Previous Article | Next Article 
Applied and Environmental Microbiology, October 2000, p. 4356-4360, Vol. 66, No. 10
0099-2240/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
PCR Primers That Amplify Fungal rRNA Genes from
Environmental Samples
James
Borneman* and
R. Jack
Hartin
Department of Plant Pathology, University of
California, Riverside, California 92521
Received 28 March 2000/Accepted 9 July 2000
 |
ABSTRACT |
Two PCR primer pairs were designed to amplify rRNA genes (rDNA)
from all four major phyla of fungi: Ascomycota,
Basidiomycota, Chytridomycota, and
Zygomycota. PCRs performed with these primers showed that
both pairs amplify DNA from organisms representing the major taxonomic
groups of fungi but not from nonfungal sources. To test the ability of
the primers to amplify fungal rDNA from environment samples, clone
libraries from two avocado grove soils were constructed and analyzed.
These soils possess different abilities to inhibit avocado root rot
caused by Phythophthora cinnamomi. Analysis of the two rDNA
clone libraries revealed differences in the two fungal communities. It
also revealed a markedly different depiction of the soil fungal
community than that generated by a culture-based analysis, confirming
the value of rDNA-based approaches for identifying organisms that may
not readily grow on agar media. Additional evidence of the usefulness
of the primers was obtained by identifying fungi associated with
avocado leaves. In both the soil and leaf analyses, no nonfungal rDNA
sequences were identified, illustrating the selectivity of these PCR
primers. This work demonstrates the ability of two newly developed PCR
primer sets to amplify fungal rDNA from soil and plant tissue, thereby
providing unique tools to examine this vast and mostly undescribed
community of organisms.
 |
INTRODUCTION |
Fungi play complex and diverse roles
in ecosystems and human society. They comprise the majority of the
biomass in soil, decompose organic material, provide nutrients to
plants, and act as indicators of ecosystem health (2, 7). In
agriculture, fungi can both devastate crop yields and provide a means
to control plant pests, including other fungi (29). In
humans, fungi can cause a range of conditions from psoriasis to
meningitis. They have also proven to be effective curative agents; for
example, Saccharomyces boulardii can prevent
Clostridium difficile toxicity and other intestinal disturbances caused by antibiotic usage (6). In the
biotechnology arena, fungi produce numerous secondary metabolites that
have valuable pharmaceutical properties (24). Their
importance to this industry and other bioprospecting endeavors is
enhanced by the vast diversity of extant fungi (10).
Although considerable knowledge about fungi has been amassed, most of
these organisms remain uncharacterized. Estimates suggest that there
are 1.5 million species of fungi on Earth; however, only approximately
70,000 species have been described, leaving 95% of the species
undescribed (16). The reasons for this deficiency include
habitats that have not been well investigated, organisms that are
difficult to culture axenically, such as obligately associated fungi,
and inaccurate identification of catalogued samples (16). Strategies used to rectify this deficit should include the use of
comparative sequence analysis of rRNA and rRNA genes (rDNA), which has
led to the discovery of many new bacterial and archaeal phylotypes in
environments such as Yellowstone hot springs, soil, and rock (3,
22).
Several PCR primers that amplify fungal rDNA from a wide range of
taxonomic groups have been described (31), but few of these
were designed for use with environmental samples. Such a tool must have
high specificity, as fungal DNA may be rare compared to DNA from other
sources, such as bacteria, plants, or other eukaryotes (14).
The ITS1-F and ITS4-B primers have been used to amplify basidiomycete
ITS1, ITS2, and 5.8S rDNA sequences from plant tissues containing fungi
(12). Similarly, the VANS1 primer has been used in
combination with other primers to amplify rDNA from
vesicular-arbuscular endomycorrhizal fungi (27). To identify disease-causing fungi, PCR primers have been designed to specifically amplify both human (4, 18, 21) and plant (17)
pathogens. In addition, three PCR primer pairs described by Smit et al.
were recently used to amplify fungal rDNA from wheat rhizosphere
samples (28). In this report, we describe two new PCR primer
pairs designed to amplify rDNA from all major taxonomic groups of
fungi, and in this study we demonstrated the use of these primer pairs
by examining the fungal communities of two avocado grove soils.
 |
MATERIALS AND METHODS |
Primer design.
A total of 213 fungal small-subunit rDNA
sequences of representatives of all major phylogenetic groups were
obtained from GenBank (National Center for Biotechnology Information
[NCBI]) and were aligned with PILEUP (Genetics Computer Group,
Madison, Wis.). Conserved sequences within this group were identified
with PRETTY (Genetics Computer Group). The specificity of these
sequences was examined by comparison to the nonredundant nucleotide
database at GenBank by using BLAST (NCBI). The PCR primers identified
through this process were nu-SSU-0817-5'
(TTAGCATGGAATAATRRAATAGGA), nu-SSU-1196-3' (TCTGGACCTGGTGAGTTTCC), and nu-SSU-1536-3' (ATTGCAATGCYCTATCCCCA).
DNA extraction.
DNA were extracted from pure cultures of
fungi, dried fungal samples, and avocado leaves by using a FastDNA Kit
as described by the manufacturer (Bio 101, Vista, Calif.). DNA were
extracted from two avocado grove soils, collected at the Vanoni and
Powell ranches, by using a FastDNA Kit for Soil as described by the
manufacturer (Bio 101) (5). DNA that were not amplified in
PCRs containing universal rDNA primers 530F (GTGCCAGCMGCCGCGG)
and 1392R (ACGGGCGGTGTGTRC) (19) were
further purified by electrophoresis on 1% agarose gels and isolated
with a QIAquick gel extraction kit (Qiagen, Valencia, Calif.).
PCR parameters.
DNA from fungi and other sources were
amplified in 10-µl PCR mixtures containing the following final
concentrations or total amounts: 3 to 8 ng of DNA, 50 mM Tris (pH 8.3),
500 µg of bovine serum albumin per ml, 2.5 mM MgCl2, each
deoxynucleoside triphosphate at a concentration of 250 µM, 400 nM
forward primer nu-SSU-0817-5', 400 nM reverse primer nu-SSU-1196-3' or
nu-SSU-1536-3', and 0.5 U of Taq DNA polymerase. All
reagents were combined and heated at 94°C for 2 min. Thirty-five
cycles of PCR were then performed by using 94°C for 0 s, 56°C
for 10 s, and 72°C for 30 s, followed by 72°C for 2 min.
PCRs were performed in glass capillary tubes with a model 1002 Rapidcycler (Idaho Technologies, Idaho Falls, Idaho). PCRs which used
primers EF4 and EF3, primers EF4 and fung5, and primers EF4 and NS3
were performed as previously described by Smit et al. (28)
by using both an MJ Research PTC-200 thermocycler and an Idaho
Technologies model 1002 Rapidcycler.
Small-subunit rDNA clone library construction.
DNAs isolated
from soil and avocado leaves were amplified by PCR as described above.
rDNA libraries were produced by gel isolating the amplified genes,
ligating them into the pGEM-T vector (Promega, Madison, Wis.), and
transforming the plasmids into competent JM109 cells. Bacterial
colonies containing plasmids with rDNA inserts were identified by
-complementation (26).
Analysis of rDNA clone libraries.
Plasmid DNA were isolated
from randomly selected rDNA clones. To sort the clones into groups or
operational taxonomic units (OTUs), the rDNA inserts were amplified by
PCR, digested individually with several DNA restriction endonuclease
treatments (HpaI, MseI, ApaI-SacI, and RsaI), and resolved on
2% agarose gels. Approximately 430 bases of nucleotide sequence were
obtained from one representative clone of each OTU. Similarities of the
rDNA clones to sequences in the GenBank database were determined by
using BLAST (NCBI) and Gap (Genetics Computer Group).
Nucleotide sequence accession numbers.
rDNA sequences AL10,
AL15, AL3, JK1-1, JK1-14, and JK1-16 have been deposited in the GenBank
database under accession no. AF183384, AF183386, AF183388,
AF247743, AF247744, and AF247745, respectively. rDNA sequences
JK2-2, JK2-4, JK2-9, JK2-17, JK2-22, JK3-21, JK3-25, JK3-30, JK3-18,
JKX-3, and JK3-26 have been deposited in the GenBank database under
accession no. AF246619 through AF246629, respectively.
 |
RESULTS AND DISCUSSION |
Two PCR primer pairs were designed to amplify rDNA from all four
major phyla of fungi: Ascomycota, Basidiomycota,
Chytridomycota, and Zygomycota. The
primers were named nu-SSU-0817-5', nu-SSU-1196-3', and nu-SSU-1536-3'
by using the nomenclature convention described by Gargas and DePriest
(13). nu-SSU-0817-5' and nu-SSU-1196-3' amplify a
422-bp region of the Saccharomyces cereviseae
small-subunit rDNA molecule (GenBank accession no. J01353) and contain
the V4 (partial) and V5 variable regions (Fig.
1) (30). nu-SSU-0817-5' and
nu-SSU-1536-3' amplify a 762-bp region and contain the V4 (partial),
V5, V7, and V8 (partial) variable regions (Fig. 1).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 1.
Diagram of the eukaryotic small-subunit rDNA with the
variable regions highlighted in gray. The numerical positions of the
primers and the PCR product sizes were obtained by using S. cereviseae (GenBank accession no. J01353) as the reference
template.
|
|
Both primer pairs show strong specificity for fungal rDNA sequences.
Using BLAST (NCBI), the percentages of identical matches of
nu-SSU-0817-5', nu-SSU-1196-3', and nu-SSU-1536-3' with fungal rDNA
sequences in the GenBank database (NCBI) were determined to be 83, 85, and 99.8%, respectively (Table 1). PCRs
with these primers showed that both pairs amplify DNA from
representatives of all major taxonomic groups of fungi but not from
representative nonfungal groups, including the oomycete
Phytophthora infestans (Fig. 2
and Table 2). These results were obtained
when annealing temperatures ranging from 50 to 58°C and from 52 to
58°C were used with the nu-SSU-0817-5'-nu-SSU-1196-3' and
nu-SSU-0817-5'-nu-SSU-1536-3' primer pairs, respectively
(data not shown). Similar results were obtained with two
different thermocyclers (data not shown).

View larger version (120K):
[in this window]
[in a new window]
|
FIG. 2.
PCR amplification of representative DNA templates with
five different fungal rDNA primer sets. PCR products were resolved on
agarose gels and stained with ethidium bromide. (A) Primers
nu-SSU-0817-5' and nu-SSU-1196-3'; (B) primers nu-SSU-0817-5' and
nu-SSU-1536-3'; (C) primers EF4 and EF3; (D) primers EF4 and NS3; (E)
primers EF4 and fung5. Lane 1, 1-kb ladder (Gibco BRL, Grand Island,
N.Y.); lane 2, Monilinia fructicola; lane 3, Tilletia
caries; lane 4, Allomyces javanicus; lane 5, Glomus deserticola; lane 6, Escherichia coli;
lane 7, Caenorhabditis elegans; lane 8, Cucumis
melo; lane 9, Phytophthora infestans. The larger sizes
of the M. fructicola bands (lane 2) are likely due to intron
insertion. The results of these experiments and a more extensive
analysis are summarized in Table 2.
|
|
To examine the ability of these primers to selectively amplify fungal
rDNA from environmental samples, the fungal communities of two avocado
grove soils were analyzed by performing PCRs with mixtures containing
nu-SSU-0817-5' and nu-SSU-1536-3' (Fig.
3). The Vanoni soil possesses the ability
to inhibit avocado root rot caused by Phytophthora cinnamomi
and is therefore considered a disease-suppressive soil. Conversely, the
Powell soil is classified as a disease-conducive soil because it does
not inhibit avocado root rot. Numerous suppressive soils have been
described, many of which possess biological components that may
contribute to this phenomenon (8). In the past,
identification of these components has been challenging because the
majority of microorganisms do not readily grow on agar media
(1), which leads to analyses that may not accurately reflect
the true fungal community in a soil. Alternative approaches that avoid
this culture bias include analysis of rRNA genes isolated from soil. In
this study, we examined two avocado grove soils by sorting 62 fungal
rDNA clones into 10 different clone types or OTUs, 4 of which were
found only in the suppressive soil (Table
3). In addition, the dominant genera in
the Vanoni soil identified by the rDNA analysis
(Tritirachium, Aspergillus, Pleospora,
Petriella, Monilinia, and Exophiala)
(Table 3) were markedly different from those identified by a
traditional culture-based approach (Aspergillus,
Penicillium, Sporothrix, Phoma,
Trichoderma, and Fusarium) (9). While
PCR can also introduce errors (11, 20, 25), these results
show the potential of the rDNA-based approach for biological control
research as this approach revealed a very different depiction of the
soil fungal community than that provided by the culture-based analysis.
Future strategies to obtain biological control organisms could include culture-independent rDNA analysis followed by isolation of specific organisms on selective media.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 3.
PCR amplification of DNA extracted from two soils with
five different fungal rDNA primer pairs. PCR products were resolved on
agarose gels and stained with ethidium bromide. Lane 1, primers EF4 and
EF3; lane 2, primers EF4 and fung5; lane 3, primers EF4 and NS3; lane
4, primers nu-SSU-0817-5' and nu-SSU-1196-3'; lanes 5 and 6, primers
nu-SSU-0817-5' and nu-SSU-1536-3'; lanes 1 through 5, Vanoni soil DNA;
lane 6, Powell soil DNA; lane 7, 1-kb ladder (Gibco BRL).
|
|
To test the primers further, nu-SSU-0817-5' and nu-SSU-1536-3' were
used to examine fungi associated with avocado leaves. After epidemics
of P. cinnamomi moved through several southern California
avocado groves, the soils were determined to be more disease
suppressive and were also covered with avocado leaves coated with fungi
(unpublished observations). To identify these fungi, three randomly
selected clones were analyzed, all of whose rDNA sequences showed
similarity to previously described fungal rDNA sequences. Specifically,
clones AL3, AL10, and AL15 showed similarity to Panellus
serotinus (96%), Arthrobotrys dactyloides (98%), and
Monilinia fructicola (99%), respectively. To test the nu-SSU-0817-5'-nu-SSU-1196-3' primer pair, an rDNA clone library from
the aforementioned Vanoni soil DNA was constructed. Three randomly
selected clones from this library, JK1-1, JK1-14, and JK1-16, were
analyzed and shown to have similarity to Fusarium oxysporum
(98%), Echinosporangium transversale (98%), and
Pseudallescheria ellipsoidea (100%), respectively. In these
analyses and the other rDNA analyses performed with the primers
developed in this study, no nonfungal rDNA sequences were
identified, demonstrating the selectivity of these newly developed tools.
To compare our PCR primers with others designed for similar purposes,
we also examined three recently developed fungal rDNA primer
pairs described by Smit et al. (28). In our laboratory, two
of these pairs (primers EF4 and EF3 and primers EF4 and fung5) amplified most of our fungal templates and some of our nonfungal templates (Fig. 2 and Table 2). The third primer pair, primers EF4 and
NS3, produced no amplification products with any of the templates
except Amoebidium parasiticum and Mucor rouxii
(Fig. 2 and Table 2). For all three of these primer pairs, similar results were obtained with two different thermocyclers (data not shown). Except for the inability of primers EF4 and NS3 to amplify most
of the fungal rDNA templates, these results were similar to those
described by Smit et al. (28). To test the ability of these
primers to amplify fungal rDNA from environmental samples, the primers
were used in PCRs with DNA extracted from soil (Fig. 3). The resulting
PCR products were then gel isolated and cloned. For the EF4-fung5
primer pair, 30 clones were sorted into three OTUs. A nucleotide
sequence analysis of one representative clone from each OTU identified
two sequences that do not have significant similarity to any rDNA or
other database sequence and one sequence (JKX-3) that is similar to the
fungus Opegrapha varia sequence (92%). For the EF4-NS3
primer pair, 29 clones were sorted into six OTUs. A nucleotide sequence
analysis of these clones identified six sequences that do not have
significant similarity to any rDNA or other database sequence. For the
EF4-EF3 primer pair, a band of the correct size was not obtained and
therefore there was no further analysis. These results show the
variability that can occur with PCR-based techniques, as our soil
analysis produced results that were significantly different from those
obtained in a wheat rhizosphere analysis in which the same primers were used (28). They also reinforce the idea that PCR-based
community structure studies should include some nucleotide sequence
analysis as the resulting amplification products may not always be
comprised of the intended DNA.
The results described in this report provide evidence that PCR primers
nu-SSU-0817-5', nu-SSU-1196-3', and nu-SSU-1536-3' will be useful tools
for identifying fungi in environmental samples, such as soil and plant
tissues. In addition, the primer sequences will likely be useful in the
construction of fungal rDNA libraries from other environmental samples,
for denaturation gradient gel electrophoresis analysis, or as
fungus-specific hybridization probes. Fungi play important roles in
agriculture, medicine, and ecosystems and are also considered critical
components of human civilization and evolution (15). Indeed,
fungi may have been essential in the evolution of land plants (15,
23). The scope of their functional roles and the extent of their
diversity have yet to be understood, as most fungi remain undescribed
(16). The PCR primers described in this report provide
unique tools to further characterize this important group of organisms.
 |
ACKNOWLEDGMENTS |
We thank James Adaskaveg, Salomon Bartnicki-Garcia, Howard
Judelson, John Menge, Elinor Pond, Sam Roberts, Karl Steddom, John Taylor, and Barbara Waaland for kindly providing tissue or DNA samples
for this study.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Plant Pathology, University of California, Riverside, CA 92521. Phone: (909) 787-3584. Fax: (909) 787-4294. E-mail:
borneman{at}ucrac1.ucr.edu.
 |
REFERENCES |
| 1.
|
Amann, R. I.,
W. Ludwig, and K.-H. Schleifer.
1995.
Phylogenetic identification and in situ detection of individual microbial cells without cultivation.
Microbiol. Rev.
59:143-169[Abstract/Free Full Text].
|
| 2.
|
Apinis, A. E.
1972.
Facts and problems.
Mycopathol. Mycol. Appl.
48:93-109[CrossRef][Medline].
|
| 3.
|
Barns, S. M.,
R. E. Fundyga,
M. W. Jeffries, and N. R. Pace.
1994.
Remarkable archaeal diversity detected in a Yellowstone National Park hot spring environment.
Proc. Natl. Acad. Sci. USA
91:1609-1613[Abstract/Free Full Text].
|
| 4.
|
Bock, M.,
M. Maiwald,
R. Kappe,
P. Nickel, and H. Naeher.
1994.
Polymerase chain reaction-based detection of dermatophyte DNA with a fungus-specific primer system.
Mycoses
37:79-84[Medline].
|
| 5.
|
Borneman, J.,
P. W. Skroch,
K. M. O'Sullivan,
J. A. Palus,
N. G. Rumjanek,
J. L. Jansen,
J. Nienhuis, and E. W. Triplett.
1996.
Molecular microbial diversity of an agricultural soil in Wisconsin.
Appl. Environ. Microbiol.
62:1935-1943[Abstract].
|
| 6.
|
Buts, J. P.,
P. Bernasconi,
J. P. Vaerman, and C. Dive.
1990.
Stimulation of secretory IgA and secretory component of immunoglobulins in small intestine of rats treated with Saccharomyces boulardii.
Dig. Dis. Sci.
35:251-256[CrossRef][Medline].
|
| 7.
|
Carroll, G. C., and D. T. Wicklow.
1992.
The fungal community: its organization and role in the ecosystem, 2nd ed.
M. Dekker, New York, N.Y.
|
| 8.
|
Cook, R. J., and K. F. Baker.
1983.
The nature and practice of biological control of plant pathogens.
APS Press, St. Paul, Minn.
|
| 9.
|
Downer, A. J.
1998.
Ph.D. thesis.
University of California, Riverside.
|
| 10.
|
Dreyfuss, M. M., and I. H. Chapela.
1994.
Potential of fungi in the discovery of novel, low-molecular weight pharmaceuticals, p. 49-80.
In
V. P. Gullo (ed.), Biotechnology series, vol. 26. The discovery of natural products with therapeutic potential. Butterworth-Heinemann, Newton, Mass.
|
| 11.
|
Farrelly, V.,
F. A. Rainey, and E. Stackebrandt.
1995.
Effect of genome size and rrn gene copy number on PCR amplification of 16S rRNA genes from a mixture of bacterial species.
Appl. Environ. Microbiol.
61:2798-2801[Abstract].
|
| 12.
|
Gardes, M., and T. D. Bruns.
1993.
ITS primers with enhanced specificity for basidiomycetes application to the identification of mycorrhizae and rusts.
Mol. Ecol.
2:113-118[Medline].
|
| 13.
|
Gargas, A., and P. T. DePriest.
1996.
A nomenclature for fungal PCR primers with examples from intron-containing SSU rDNA.
Mycologia
88:745-748[CrossRef].
|
| 14.
|
Harris, D.
1994.
Analyses of DNA extracted from microbial communities, p. 111-118.
In
K. Ritz, J. Dighton, and K. E. Giller (ed.), Beyond the biomass. John Wiley & Sons, Chichester, United Kingdom.
|
| 15.
|
Hawksworth, D. L.
1991.
The fungal dimension of biodiversity: magnitude, significance, and conservation.
Mycol. Res.
95:641-655[CrossRef].
|
| 16.
|
Hawksworth, D. L., and A. Y. Rossman.
1997.
Where are all the undescribed fungi?
Phytopathology
87:888-891[CrossRef][Medline].
|
| 17.
|
Henson, J. M., and R. French.
1993.
The polymerase chain reaction and plant disease diagnosis.
Annu. Rev. Phytopathol.
31:81-109[CrossRef][Medline].
|
| 18.
|
Kappe, R.,
C. Fauser,
C. N. Okeke, and M. Maiwald.
1996.
Universal fungus-specific primer systems and group-specific hybridization oligonucleotides for 18S rDNA.
Mycoses
39:25-30[Medline].
|
| 19.
|
Lane, D. J.
1991.
16S/23S rRNA sequencing, p. 115-175.
In
E. Stackebrandt, and M. Goodfellow (ed.), Nucleic acid techniques in bacterial systematics. Wiley, New York, N.Y.
|
| 20.
|
Liesack, W.,
H. Weyland, and E. Stackebrandt.
1991.
Potential risks of gene amplification by PCR as determined by 16S rDNA analysis of a mixed-culture of strict barophilic bacteria.
Microb. Ecol.
21:191-198[CrossRef].
|
| 21.
|
Makimura, K.,
S. Y. Murayama, and H. Yamaguchi.
1994.
Detection of a wide range of medically important fungi by the polymerase chain reaction.
J. Med. Microbiol.
40:358-364[Abstract/Free Full Text].
|
| 22.
|
Pace, N. R.
1997.
A molecular view of microbial diversity and the biosphere.
Science
276:734-740[Abstract/Free Full Text].
|
| 23.
|
Pirozynski, K. A., and D. W. Malloch.
1975.
The origin of land plants: a matter of mycotrophism.
BioSystems
6:153-164[CrossRef][Medline].
|
| 24.
|
Porter, N., and F. M. Fox.
1993.
Diversity of microbial products: discovery and application.
Pestic. Sci.
39:161-168[CrossRef].
|
| 25.
|
Reysenbach, A.-L.,
L. J. Giver,
G. S. Wickham, and N. R. Pace.
1992.
Differential amplification of rRNA genes by polymerase chain reaction.
Appl. Environ. Microbiol.
58:3417-3418[Abstract/Free Full Text].
|
| 26.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 27.
|
Simon, L.,
M. Lalonde, and T. D. Bruns.
1992.
Specific amplification of 18S fungal ribosomal genes from vesicular-arbuscular endomycorrhizal fungi colonizing roots.
Appl. Environ. Microbiol.
58:291-295[Abstract/Free Full Text].
|
| 28.
|
Smit, E.,
P. Leeflang,
B. Glandorf,
J. D. van Elsas, and K. Wernars.
1999.
Analysis of fungal diversity in the wheat rhizosphere by sequencing of cloned PCR-amplified genes encoding 18S rRNA and temperature gradient gel electrophoresis.
Appl. Environ. Microbiol.
65:2614-2621[Abstract/Free Full Text].
|
| 29.
|
Van Driesche, R. G., and T. S. Bellows.
1996.
Biological control.
Chapman & Hall, New York, N.Y.
|
| 30.
|
Verweij, P. E.,
J. F. G. M. Meis,
P. Van Den Hurk,
J. Zoll,
R. A. Samson, and W. J. G. Melchers.
1995.
Phylogenetic relationships of five species of Aspergillus and related taxa as deduced by comparison of sequences of small subunit ribosomal RNA.
J. Med. Vet. Mycol.
33:185-190[Medline].
|
| 31.
|
White, T. J.,
T. Bruns,
S. Lee, and J. W. Taylor.
1990.
Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p. 315-322.
In
M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols: a guide to methods and applications. Academic Press, Inc., New York, N.Y.
|
Applied and Environmental Microbiology, October 2000, p. 4356-4360, Vol. 66, No. 10
0099-2240/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Gao, Z., Li, B., Zheng, C., Wang, G.
(2008). Molecular Detection of Fungal Communities in the Hawaiian Marine Sponges Suberites zeteki and Mycale armata. Appl. Environ. Microbiol.
74: 6091-6101
[Abstract]
[Full Text]
-
Kavroulakis, N., Ntougias, S., Zervakis, G. I., Ehaliotis, C., Haralampidis, K., Papadopoulou, K. K.
(2007). Role of ethylene in the protection of tomato plants against soil-borne fungal pathogens conferred by an endophytic Fusarium solani strain. J Exp Bot
0: erm230v1-erm230
[Abstract]
[Full Text]
-
Martin, K. J.
(2007). Introduction to Molecular Analysis of Ectomycorrhizal Communities. Soil Sci.
71: 601-610
[Abstract]
[Full Text]
-
Paulino, L. C., Tseng, C.-H., Strober, B. E., Blaser, M. J.
(2006). Molecular analysis of fungal microbiota in samples from healthy human skin and psoriatic lesions.. J. Clin. Microbiol.
44: 2933-2941
[Abstract]
[Full Text]
-
Sabev, H. A., Handley, P. S., Robson, G. D.
(2006). Fungal colonization of soil-buried plasticized polyvinyl chloride (pPVC) and the impact of incorporated biocides. Microbiology
152: 1731-1739
[Abstract]
[Full Text]
-
Jumpponen, A., Johnson, L. C.
(2005). Can rDNA analyses of diverse fungal communities in soil and roots detect effects of environmental manipulations--a case study from tallgrass prairie.. Mycologia
97: 1177-1194
[Abstract]
[Full Text]
-
Boyle, B., Hamelin, R. C., Seguin, A.
(2005). In Vivo Monitoring of Obligate Biotrophic Pathogen Growth by Kinetic PCR. Appl. Environ. Microbiol.
71: 1546-1552
[Abstract]
[Full Text]
-
Bistrussu, S., Beeton, A., Castaldo, G., Han, J., Wong, I., Tuleu, C., Long, P. F., Brown, K., Cross, N., Cope, J., Goldman, A. P., Karimova, A., O'Callaghan, M., Robertson, A., Smith, L.
(2004). Are Extracorporeal Membrane Oxygenation Circuits That Are Primed with Plasmalyte and Stored a Likely Source of Infection?. J. Clin. Microbiol.
42: 3906-3906
[Full Text]
-
Filion, M., Hamelin, R. C., Bernier, L., St-Arnaud, M.
(2004). Molecular Profiling of Rhizosphere Microbial Communities Associated with Healthy and Diseased Black Spruce (Picea mariana) Seedlings Grown in a Nursery. Appl. Environ. Microbiol.
70: 3541-3551
[Abstract]
[Full Text]
-
Green, S. J., Freeman, S., Hadar, Y., Minz, D.
(2004). Molecular tools for isolate and community studies of Pyrenomycete fungi. Mycologia
96: 439-451
[Abstract]
[Full Text]
-
Gomes, N. C. M., Fagbola, O., Costa, R., Rumjanek, N. G., Buchner, A., Mendona-Hagler, L., Smalla, K.
(2003). Dynamics of Fungal Communities in Bulk and Maize Rhizosphere Soil in the Tropics. Appl. Environ. Microbiol.
69: 3758-3766
[Abstract]
[Full Text]
-
Nikolcheva, L. G., Cockshutt, A. M., Barlocher, F.
(2003). Determining Diversity of Freshwater Fungi on Decaying Leaves: Comparison of Traditional and Molecular Approaches. Appl. Environ. Microbiol.
69: 2548-2554
[Abstract]
[Full Text]
-
Jumpponen, A., Newsham, K. K., Neises, D. J.
(2003). Filamentous ascomycetes inhabiting the rhizoid environment of the liverwort Cephaloziella varians in Antarctica are assessed by direct PCR and cloning. Mycologia
95: 457-466
[Abstract]
[Full Text]
-
Landeweert, R., Leeflang, P., Kuyper, T. W., Hoffland, E., Rosling, A., Wernars, K., Smit, E.
(2003). Molecular Identification of Ectomycorrhizal Mycelium in Soil Horizons. Appl. Environ. Microbiol.
69: 327-333
[Abstract]
[Full Text]
-
Valinsky, L., Della Vedova, G., Jiang, T., Borneman, J.
(2002). Oligonucleotide Fingerprinting of rRNA Genes for Analysis of Fungal Community Composition. Appl. Environ. Microbiol.
68: 5999-6004
[Abstract]
[Full Text]
-
Klamer, M., Roberts, M. S., Levine, L. H., Drake, B. G., Garland, J. L.
(2002). Influence of Elevated CO2 on the Fungal Community in a Coastal Scrub Oak Forest Soil Investigated with Terminal-Restriction Fragment Length Polymorphism Analysis. Appl. Environ. Microbiol.
68: 4370-4376
[Abstract]
[Full Text]
-
Ranjard, L., Poly, F., Lata, J.-C., Mougel, C., Thioulouse, J., Nazaret, S.
(2001). Characterization of Bacterial and Fungal Soil Communities by Automated Ribosomal Intergenic Spacer Analysis Fingerprints: Biological and Methodological Variability. Appl. Environ. Microbiol.
67: 4479-4487
[Abstract]
[Full Text]