). In the
case of the gbu genes, the view that TTG is the start codon for two of the genes in the transport system arose from the observed homology with the deduced N-terminal sequences of OpuAA and OpuAC of
B. subtilis upstream from the first ATG codon of GbuA and
GbuC (59 and 58%, respectively). Also, located 7 and 8 bp upstream from the putative TTG start codons of gbuA and
gbuC, respectively, were GA-rich regions which could serve
as ribosome binding sites. In addition, similar GA-rich regions
optimally spaced for ribosome binding from the first occurring ATG
codons of both gbuA and gbuC were not found.
While the putative promoter region of the gbu operon shows
extensive homology to the promoters of opuA and
proU (18, 28), none of these promoters contains
consensus sequences recognized by any known sigma factor from
gram-positive or -negative bacteria (13, 14). Even so,
Becker et al. (2) recently reported that a mutation in the
stress transcription factor 
B of L. monocytogenes decreased the glycine betaine-dependent osmotic tolerance of the cell and reduced the rate of glycine betaine transport. One explanation for this apparent incongruity is that B might affect transport activity indirectly via
modulation of a regulatory protein that controls gbu
expression or betaine transport activity. However, when one also
considers that the decrease in glycine betaine uptake in the
B knockout mutant reported by Becker et al.
(2) was less than twofold, a simpler explanation is that a
second, B-dependent, transporter occurs in L. monocytogenes.
The fact that glycine betaine uptake was not completely blocked in the
osmotically stressed mutant strain LTG59 is another indication that one
additional transport system is present in L. monocytogenes.
Furthermore, when Na+ was omitted from the assay mixture,
glycine betaine uptake activity was virtually eliminated in LTG59 but
remained unchanged in the parent strain, 10403S. Taken together, these
results indicate that two transport systems occur in L. monocytogenes: a highly active ATP-dependent transporter and a
less active Na+-glycine betaine symporter. Multiple
transport systems in prokaryotes are not uncommon, and such systems
have been observed for glycine betaine transport. In B. subtilis, three glycine betaine uptake systems, encoded by
opuA, opuD, and opuC (proU), have been
identified (17, 26), and two each have been identified
in Staphylococcus aureus (35, 40) and E. coli (46).
Why should L. monocytogenes have two osmotically regulated
glycine betaine transport systems? Apparently glycine betaine
accumulation is an important process in L. monocytogenes,
conferring both osmotic and chill tolerance (21).
Furthermore, it is accumulated in unstressed cells (21),
albeit to relatively low concentrations, presumably to contribute to
the high turgor pressure found in gram-positive bacteria. Unlike the
transport systems in S. aureus (35, 40) and
E. coli (46), both transporters in L. monocytogenes appear to give low Km values
(11, 21, 28a), which also indicates the importance of
glycine betaine to this species. However, these systems are not truly
redundant considering the differences in their relative rates of
activity and modes of energy coupling. In assigning separate functions
to these transporters, it would be an oversimplification to assume that
the major role of the ATP-dependent system is merely the transport of
glycine betaine in the absence of Na+, since is unlikely
that an Na+-free environment would be encountered in
nature. It is more likely a question of energetics.
Na+-metabolite symporters are generally single
transmembrane proteins, which are much simpler and more economical for
the cell to manufacture than multicomponent, ATP-dependent
transporters. Moreover, although little is known about the
stoichiometry of these transport systems, it is generally accepted that
transport of nutrients by ion-metabolite symporters is also less
costly, energetically, than ATP-coupled transport. However, a benefit
of the ATP-dependent transporters is that they are able to concentrate
metabolites to a much higher level than ion-metabolite symporters.
Hence, symport may be the primary route of glycine betaine accumulation
in energy-depleted cells, while the ATP-coupled system may be more
important during rapid growth, when energy is plentiful.
Finally, disruption of gbu by transposon insertion
significantly reduced chill-activated transport, indicating that
gbu is responsible for most of the chill-activated uptake.
This result agrees with our previous observation that the
Na+-glycine betaine symporter could not support
chill-activated transport in vesicles (11). Whether the
residual chill-activated transport is a result of passive diffusion or
is due to this or another transport system needs to be addressed to
elucidate the specific functions of each transport system in nature.
| 1.
|
Ames, G. F.-L.
1988.
Structure and mechanism of bacterial periplasmic transport systems.
J. Bioenerg. Biomembr.
20:1-18[Medline].
|
| 2.
|
Becker, L. A.,
M. S. Cetin,
R. W. Hutkins, and A. K. Benson.
1998.
Identification of the gene encoding the alternative sigma factor B from Listeria monocytogenes and its role in osmotolerance.
J. Bacteriol.
180:4547-4554[Abstract/Free Full Text].
|
| 3.
|
Beumer, R. R.,
M. C. Te Giffel,
L. J. Cox,
F. M. Rombouts, and T. Abee.
1994.
Effect of exogenous proline, betaine, and carnitine on growth of Listeria monocytogenes in a minimal medium.
Appl. Environ. Microbiol.
60:1359-1363[Abstract/Free Full Text].
|
| 4.
|
Camilli, A.,
D. A. Portnoy, and P. Youngman.
1990.
Insertional mutagenesis of Listeria monocytogenes with a novel Tn917 derivative that allows direct cloning of DNA flanking transposon insertions.
J. Bacteriol.
172:3738-3744[Abstract/Free Full Text].
|
| 5.
|
Cole, M. B.,
M. V. Jones, and C. Holyoak.
1990.
The effect of pH, salt concentration and temperature on the survival and growth of Listeria monocytogenes.
J. Appl. Bacteriol.
69:63-72[Medline].
|
| 6.
|
Conner, D. E.,
R. E. Brackett, and L. R. Beuchat.
1986.
Effect of temperature, sodium chloride, and pH on growth of Listeria monocytogenes in cabbage juice.
Appl. Environ. Microbiol.
52:59-63[Abstract/Free Full Text].
|
| 7.
|
Csonka, L. N., and A. D. Hanson.
1991.
Prokaryotic osmoregulation: genetics and physiology.
Annu. Rev. Microbiol.
45:569-606[Medline].
|
| 8.
|
Culham, D. E.,
B. Lasby,
A. G. Marangoni,
J. L. Milner,
B. A. Steer,
R. W. van Nues, and J. M. Wood.
1993.
Isolation and sequencing of Escherichia coli gene proP reveals unusual structural features of the osmoregulatory proline/betaine transporter, ProP.
J. Mol. Biol.
229:268-276[Medline].
|
| 9.
|
Farber, J. M., and P. I. Peterkin.
1991.
Listeria monocytogenes: a food-borne pathogen.
Microbiol. Rev.
55:476-511[Abstract/Free Full Text].
|
| 10.
|
Flamm, R. K.,
D. J. Hinrichs, and M. F. Tomashow.
1984.
Introduction of pAM 1 into Listeria monocytogenes by conjugation and homology between native L. monocytogenes plasmids.
Infect. Immun.
44:157-161[Abstract/Free Full Text].
|
| 11.
|
Gerhardt, P. N. M.,
L. T. Smith, and G. M. Smith.
1996.
Sodium-driven, osmotically activated glycine betaine transport in Listeria monocytogenes membrane vesicles.
J. Bacteriol.
178:6105-6109[Abstract/Free Full Text].
|
| 12.
|
Gowrishankar, J.
1989.
Nucleotide sequence of the osmoregulatory proU operon of Escherichia coli.
J. Bacteriol.
171:1923-1931[Abstract/Free Full Text].
|
| 13.
|
Haldenwang, W. G.
1995.
The sigma factors of Bacillus subtilis.
Microbiol. Rev.
59:1-30[Abstract/Free Full Text].
|
| 14.
|
Helmann, J. D., and M. J. Chamberlin.
1988.
Structure and function of bacterial sigma factors.
Annu. Rev. Biochem.
57:839-872[Medline].
|
| 15.
|
Higgins, C. F.
1992.
ABC transporters: from microorganism to man.
Ann. Rev. Cell Biol.
8:67-113.
|
| 16.
|
Juneja, V. K.,
T. A. Foglia, and B. S. Marmer.
1998.
Heat resistance and fatty acid composition of Listeria monocytogenes: effect of pH, acidulant, and growth temperature.
J. Food Prot.
61:683-687.
[Medline] |
| 17.
|
Kappes, R. M.,
B. Kempf, and E. Bremer.
1996.
Three transport systems for the osmoprotectant glycine betaine operate in Bacillus subtilis: characterization of OpuD.
J. Bacteriol.
178:5071-5079[Abstract/Free Full Text].
|
| 18.
|
Kempf, B., and E. Bremer.
1995.
OpuA, an osmotically regulated binding protein-dependent transport system for the osmoprotectant glycine betaine in Bacillus subtilis.
J. Biol. Chem.
270:16701-16713[Abstract/Free Full Text].
|
| 19.
|
Kempf, B. J.,
J. Gade, and E. Bremer.
1997.
Lipoprotein from the osmoregulated ABC transport system OpuA of Bacillus subtilis: purification of the glycine betaine binding protein and characterization of a functional lipidless mutant.
J. Bacteriol.
179:6213-6220[Abstract/Free Full Text].
|
| 20.
|
Ko, R.
1996.
Adaptation mechanisms of Listeria monocytogenes under hyperosmotic and low temperature stress. Ph.D. thesis.
University of California, Davis.
|
| 21.
|
Ko, R.,
L. T. Smith, and G. M. Smith.
1994.
Glycine betaine confers enhanced osmotolerance and cryotolerance on Listeria monocytogenes.
J. Bacteriol.
176:426-431[Abstract/Free Full Text].
|
| 22.
|
Kozak, M.
1983.
Comparison of initiation of protein synthesis in procaryotes, eucaryotes, and organelles.
Microbiol. Rev.
47:1-45[Free Full Text].
|
| 23.
|
Kunst, F.,
N. Ogasawara,
I. Moszer,
A. M. Albertini,
G. Alloni, et al.
1997.
The complete genome sequence of the gram-positive bacterium Bacillus subtilis.
Nature
390:249-256[Medline].
|
| 24.
|
Kyte, J., and R. F. Doolittle.
1982.
A simple method for displaying the hydropathic character of a protein.
J. Mol. Biol.
157:105-132[Medline].
|
| 25.
|
Leimeister-Wachter, M.,
E. Domann, and T. Chakraborty.
1991.
Detection of a gene encoding a phosphatidylinositol-specific phospholipase C that is co-ordinately expressed with listeriolysin in Listeria monocytogenes.
Mol. Microbiol.
5:361-366[Medline].
|
| 26.
|
Lin, Y., and J. N. Hansen.
1995.
Characterization of a chimeric proU operon in a subtilin-producing mutant of Bacillus subtilis 168.
J. Bacteriol.
177:6874-6880[Abstract/Free Full Text].
|
| 27.
|
Lowry, O. H.,
N. J. Rosebrough,
A. L. Farr, and R. J. Randall.
1951.
Protein measurement with the Folin phenol reagent.
J. Biol. Chem.
193:265-275[Free Full Text].
|
| 28.
|
May, G.,
E. Faatz,
J. M. Lucht,
M. Harrdt,
M. Bolliger, and E. Bremer.
1989.
Characterization of the osmoregulated Escherichia coli proU promoter and identification of ProV as a membrane-associated protein.
Mol. Microbiol.
3:1521-1531[Medline].
|
| 28a.
| Mendum, M., and L. T. Smith. Unpublished
results.
|
| 29.
|
Mengaud, J.,
C. Braun-Breton, and P. Cossart.
1991.
Identification of phosphatidylinositol-specific phospholipase C activity in Listeria monocytogenes: a novel type of virulence factor?
Mol. Microbiol.
5:367-372[Medline].
|
| 30.
|
Miller, J. H.
1992.
A short course in bacterial genetics: a laboratory manual and handbook for Escherichia coli and related bacteria.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 31.
|
Patchett, R. A.,
A. F. Kelly, and R. G. Kroll.
1994.
Transport of glycine betaine by Listeria monocytogenes.
Arch. Microbiol.
162:205-210[Medline].
|
| 32.
|
Perroud, B., and D. Le Rudulier.
1985.
Glycine betaine transport in Escherichia coli: osmotic modulation.
J. Bacteriol.
161:393-401[Abstract/Free Full Text].
|
| 33.
|
Pine, L.,
M. Franzus, and G. Malcolm.
1986.
Guanine is a growth factor for Legionella species.
J. Clin. Microbiol.
23:163-169[Abstract/Free Full Text].
|
| 34.
|
Pine, L.,
G. Malcom,
J. Brooks, and M. Daneshvar.
1989.
Physiological studies on the growth and utilization of sugars by Listeria species.
Can. J. Microbiol.
35:245-254[Medline].
|
| 35.
|
Pourkomailian, B., and I. R. Booth.
1994.
Glycine betaine transport by Staphylococcus aureus: evidence for feedback regulation of the activity of the two transport systems.
Microbiology
140:3131-3138[Abstract].
|
| 36.
|
Rost, B.,
C. Sander, and R. Schneider.
1994.
PHD an automatic mail server for protein secondary structure prediction.
CABIOS
10:53-60.
[Abstract/Free Full Text] |
| 37.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 38.
|
Shaw, J. H., and D. B. Clewell.
1985.
Complete nucleotide sequence of macrolide-lincosamide-streptogramin B-resistance transposon Tn917 in Streptococcus faecalis.
J. Bacteriol.
164:782-796[Abstract/Free Full Text].
|
| 39.
|
Smith, L. T.
1996.
Role of osmolytes in adaptation of osmotically stressed and chill-stressed Listeria monocytogenes grown in liquid media and on processed meat surfaces.
Appl. Environ. Microbiol.
62:3088-3093[Abstract].
|
| 40.
|
Stimeling, K. W.,
J. E. Graham,
A. Kaenjak, and B. J. Wilkinson.
1994.
Evidence for feedback (trans) regulation of, and two systems for, glycine betaine transport by Staphylococcus aureus.
Microbiology
140:3139-3144[Abstract].
|
| 41.
|
Sun, A. N.,
A. Camilli, and D. A. Portnoy.
1990.
Isolation of Listeria monocytogenes small-plaque mutants defective for intracellular growth and cell-to-cell spread.
Infect. Immun.
58:3770-3778[Abstract/Free Full Text].
|
| 42.
|
Sutcliffe, I. C., and R. R. B. Russell.
1995.
Lipoproteins of gram-positive bacteria.
J. Bacteriol.
177:1123-1128[Free Full Text].
|
| 43.
|
Takeshita, S.,
M. Sato,
M. Toba,
W. Masahashi, and T. Hashimoto-Gotoh.
1987.
High-copy-number and low-copy-number plasmid vectors for lacZ -complementation and chloramphenicol- or kanamycin-resistance selection.
Gene
61:63-74[Medline].
|
| 44.
|
Verheul, A.,
F. M. Rombouts,
R. R. Beumer, and T. Abee.
1995.
An ATP-dependent L-carnitine transporter in Listeria monocytogenes Scott A is involved in osmoprotection.
J. Bacteriol.
177:3205-3212[Abstract/Free Full Text].
|
| 45.
|
Walker, S.,
P. Archer, and J. Banks.
1990.
Growth of Listeria monocytogenes at refrigeration temperatures.
J. Appl. Bacteriol.
68:157-162[Medline].
|
| 46.
|
Wood, J. M.
1988.
Proline porters effect the utilization of proline as nutrient or osmoprotectant for bacteria.
J. Membr. Biol.
106:183-202[Medline].
|
| 47.
|
Yancey, P. H.,
M. E. Clark,
S. C. Hand,
R. D. Bowlus, and G. N. Somero.
1982.
Living with water stress: evolution of osmolyte systems.
Science
217:1214-1222[Abstract/Free Full Text].
|
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
and
Top
Abstract
Introduction
Present address: Laboratory of Molecular Entomology and
Baculovirology, The Institute of Physical and Chemical Research, Wako, Saitama, Japan.
