Previous Article | Next Article 
Applied and Environmental Microbiology, January 2000, p. 277-283, Vol. 66, No. 1
0099-2240/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Carbon Catabolite Repression in Lactobacillus
pentosus: Analysis of the ccpA Region
Kerstin
Mahr,
Wolfgang
Hillen, and
Fritz
Titgemeyer*
Lehrstuhl für Mikrobiologie,
Friedrich-Alexander-Universität Erlangen-Nürnberg, D-91058
Erlangen, Germany
Received 16 August 1999/Accepted 26 October 1999
 |
ABSTRACT |
The catabolite control protein CcpA is a central regulator in
low-G+C-content gram-positive bacteria. It confers carbon catabolite repression to numerous genes required for carbon utilization. It also
operates as a transcriptional activator of genes involved in diverse
phenomena, such as glycolysis and ammonium fixation. We have cloned the
ccpA region of Lactobacillus pentosus. ccpA encodes a protein of 336 amino acids exhibiting similarity to CcpA
proteins of other bacteria and to proteins of the LacI/GalR family of
transcriptional regulators. Upstream of ccpA was found an
open reading frame with similarity to the pepQ gene,
encoding a prolidase. Primer extension experiments revealed two start
sites of transcription for ccpA. In wild-type cells grown
on glucose, mRNA synthesis occurred only from the promoter proximal to
ccpA. In a ccpA mutant strain, both promoters
were used, with increased transcription from the distant promoter,
which overlaps a presumptive CcpA binding site called cre
(for catabolite responsive element). This suggests that expression of
ccpA is autoregulated. Determination of the expression
levels of CcpA in cells grown on repressing and nonrepressing carbon
sources revealed that the amounts of CcpA produced did not change
significantly, leading to the conclusion that the arrangement of two
promoters may ensure constant expression of ccpA under
various environmental conditions. A comparison of the genetic
structures of ccpA regions revealed that lactic acid bacteria possess the gene order pepQ-ccpA-variable while
the genetic structure in bacilli and Staphylococcus xylosus
is aroA-ccpA-variable-acuC.
| |
INTRODUCTION |
The catabolite control protein CcpA
is a global regulator controlling carbon catabolite repression (CCR),
glycolysis, fermentative metabolism, and fixation of ammonium in
low-G+C-content gram-positive bacteria (42). Thus, bacteria
carrying a defect in ccpA exhibit deregulated CCR and
reduced growth rates (20). The molecular mechanism of CcpA
function in bacilli is well understood (for a review, see reference
14). When Bacillus subtilis is grown on a
preferred carbon source, such as glucose or fructose, the metabolite-activated HPr kinase/phosphatase PtsK phosphorylates the
proteins HPr and Crh at a seryl residue via ATP (9, 19, 32).
Both seryl-phosphorylated proteins activate CcpA by forming a complex
with it, thereby enabling CcpA to bind to catabolite responsive
elements (cre) found within promoter or coding regions of
catabolite-controlled genes (5). This results in a
repression of gene expression at the level of mRNA synthesis, as has
been demonstrated, for example, for the gnt operon of
B. subtilis and the xyl operon of Bacillus
megaterium (8, 10). Besides its repressor function,
CcpA operates as a pleiotropic activator, as has been reported for the
B. subtilis genes encoding acetate kinase, 
-acetolactate
synthase, phosphotransacetylase, and glutamate synthase and for the
Lactococcus lactis las operon, encoding phosphofructokinase, pyruvate kinase, and L-lactate dehydrogenase (7, 11,
26, 33, 36).
Lactic acid bacteria, which are of central importance for the food
industry, apparently control utilization of carbon sources via CCR. An
internal fragment of the ccpA gene of Lactobacillus pentosus, an organism involved in fermentation of cucumbers,
olives, and cabbage (the latter for sauerkraut production), has been
cloned and used to construct a ccpA mutant (22).
Glucose repression of the xylAB operon, encoding
D-xylose isomerase and D-xylulose kinase, which
are required for xylose fermentation, was relieved in the
ccpA mutant strain (22). This led to the
conclusion that the mechanism of CCR in L. pentosus is
similar to that found in bacilli. Data supporting this conclusion have
been reported for the CcpA proteins of Lactobacillus casei
and Lactococcus lactis and for the CcpA homologue PepR1 of
Lactobacillus delbrueckii subsp. lactis (25,
26, 30, 35). Analysis of the CcpA homologue RegM of
Streptococcus mutans revealed an opposite effect on CCR (37). When regM was inactivated, the mutant
strain showed an increase in glucose repression. As in the case of
pepR1 of L. delbrueckii subsp. lactis
and the ccpA genes of L. casei and
Lactococcus lactis, regM is linked to the gene
pepQ, encoding a prolidase, suggesting that these genes have
similar functions (3, 37, 41; C. Esteban and G. Pérez-Martínez, unpublished data, 1999). Information on
the genetic context of L. pentosus ccpA is lacking.
In this communication, we report the completion of the determination of
the L. pentosus ccpA sequence and that of the surrounding genes. We use this information to assess the regulation of
ccpA itself, showing that it has features distinctly
different from those of L. casei and Staphylococcus
xylosus. We inspect CcpA-specific residues among CcpAs and the
closely related proteins RegM and PepR1, and we compare the
ccpA region of L. pentosus with ccpA regions of other bacteria, providing new insights into the genetic organization of ccpA among lactic acid bacteria and other
low-G+C-content gram-positive bacteria.
| |
MATERIALS AND METHODS |
Bacterial strains.
L. pentosus MD363 (wild type) was
used for isolation of the ccpA genomic region
(22). L. pentosus MD363 and the isogenic ccpA mutant L. pentosus LPE4
(ccpA::erm) were used for primer extension and Western blot analyses (22). Escherichia
coli DH5 was used for standard cloning procedures
(34).
Southern blot analysis.
Chromosomal DNA of L. pentosus MD363 was isolated as described previously
(24). Ten-microgram quantities of chromosomal DNA were
digested with SalI, PstI, SpeI,
DraI, or EcoRV, and restriction fragments were
separated on a 1% agarose gel. Plasmid pEI2 (1 µg) was labelled by
nick translation, using a biotin-7-dATP labelling kit (BioNick
labelling system; Gibco BRL) according to the recommendations of the
manufacturer. DNA fragments from agarose gels were transferred to a
nylon membrane (Gibco BRL) and fixed by UV irradiation (UV Stratalinker; Stratagene). Standard aqueous conditions were employed for hybridization and washing of membranes (34). Hybridized DNA fragments on the membrane were visualized by using the PhotoGENE nucleic acid detection system (Gibco BRL). Single
ccpA-hybridizing DNA fragments of 6.4, 14.0, 10.0, 8.0, and
4.3 kb were obtained after restriction with SalI,
PstI, SpeI, DraI, and
EcoRV, respectively.
Inverse PCR.
L. pentosus MD363 chromosomal DNA (200 ng) was digested with SalI and religated overnight at 14°C
in a 200-µl volume of T4 DNA ligase buffer containing 10 U of T4 DNA
ligase (Boehringer). The religated DNA was precipitated by addition of
700 µl of ice-cold ethanol (96%), 20 µl of 3 M sodium acetate (pH
4.8), and glycogen (1 µg ml
1) and incubation for 2 h at 
70°C. The precipitated DNA was resuspended in 20 µl of
Tris-EDTA buffer, pH 8.0. For inverse PCR, the Tth-Taq enzyme mixture included in the Sawady-Long PCR Kit from Peqlab was
used. The reaction mixture consisted of 3 µl of religated DNA (about
30 ng), 1.75 mM MgCl2, 350 µM each deoxyribonucleoside triphosphate, 2.5 U of the Tth-Taq enzyme mixture, and 15 pmol of each primer (LPE1 [5'-CCATTAACCACCCGTGAAACCGTTGCC-3']
and LPE2 [5'-TCCAGCCATCACCTCAATCACGCAACC-3']) in a
volume of 50 µl. PCR was conducted as follows: 2 min at 93°C; 10 cycles of 10 s at 93°C, 30 s at 55°C, and 5 min at
68°C; 20 cycles of 10 s at 93°C, 30 s at 55°C, and 5 min plus 20 s at 68°C; and a final incubation for 18 min at
68°C. DNA sequencing of inverse-PCR products was performed on an ABI
PRISM 310 Genetic Analyzer (Perkin-Elmer) with fluorescence-labelled
dideoxyribonucleoside triphosphates provided in the BigDye Terminator
Mix (Perkin-Elmer).
Plasmid construction.
The ccpA gene was cloned in
two steps. First, a DNA fragment of 1,260 bp was amplified by PCR from
L. pentosus MD363 chromosomal DNA, using oligonucleotides
LPE9 (5'-AAAAATACAATCTCCGTGTGG-3') and LPE10
(5'-GATTCCAAACCTAGTATACCGC-3'). This fragment was used as a
template for a second PCR with oligonucleotides LPE11
(5'-GGGCTATTTTCATATGGAAAAGC-3') and LPE12
(5'-ACTTCCCGGATCCGGCGTCTCATTAG-3') to create an
NdeI and a BamHI restriction site, respectively
(underlined). The NdeI-BamHI fragment was cloned
into plasmid pET15b (Novagen) which had been cut with the same
restriction endonucleases, giving plasmid pWH154 (ccpA). The
pepQ-ccpA intergenic region was amplified by PCR with oligonucleotides LPE17 (5'-CACCGAGGTCGAACAAGACC-3') and
LPE26 (5'-GCCACATCATAAATTGTTACTG-3'). The PCR amplification
product of 978 bp, containing 689 bp of pepQ, 254 bp of the
pepQ-ccpA intergenic region, and 35 bp of ccpA,
was cloned into the SmaI restriction site of plasmid
pSU2718, giving plasmid pWH156 (27). Nucleotide sequences of
inserts were determined by DNA sequencing as described above.
Isolation of RNA.
Cells of L. pentosus MD363 and
LPE4 (ccpA::erm) were grown overnight
at 37°C under static conditions on minimal (M) medium supplemented
with 50 mM glucose (23). Cells were harvested by centrifugation and washed twice with 10 ml of M medium. A 50-ml volume
of M medium supplemented with 50 mM glucose was inoculated with cells
to an optical density at 600 nm (OD600) of 0.1. Cells were
grown at 37°C to an OD600 of 0.8. A 10-ml volume of the
culture was harvested, and the resulting cell pellet was resuspended in 100 µl of Tris-EDTA buffer, pH 8.0. Lysozyme was added to a final concentration of 10 mg ml1, and the suspension was
incubated at 37°C for 1 h. Lysis of the cells and preparation of
total RNA were performed with an RNeasy Minikit from Qiagen according
to the recommendations of the manufacturer.
Primer extension analysis.
Total RNA of L. pentosus MD363 and LPE4 was isolated as described above. Primer
extension experiments were performed with avian myeloblastosis virus
reverse transcriptase (Stratagene) and oligonucleotide LPE27
(5'-AATTGTTACTGTTTGCTTTTCC-3'), which is complementary to
positions 24 to 3 of the ccpA coding sequence (see Fig. 3A).
Oligonucleotides were 5' labelled by the use of T4 polynucleotide
kinase (New England Biolabs). In primer extension reactions, 500 fmol
of labelled primer was used with 20 µg of cellular RNA. Reverse
transcripts were resolved on 6% urea-polyacrylamide gels. Standard
DNA sequencing reactions with Sequenase (U.S. Biochemical Corp.), using
the same oligonucleotides, were performed for sizing of the primer
extension products. The positions of transcriptional start sites were
confirmed by using a second oligonucleotide, LPE26
(5'-GCCACATCATAAATTG-TTACTG-3'), hybridizing to positions 35 to 14 of the ccpA coding sequence.
Western blot analysis.
L. pentosus MD363 and LPE4
(ccpA::erm) were grown individually
overnight at 37°C under static conditions in 10 ml of M medium supplemented with 50 mM glucose (23). Cells were harvested
by centrifugation and washed twice with 10 ml of M medium. A 50-ml volume of M medium supplemented with 50 mM glucose or xylose was inoculated with culture to an OD600 of 0.1. Cells were
grown at 37°C to an OD600 of 0.8. After the cells were
harvested, the cell pellet was resuspended in 1 ml of starting buffer
(20 mM Tris-HCl [pH 7.5], 3 mM dithiothreitol). Crude extracts were
prepared by sonification at 45 W (Labsonic U [Braun]; twice, for
20 s each time) and subsequent removal of cell debris by
centrifugation. Proteins of cell extracts were separated by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis on a 7.5%
polyacrylamide gel and transferred to a polyvinylidene difluoride
membrane (Fluorotrans) by electroblotting. CcpA was detected with a
rabbit polyclonal antiserum raised against CcpA of B. megaterium (21). CcpA antibodies on the polyvinylidene difluoride membrane were visualized by using the ECL Western blot analysis system (Amersham).
Computer analyses.
DNA and protein data bank searches were
performed with the BLAST server of the National Center for
Biotechnology Information at the National Institutes of Health,
Bethesda, Md. (URL http://www.ncbi.nlm.nih.gov). The LaserGene
workstation software (DNASTAR, Inc.) was used to process DNA and
protein sequence data.
Nucleotide sequence accession number.
The
pepQ-ccpA DNA sequence has been submitted to GenBank under
accession no. AF176799.
| |
RESULTS AND DISCUSSION |
Isolation of the ccpA region of L. pentosus.
The isolation of an internal ccpA gene fragment from
L. pentosus MD353 has been described in a previous
publication (22). This fragment was used to construct a
ccpA mutant in the more highly transformable strain MD363.
Thus, we chose MD363 to determine the sequences of the complete
ccpA gene and flanking genes.
A Southern blot analysis of chromosomal DNA of MD363 was performed with
plasmid pEI2, which contains the internal ccpA fragment 'ccpA', as a probe. Chromosomal DNA restricted with
SalI gave a signal of 6.4 kb, indicating the presence of the
ccpA gene on the chromosomal SalI DNA fragment
(data not shown). The 6.4-kb fragment was amplified by inverse PCR with
oligonucleotides LPE1 and LPE2, which hybridized to the 5' end and to
the 3' end of the known 'ccpA' fragment, respectively. As a
result, an amplification product of 5.6 kb was generated (Fig.
1). The PCR fragment was directly
subjected to sequencing with the same oligonucleotides. The determined
nucleotide sequence comprised the missing ends of ccpA and
adjacent intergenic sequences, as revealed by analysis of similarity to
the ccpA gene of L. casei. Further sequencing of
the PCR product yielded 1,379 bp upstream and 453 bp downstream of
ccpA (see the section on genetic organization below).
View larger version (47K):
[in this window]
[in a new window]
|
FIG. 1.
Amplification product of 5.6 kb of the ccpA
region of L. pentosus on a 1% agarose gel. Sizes of DNA
fragments are indicated in kilobase pairs. Lane 1, DNA marker
fragments; lane 2, 3 µl of a 50-µl-volume inverse PCR using
oligonucleotides LPE1 and LPE2 and religated L. pentosus
MD363 chromosomal DNA.
|
|
Analysis of CcpA.
The L. pentosus ccpA gene was
amplified by PCR, using chromosomal DNA as a template, as described in
Materials and Methods. For further analysis, the fragment was cloned in
plasmid pET15b by insertion into NdeI and BamHI
sites, giving plasmid pWH154. Sequencing of L. pentosus
MD363 ccpA revealed an open reading frame (ORF) of 1,011 bp
encoding 336 amino acids with a calculated molecular mass of 36,316 Da.
A potential ribosome binding site (RBS; AGAAAGG) is located
at positions 12 to 18. At the DNA level, ccpA of
L. pentosus MD363 showed 97% identity to the
'ccpA' fragment of L. pentosus MD353 and 76%
identity to the next related ccpA gene of L. casei. The 20 differences in nucleotides found in the
ccpA genes of the two L. pentosus strains do not
affect the amino acid sequence; thus, the gene products are identical.
At the protein level, CcpA of
L. pentosus shows 66 to 39%
identity to CcpA and CcpA-like proteins of
L. casei (66%),
Enterococcus faecalis (62%; accession no.
AJ011113),
Listeria monocytogenes (60%),
Streptococcus
mutans (RegM; 59%),
B. subtilis (56%),
B. megaterium (55%),
Lactococcus lactis (53%),
L. delbrueckii (PepR1;
50%),
Thermoactinomyces sp. strain
E79 (50%; accession no.
AF055979),
Staphylococcus xylosus
(48%), and
Clostridium acetobutylicum (39%)
(
1,
13,
16,
26,
37,
41).
The CcpA proteins comprise a subgroup of the LacI/GalR family of
bacterial transcriptional regulators, to which they exhibit
about 30%
protein sequence identity (
43). The CcpA subgroup
has been
defined by physiological functionality (
18). On this
basis,
67 CcpA-specific residues have been proposed to be present
in all CcpA
proteins and predominantly absent from the other members
of the family
(
18). The CcpA-specific residues are clustered
in three
blocks throughout the amino acid sequence. One block
covers the
N-terminal helix-turn-helix motif, while most other
conserved residues
form a continuous patch on the protein surface
(
18). The
contents of LacI/GalR-specific residues among all
proteins of the
family are similar, ranging between 63 and 83
LacI/GalR-specific
positions (Table
1). CcpA of
L. pentosus possesses
61 of the 67 CcpA-specific amino acid positions
(Table
1 and
Fig.
2). Thus, CcpA of
L. pentosus contains the same number of
CcpA-specific
residues as the well-characterized CcpA of
B. megaterium (Table
1). An increased number of CcpA-specific residues compared
to
that of non-CcpA proteins of the LacI/GalR family can be found
in the
regulator protein RegA of
C. acetobutylicum (24 of 67).
This
protein was shown to complement a
B. subtilis ccpA mutant
and must therefore have features necessary for CcpA function
(
4).
The CcpA homologues RegM of
Streptococcus
mutans and PepR1 of
L. delbrueckii comprise 60 and 47 CcpA-specific residues, respectively,
a good indication of a CcpA-like
function in these organisms.
View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2.
Protein sequence of L. pentosus CcpA and
comparison to a consensus sequence. Lowercase letters of the consensus
sequence designate conserved amino acid residues specific for proteins
of the LacI/GalR family of regulators, whereas uppercase letters
designate amino acid residues specific for CcpA proteins
(18).
|
|
Identification of the genes flanking ccpA.
To determine
the genes flanking ccpA, parts of the 5.6-kb amplification
product were sequenced by primer walking. Upstream of ccpA,
an ORF of 1,107 bp whose orientation was opposite that of
ccpA and which exhibited a high degree of similarity to
pepQ genes of other lactic acid bacteria was identified and
found to encode a dipeptidase which specifically cleaves X-prolyl
peptide bonds (40). The gene was therefore designated
pepQ. Multiple-alignment analysis revealed a possible start
codon, TTG, which is preceded by a potential RBS (AGGAGTG)
located at positions 8 to 14. A potential transcriptional
termination site
(AATCCGCCCCATCCTGATAAGCACGATGGGGCGGATT; the inverted repeat is underlined) was found 33 bp downstream of
pepQ. PepQ of L. pentosus showed 57% identity to
PepQ of Lactobacillus helveticus (accession no. AK012084)
and L. delbrueckii subsp. lactis, 50% identity
to PepQ of Streptococcus mutans, and 42% identity to
L. delbrueckii subsp. bulgaricus (31, 37,
40). A catalytical center comprising a zinc-binding motif
which is typical of zinc-dependent metallopeptidases has been described (17). PepQ of L. pentosus contains this unique
signature at amino acid positions 294 to 304.
ccpA and
pepQ have similar G+C contents (49 and
50%, respectively). The 453-bp sequence downstream of
ccpA
(48% G+C) exhibited
no similarity to any known proteins of the data
bank. A potential
stem-loop structure (underlined),
AGGTTTGGAATCTG
ATTCCAAACCT, could
be
identified 58 bp downstream of
ccpA; this might serve as a
transcriptional termination site. The
pepQ-ccpA intergenic
region
(254 bp) exhibits a decreased G+C content of 32%, typical of
promoter-containing
regions (
39). A fully conserved
cre site (TGAAAGCGATTTCA) was
found to be located
at positions
107 to
120 with respect to
the
ccpA gene,
suggesting autoregulation of
ccpA.
Transcriptional regulation of ccpA.
To determine the
transcriptional start point and to examine the potential of
ccpA for autoregulation, primer extension analyses were
performed on RNA extracted from cells of wild-type strain L. pentosus MD363 and from cells of ccpA mutant strain
L. pentosus LPE4, respectively, grown on M medium
supplemented with 50 mM glucose. In both strains, a transcription start
site was found (at positions 55 and 58, respectively), as indicated
by a double band in Fig. 3B. Such a
double signal can be explained by an alternative use of start sites
through the same promoter (P1). Interestingly, the primer extension
analysis of mRNA of the ccpA mutant strain revealed a second
transcription initiation site, indicated by a stronger primer extension
signal. It could be assigned to a G at position 119, which represents
the second base of the potential cre site (P2) (Fig. 3A).
Both promoters P1 (TTGCAT-17 bp-TATATT) and P2 (TTGCAT-17
bp-TATTAT) are well conserved compared to the 
A-dependent promoters of B. subtilis
(12). The finding that the P2 transcript could be formed
only when functional CcpA protein was missing suggests autoregulation
of ccpA.
View larger version (2247K):
[in this window]
[in a new window]
|
FIG. 3.
Genetic organization and transcriptional regulation of
L. pentosus ccpA. (A) Genetic organization of the
ccpA region. The size and orientation of the ORFs were
deduced from the nucleotide sequence. The ccpA promoter
region is depicted at the DNA sequence level. ccpA
transcriptional start sites are in boldface and are marked by
asterisks. Potential RBSs and cre motifs are underlined.
Putative RNA polymerase binding sites (10 region and 35 region) in
the sequence are in boldface letters and underlined and are indicated
with P1 and P2. The N-terminal protein sequences of pepQ and
ccpA are shown. (B) Primer extension analysis of
ccpA gene transcription of L. pentosus wild-type
and ccpA mutant strains. Total RNA was prepared from cells
grown on M medium supplemented with 50 mM glucose. Reverse
transcription was carried out with end-labelled oligonucleotide LPE27.
DNA sequencing reactions were performed with the same oligonucleotide
and with pWH156 as template DNA. Primer extension products were
analyzed on 6% polyacrylamide-urea gels. Lane 1, RNA (20 µg) from
L. pentosus LPE4 (ccpA mutant); lane 2, RNA (20 µg) from L. pentosus MD363 (wild type). The sequence
interpretations around the +1 sites (asterisks and arrows) of the two
ccpA promoters are shown.
|
|
CcpA expression levels on various carbon sources.
To further
determine the effect of transcriptional regulation on the amount of
CcpA protein synthesized under different growth conditions, Western
blotting experiments were performed (Fig. 4). L. pentosus MD363
wild-type cells were grown on M medium under repressing and
nonrepressing conditions, using 50 mM glucose and 50 mM xylose,
respectively. As can be seen in Fig. 4, CcpA signals of equal
intensities were found in cell extracts grown under repressing and
nonrepressing conditions (lanes 3 and 4). This finding suggests that
nearly constant amounts of cellular CcpA are present independently of
the presence or absence of glucose.
View larger version (70K):
[in this window]
[in a new window]
|
FIG. 4.
Western blot analysis of L. pentosus grown on
various carbon sources. A Western blot of a sodium dodecyl
sulfate-7.5% polyacrylamide gel is shown after incubation with
polyclonal antibodies derived against CcpA of B. megaterium.
Lane 1, 50 ng of purified CcpA of B. megaterium; lane 2, 0.2 OD600 equivalents of protein extract of L. pentosus LPE4 (ccpA mutant); lanes 3 and 4, 0.2 OD600 equivalents of protein extract of L. pentosus MD363 grown on M medium with 50 mM glucose and 50 mM
xylose, respectively.
|
|
Regulation of
ccpA has been studied in only a few organisms,
namely,
B. subtilis,
B. megaterium,
Staphylococcus xylosus, and
L. casei (
6,
16,
29,
30). Western blot analysis and
ccpA::
lacZ fusion measurements led to
the conclusion that CcpA is constitutively
expressed in
B. subtilis and
B. megaterium (
16,
29).
However,
in neither case has the promoter been mapped. Constitutive
expression
of
ccpA of
L. casei was also revealed
by primer extension and
Northern blot analyses (
30). The
ccpA gene of
L. casei is expressed
via only one
promoter, which apparently is lacking a
cre site
and is
therefore not subject to autoregulation. As in
L. pentosus,
transcription of
ccpA of
Staphylococcus xylosus
is driven by a
tandem promoter and triggered through autoregulation via
a
cre site. However, here the
cre site overlaps
the transcription start
site of the promoter proximal to
ccpA (
6). The authors (
6)
reported
that in
Staphylococcus xylosus there exists a carbon
source-dependent autoregulation of
ccpA mediated by
cre and resulting
in a slight decrease of CcpA expression
when cells are grown in
the presence of
glucose.
In conclusion, we suggest that in all organisms investigated to date,
CcpA is produced in more or less constant amounts regardless
of growth
conditions. Transcriptional regulation of
ccpA expression
may be a means of reaching this goal in
Staphylococcus
xylosus and
L. pentosus.
Genetic organization.
The finding that pepQ genes
are also located divergently from ccpA genes in other lactic
acid bacteria led us to compare the genetic organizations of all
published ccpA regions. As depicted in Fig.
5, the gene order pepQ-ccpA
(or pepQ-ccpA homologue) is found in all lactic acid
bacteria, namely L. pentosus, L. delbrueckii, L. casei, Streptococcus mutans, and
Lactococcus lactis (3, 37, 41; C. Esteban
and G. Pérez-Martínez, unpublished data, 1999). In
contrast, the sequences downstream of ccpA differ throughout the lactic acid bacteria. While there are no sequence similarities to
other known genes in L. pentosus, orf1 of
L. casei is homologous to genes encoding transposases of
IS30 family insertion elements (30). The genes
downstream of ccpA in Lactococcus lactis and Streptococcus mutans encode homologues of thioredoxin
reductase (accession no. AF106673) and -amylase, respectively
(38). Taken together, these findings indicate that
pepQ is always associated with ccpA or a
ccpA homologue in lactic acid bacteria.
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 5.
Comparison of ccpA regions of L. pentosus, L. delbrueckii subsp. lactis
(40, 41), L. casei (30; C. Esteban and G. Pérez-Martínez, unpublished data),
Streptococcus mutans (37), Lactococcus
lactis (accession no. AF106673) (3) (A); B. megaterium (15), B. subtilis (2, 11,
13) (B); and Staphylococcus xylosus (6)
(C). Orientations of genes are indicated by arrows. Potential
transcriptional termination structures (T) and cre motifs
are indicated.
|
|
Here, the questions of whether
pepQ is regulated by CcpA and
whether PepR1 and RegM are truly functional equivalents of CcpA
of
L. pentosus,
L. casei, and
Lactococcus
lactis arise. The contents
of CcpA-specific residues support this
assumption (Table
1).
While the involvement of CcpA in CCR is
apparently established
for
L. pentosus,
L. casei,
and
Lactococcus lactis, recent data
suggest that this is
also the case for PepR1 of
L. delbrueckii (
35).
In the case of
Streptococcus mutans, inactivation of
regM resulted in an opposite CCR phenotype; i.e., CCR was
enhanced
(
37). The picture concerning regulation of
pepQ by CcpA is not
clear. While a regulatory effect has
been described for
L. delbrueckii,
this was not the case in
Streptococcus mutans (
35,
37).
A very different gene arrangement is found in non-lactic acid
gram-positive bacteria. Upstream regions of
ccpA in
B. megaterium,
B. subtilis, and
Staphylococcus
xylosus comprising the
aroA gene,
whose product in
B. subtilis has been shown to possess chorismate
mutase
activity, are conserved (
2). In
B. megaterium and
B. subtilis, two ORFs are found downstream of
ccpA (
orf1 and
orf2 in
B. megaterium and
ytxD and
ytxE in
B. subtilis) that are homologous
to the
motA and
motB genes of
B. subtilis (
15). MotA
and MotB
are integral membrane proteins involved in flagellar movement
(
28). In
Staphylococcus xylosus, no
motA or
motB homologues
are linked to
ccpA; here
acuC is the gene downstream of
ccpA encoding
a protein involved in acetoin and butanediol
metabolism (
11).
The
acuC gene of
B. subtilis is located downstream of
ytxE, showing
that
the order of the genes in the
ccpA region of
B. subtilis is similar to that of
Staphylococcus xylosus.
The overall genetic context of
ccpA and the fact that in
most cases a terminator-like structure downstream of
ccpA is
predicted
suggest a monocistronic operon organization. This is
supported
by transcript size mapping of the
ccpA mRNAs of
L. casei and
L. pentosus (
22,
30).
However, in
L. pentosus, a second transcript,
of 10 kb, has
been detected (
22). While in RNA of glucose-grown
cells the
short transcript was the primary product, the 10-kb
transcript was
predominantly present in RNA of xylose-grown cells.
This suggests that
transcription of
ccpA and the genes downstream
might be
coordinately
regulated.
Conclusions.
Analysis of the ccpA region of
L. pentosus revealed the gene order
pepQ-ccpA-variable. This genetic organization is found in
all lactic acid bacteria described to date, which may indicate that the
ccpA genes of L. pentosus, L. casei,
and Lactococcus lactis, the pepR1 gene of
L. delbrueckii, and the regM gene of Streptococcus mutans are functional equivalents. The fact
that no common gene is linked to ccpA throughout the
low-G+C-content gram-positive bacteria indicates that none of the
flanking genes play a role in CCR. The reported data on the regulation
of ccpA in L. pentosus show that CcpA levels are
constant under different environmental conditions. This is a common
feature also found in L. casei, bacilli, and
Staphylococcus xylosus. Yet, the mechanisms of
ccpA transcription differ among these organisms. In L. pentosus, ccpA transcription is realized by a tandem
promoter, the more distant component of which is apparently subject to
autoregulation. Further studies are required to elucidate whether CcpA
of L. pentosus is involved in the regulation of other
catabolite-controlled genes; whether CcpA regulates pepQ,
thereby linking carbon utilization to proteolysis; and whether CcpA
triggers gene activation as well.
| |
ACKNOWLEDGMENTS |
We thank Elke Küster-Schöck for gifts of protein and
antibodies and for helpful discussions. We thank Peter Pouwels and Stephane Chaillou for gifts of L. pentosus strains and
plasmid pEI2 and for many suggestions and discussions. We are grateful to Joachim Schick, Carlos Esteban, and Gaspar
Pérez-Martínez for making data available prior to
publication. Stephan Parche is acknowledged for critical reading of the manuscript.
This work was financed by the EU project BIO4-CT96-0380.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Lehrstuhl
für Mikrobiologie, Friedrich-Alexander-Universität
Erlangen-Nürnberg, Staudtstrasse 5, D-91058 Erlangen, Germany.
Phone: 49-(0)9131-8528095. Fax: 49-(0)9131-8528082. E-mail:
ftitgem{at}biologie.uni-erlangen.de.
| |
REFERENCES |
| 1.
|
Behari, J., and P. Youngman.
1998.
A homolog of CcpA mediates catabolite control in Listeria monocytogenes but not carbon source regulation of virulence genes.
J. Bacteriol.
180:6316-6324[Abstract/Free Full Text].
|
| 2.
|
Bolotin, A.,
V. Khazak,
N. Stoynova,
K. Ratmanova,
Y. Yomantas, and Y. Kozlov.
1995.
Identical amino acid sequence of the aroA(G) gene products of Bacillus subtilis 168 and B. subtilis Marburg strain.
Microbiology
141:2219-2222[Abstract/Free Full Text].
|
| 3.
|
Bolotin, A.,
S. Mauger,
K. Malarme,
S. D. Ehrlich, and A. Sorokin.
1999.
Low-redundancy sequencing of the entire Lactococcus lactis IL1403 genome.
Antonie Leeuwenhoek
76:27-76[CrossRef][Medline].
|
| 4.
|
Davison, S. P.,
J. D. Santangelo,
S. J. Reid, and D. R. Woods.
1995.
A Clostridium acetobutylicum regulator gene (regA) affecting amylase production in Bacillus subtilis.
Microbiology
141:989-996[Abstract/Free Full Text].
|
| 5.
|
Deutscher, J.,
E. Küster,
U. Bergstedt,
V. Charrier, and W. Hillen.
1995.
Protein kinase-dependent HPr/CcpA interaction links glycolytic activity to carbon catabolite repression in gram-positive bacteria.
Mol. Microbiol.
15:1049-1053[Medline].
|
| 6.
|
Egeter, O., and R. Brückner.
1996.
Catabolite repression mediated by the catabolite control protein CcpA in Staphylococcus xylosus.
Mol. Microbiol.
21:739-749[CrossRef][Medline].
|
| 7.
|
Faires, N.,
S. Tobisch,
S. Bachem,
I. Martin-Verstraete,
M. Hecker, and J. Stülke.
1999.
The catabolite control protein CcpA controls ammonium assimilation in Bacillus subtilis.
J. Mol. Microbiol. Biotechnol.
1:141-148[Medline].
|
| 8.
|
Fujita, Y.,
Y. Miwa,
A. Galinier, and J. Deutscher.
1995.
Specific recognition of the Bacillus subtilis gnt cis-acting catabolite-responsive element by a protein complex formed between CcpA and seryl-phosphorylated HPr.
Mol. Microbiol.
17:953-960[CrossRef][Medline].
|
| 9.
|
Galinier, A.,
J. Haiech,
M.-C. Kilhofer,
M. Jaquinod,
J. Stülke,
J. Deutscher, and I. Martin-Verstraete.
1997.
The Bacillus subtilis crh gene encodes an HPr-like protein involved in carbon catabolite repression.
Proc. Natl. Acad. Sci. USA
94:8439-8444[Abstract/Free Full Text].
|
| 10.
|
Gösseringer, R.,
E. Küster,
A. Galinier,
J. Deutscher, and W. Hillen.
1997.
Cooperative and non-cooperative DNA binding modes of catabolite control protein CcpA from Bacillus megaterium result from sensing two different signals.
J. Mol. Biol.
266:665-676[CrossRef][Medline].
|
| 11.
|
Grundy, F. J.,
D. A. Waters,
T. Y. Takova, and T. M. Henkin.
1993.
Identification of genes involved in utilization of acetate and acetoin in Bacillus subtilis.
Mol. Microbiol.
10:259-271[Medline].
|
| 12.
|
Helmann, J. D.
1995.
Compilation and analysis of Bacillus subtilis A-dependent promoter sequences: evidence for extended contact between RNA polymerase and upstream promoter DNA.
Nucleic Acids Res.
23:2351-2360[Abstract/Free Full Text].
|
| 13.
|
Henkin, T. M.,
F. J. Grundy,
W. L. Nicholson, and G. H. Chambliss.
1991.
Catabolite repression of -amylase gene expression in Bacillus subtilis involves a trans-acting gene product homologous to the Escherichia coli lacI and galR repressors.
Mol. Microbiol.
5:575-584[CrossRef][Medline].
|
| 14.
|
Hueck, C. J., and W. Hillen.
1995.
Catabolite repression in Bacillus subtilis: a global regulatory mechanism for the gram-positive bacteria?
Mol. Microbiol.
15:395-401[Medline].
|
| 15.
|
Hueck, C. J.,
A. Kraus, and W. Hillen.
1994.
Sequences of ccpA and two downstream Bacillus megaterium genes with homology to the motAB operon from Bacillus subtilis.
Gene
143:147-148[CrossRef][Medline].
|
| 16.
|
Hueck, C. J.,
A. Kraus,
D. Schmiedel, and W. Hillen.
1995.
Cloning, expression and functional analyses of the catabolite control protein CcpA from Bacillus megaterium.
Mol. Microbiol.
16:855-864[CrossRef][Medline].
|
| 17.
|
Jongeneel, C. V.,
J. Bouvier, and A. Bairoch.
1989.
A unique signature identifies a family of zinc-dependent metallopeptidases.
FEBS Lett.
242:211-214[CrossRef][Medline].
|
| 18.
|
Kraus, A.,
E. Küster,
A. Wagner,
K. Hoffmann, and W. Hillen.
1998.
Identification of a co-repressor binding site in catabolite control protein CcpA.
Mol. Microbiol.
30:955-963[CrossRef][Medline].
|
| 19.
|
Kravanja, M.,
R. Engelmann,
V. Dossonnet,
M. Bluggel,
H. E. Meyer,
R. Frank,
A. Galinier,
J. Deutscher,
N. Schnell, and W. Hengstenberg.
1999.
The hprK gene of Enterococcus faecalis encodes a novel bifunctional enzyme: the HPr kinase/phosphatase.
Mol. Microbiol.
31:59-66[CrossRef][Medline].
|
| 20.
|
Küster, E.,
T. Hilbich,
M. K. Dahl, and W. Hillen.
1999.
Mutations in catabolite control protein CcpA separating growth effects from catabolite repression.
J. Bacteriol.
181:4125-4128[Abstract/Free Full Text].
|
| 21.
|
Küster, E.,
E. J. Luesink,
W. M. de Vos, and W. Hillen.
1996.
Immunological crossreactivity to catabolite control protein CcpA from Bacillus megaterium is found in many gram-positive bacteria.
FEMS Microbiol. Lett.
139:109-115[Medline].
|
| 22.
|
Lokman, B. C.,
M. Heerikhuisen,
R. J. Leer,
A. van den Broek,
Y. Borsboom,
S. Chaillou,
P. W. Postma, and P. H. Pouwels.
1997.
Regulation of expression of the Lactobacillus pentosus xylAB operon.
J. Bacteriol.
179:5391-5397[Abstract/Free Full Text].
|
| 23.
|
Lokman, B. C.,
R. J. Leer,
R. van Sorge, and P. H. Pouwels.
1994.
Promoter analysis and transcriptional regulation of Lactobacillus pentosus genes involved in xylose catabolism.
Mol. Gen. Genet.
245:117-125[CrossRef][Medline].
|
| 24.
|
Lokman, B. C.,
P. van Santen,
J. C. Verdoes,
J. Kruse,
R. J. Leer,
M. Posno, and P. H. Pouwels.
1991.
Organization and characterization of three genes involved in D-xylose catabolism in Lactobacillus pentosus.
Mol. Gen. Genet.
230:161-169[CrossRef][Medline].
|
| 25.
|
Luesink, E. J.,
C. M. A. Beumer,
O. P. Kuipers, and W. M. De Vos.
1999.
Molecular characterization of the Lactococcus lactis ptsHI operon and analysis of the regulatory role of HPr.
J. Bacteriol.
181:764-771[Abstract/Free Full Text].
|
| 26.
|
Luesink, E. J.,
R. E. van Herpen,
B. P. Grossiord,
O. P. Kuipers, and W. M. de Vos.
1998.
Transcriptional activation of the glycolytic las operon and catabolite repression of the gal operon in Lactococcus lactis are mediated by the catabolite control protein CcpA.
Mol. Microbiol.
30:789-798[CrossRef][Medline].
|
| 27.
|
Martinez, E.,
B. Bartolome, and F. de la Cruz.
1988.
pACYC184-derived cloning vectors containing the multiple cloning site and lacZ alpha reporter gene of pUC8/9 and pUC18/19 plasmids.
Gene
68:159-162[CrossRef][Medline].
|
| 28.
|
Mirel, D. B.,
V. M. Lustre, and M. J. Chamberlin.
1992.
An operon of Bacillus subtilis motility genes transcribed by the D form of RNA polymerase.
J. Bacteriol.
174:4197-4204[Abstract/Free Full Text].
|
| 29.
|
Miwa, Y.,
M. Saikawa, and Y. Fujita.
1994.
Possible function and some properties of the CcpA protein of Bacillus subtilis.
Microbiology
140:2567-2575[Abstract/Free Full Text].
|
| 30.
|
Monedero, V.,
M. J. Gosalbes, and G. Pérez-Martínez.
1997.
Catabolite repression in Lactobacillus casei ATCC 393 is mediated by CcpA.
J. Bacteriol.
179:6657-6664[Abstract/Free Full Text].
|
| 31.
|
Morel, F.,
J. Frot-Coutaz,
D. Aubel,
R. Portalier, and D. Atlan.
1999.
Characterization of a prolidase from Lactobacillus delbrueckii subsp. bulgaricus CNRZ 397 with an unusual regulation of biosynthesis.
Microbiology
145:437-446[Abstract/Free Full Text].
|
| 32.
|
Reizer, J.,
C. Hoischen,
F. Titgemeyer,
C. Rivolta,
R. Rabus,
J. Stülke,
D. Karamata,
M. H. J. Saier, and W. Hillen.
1998.
A novel protein kinase that controls carbon catabolite repression in bacteria.
Mol. Microbiol.
27:1157-1169[CrossRef][Medline].
|
| 33.
|
Renna, M. C.,
N. Najimudin,
L. R. Winik, and S. A. Zahler.
1993.
Regulation of the Bacillus subtilis alsS, alsD, and alsR genes involved in post-exponential-phase production of acetoin.
J. Bacteriol.
175:3863-3875[Abstract/Free Full Text].
|
| 34.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 35.
|
Schick, J.,
B. Weber,
J. R. Klein, and B. Henrich.
1999.
PepR1, a CcpA-like transcription regulator of Lactobacillus delbrückii ssp. lactis.
Microbiology
145:3147-3154[Abstract/Free Full Text].
|
| 36.
|
Shin, B. S.,
S. K. Choi, and S. H. Park.
1999.
Regulation of the Bacillus subtilis phosphotransacetylase gene.
J. Biochem. (Tokyo)
126:333-339[Abstract/Free Full Text].
|
| 37.
|
Simpson, C. L., and R. R. B. Russell.
1998.
Identification of a homolog of CcpA catabolite repressor protein in Streptococcus mutans.
Infect. Immun.
66:2085-2092[Abstract/Free Full Text].
|
| 38.
|
Simpson, C. L., and R. R. B. Russell.
1998.
Intracellular -amylase of Streptococcus mutans.
J. Bacteriol.
180:4711-4717[Abstract/Free Full Text].
|
| 39.
|
Strohl, W. R.
1992.
Compilation and analysis of DNA sequences associated with apparent streptomycete promoters.
Nucleic Acids Res.
20:961-974[Abstract/Free Full Text].
|
| 40.
|
Stucky, K.,
J. R. Klein,
A. Schuller,
H. Matern,
B. Henrich, and R. Plapp.
1995.
Cloning and DNA sequence analysis of pepQ, a prolidase gene from Lactobacillus delbrueckii subsp. lactis DSM7290, and partial characterization of its product.
Mol. Gen. Genet.
247:494-500[CrossRef][Medline].
|
| 41.
|
Stucky, K.,
J. Schick,
J. Klein,
B. Henrich, and R. Plapp.
1996.
Characterization of pepR1, a gene coding for a potential transcriptional regulator of Lactobacillus delbrueckii subsp. lactis DSM7290.
FEMS Microbiol. Lett.
136:63-69[CrossRef][Medline].
|
| 42.
|
Stülke, J., and W. Hillen.
1999.
Carbon catabolite repression in bacteria.
Curr. Opin. Microbiol.
2:195-201[CrossRef][Medline].
|
| 43.
|
Weickert, M. J., and S. Adhya.
1992.
A family of bacterial regulators homologous to Gal and Lac repressors.
J. Biol. Chem.
267:15869-15874[Abstract/Free Full Text].
|
Applied and Environmental Microbiology, January 2000, p. 277-283, Vol. 66, No. 1
0099-2240/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kim, J.-H., Shoemaker, S. P., Mills, D. A.
(2009). Relaxed control of sugar utilization in Lactobacillus brevis. Microbiology
155: 1351-1359
[Abstract]
[Full Text]
-
Brinkrolf, K., Ploger, S., Solle, S., Brune, I., Nentwich, S. S., Huser, A. T., Kalinowski, J., Puhler, A., Tauch, A.
(2008). The LacI/GalR family transcriptional regulator UriR negatively controls uridine utilization of Corynebacterium glutamicum by binding to catabolite-responsive element (cre)-like sequences. Microbiology
154: 1068-1081
[Abstract]
[Full Text]
-
Almengor, A. C., Kinkel, T. L., Day, S. J., McIver, K. S.
(2007). The Catabolite Control Protein CcpA Binds to Pmga and Influences Expression of the Virulence Regulator Mga in the Group A Streptococcus. J. Bacteriol.
189: 8405-8416
[Abstract]
[Full Text]
-
Zomer, A. L., Buist, G., Larsen, R., Kok, J., Kuipers, O. P.
(2007). Time-Resolved Determination of the CcpA Regulon of Lactococcus lactis subsp. cremoris MG1363. J. Bacteriol.
189: 1366-1381
[Abstract]
[Full Text]
-
Deutscher, J., Francke, C., Postma, P. W.
(2006). How Phosphotransferase System-Related Protein Phosphorylation Regulates Carbohydrate Metabolism in Bacteria. Microbiol. Mol. Biol. Rev.
70: 939-1031
[Abstract]
[Full Text]
-
Barrangou, R., Azcarate-Peril, M. A., Duong, T., Conners, S. B., Kelly, R. M., Klaenhammer, T. R.
(2006). Global analysis of carbohydrate utilization by Lactobacillus acidophilus using cDNA microarrays. Proc. Natl. Acad. Sci. USA
103: 3816-3821
[Abstract]
[Full Text]
-
Iyer, R., Baliga, N. S., Camilli, A.
(2005). Catabolite Control Protein A (CcpA) Contributes to Virulence and Regulation of Sugar Metabolism in Streptococcus pneumoniae. J. Bacteriol.
187: 8340-8349
[Abstract]
[Full Text]
-
Asanuma, N., Yoshii, T., Hino, T.
(2004). Molecular Characterization of CcpA and Involvement of This Protein in Transcriptional Regulation of Lactate Dehydrogenase and Pyruvate Formate-Lyase in the Ruminal Bacterium Streptococcus bovis. Appl. Environ. Microbiol.
70: 5244-5251
[Abstract]
[Full Text]
-
Duche, O., Tremoulet, F., Glaser, P., Labadie, J.
(2002). Salt Stress Proteins Induced in Listeria monocytogenes. Appl. Environ. Microbiol.
68: 1491-1498
[Abstract]
[Full Text]
-
Wen, Z. T., Burne, R. A.
(2002). Analysis of cis- and trans-Acting Factors Involved in Regulation of the Streptococcus mutans Fructanase Gene (fruA). J. Bacteriol.
184: 126-133
[Abstract]
[Full Text]
-
Muscariello, L., Marasco, R., De Felice, M., Sacco, M.
(2001). The Functional ccpA Gene Is Required for Carbon Catabolite Repression in Lactobacillus plantarum. Appl. Environ. Microbiol.
67: 2903-2907
[Abstract]
[Full Text]
-
Rogers, J. D., Scannapieco, F. A.
(2001). RegG, a CcpA Homolog, Participates in Regulation of Amylase-Binding Protein A Gene (abpA) Expression in Streptococcus gordonii. J. Bacteriol.
183: 3521-3525
[Abstract]
[Full Text]
-
van den Bogaard, P. T. C., Kleerebezem, M., Kuipers, O. P., de Vos, W. M.
(2000). Control of Lactose Transport, beta -Galactosidase Activity, and Glycolysis by CcpA in Streptococcus thermophilus: Evidence for Carbon Catabolite Repression by a Non-Phosphoenolpyruvate-Dependent Phosphotransferase System Sugar. J. Bacteriol.
182: 5982-5989
[Abstract]
[Full Text]
Top
Abstract
Introduction
