Previous Article | Next Article 
Applied and Environmental Microbiology, October 2000, p. 4589-4594, Vol. 66, No. 10
0099-2240/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
A Bioluminescent Whole-Cell Reporter for Detection
of 2,4-Dichlorophenoxyacetic Acid and 2,4-Dichlorophenol
in Soil
Anthony G.
Hay,
James F.
Rice,
Bruce M.
Applegate,
Nathan G.
Bright, and
Gary S.
Sayler*
Center for Environmental Biotechnology,
University of Tennessee, Knoxville, Knoxville, Tennessee 37996-1605
Received 1 May 2000/Accepted 25 June 2000
 |
ABSTRACT |
A bioreporter was made containing a
tfdRPDII-luxCDABE fusion in a modified
mini-Tn5 construct. When it was introduced into the
chromosome of Ralstonia eutropha JMP134, the resulting
strain, JMP134-32, produced a sensitive bioluminescent response to
2,4-dichlorophenoxyacetic acid (2,4-D) at concentrations of 2.0 µM to
5.0 mM. This response was linear (R2 = 0.9825) in the range of 2.0 µM to 1.1 × 102 µM.
Saturation occurred at higher concentrations, with maximal bioluminescence occurring in the presence of approximately 1.2 mM
2,4-D. A sensitive response was also recorded in the presence of
2,4-dichlorophenol at concentrations below 1.1 × 102
µM; however, only a limited bioluminescent response was recorded in
the presence of 3-chlorobenzoic acid at concentrations below 1.0 mM. A
significant bioluminescent response was also recorded when strain
JMP134-32 was incubated with soils containing aged 2,4-D residues.
| |
TEXT |
The herbicide
2,4-dichlorophenoxyacetic acid (2,4-D) is widely used in both
agricultural and domestic weed control applications. While it is
rapidly degraded in most environments, the initial step in the
degradation of 2,4-D is a dioxygenase-mediated attack on the acetic
acid moiety, yielding glyoxylate and 2,4-dichlorophenol (DCP)
(13). At concentrations ranging from 120 to 250 µM, DCP is
known to be toxic to 2,4-D degraders and other microorganisms (8,
28), giving rise to concern over the fate of 2,4-D in the
environment. As both 2,4-D and DCP are moderately nonpolar molecules,
they have a tendency to partition into organic matter. This reduction
in bioavailability is difficult to assess with traditional analytical
approaches but is an important factor affecting the longevity of these
compounds in the environment.
Bioreporters are being increasingly used as a nondestructive means of
assaying gene expression, thereby allowing the assessment of
biologically relevant analyte concentrations. Analysis of gene expression typically relies on transcriptional fusions between a
promoter of interest and a reporter gene. Commonly used reporter genes
include lacZ, gfp, luxAB, and
luxCDABE. Use of the entire luxCDABE gene
cassette has been extensive (1, 2, 7, 17, 22, 35, 36)
because such reporters do not require the addition of an exogenous
substrate for signal production. The bioluminescent signal generated by
luxCDABE fusions is typically short-lived, thus allowing for
repetitive sampling under dynamic conditions. Similar bioreporters have
recently been shown to be compatible with emerging signal detection
technologies, such as integrated circuits capable of processing and
communicating signal input (39). We report here on the
development of a bioluminescent reporter for the detection of 2,4-D
degradation in aqueous samples and demonstrate its use in slurries
containing aged 2,4-D residues.
Strain construction.
Ralstonia (formerly
Alcaligenes) (44) eutropha JMP134
contains plasmid pJP4, which encodes all the enzymes involved in the metabolism of 2,4-D. This plasmid and the associated enzymes have been
well characterized (10, 26, 27, 30, 41). As transcription of
the genes associated with 2,4-D degradation is known to be inducible
(12, 23), construction of a functional bioreporter was
deemed feasible. To construct such a reporter both promoter and
regulatory elements were selected from pJP4 and fused to promoterless lux reporter genes (33).
The tfdDII promoter (tfdPDII) was
chosen because it has two domains that are identical to those of the
promoter of tfdA (27) but does not contain a
piece of the ISJP4 insertion element, which has interrupted
the tfdA promoter region (24). To fully activate transcription of the genes encoding 2,4-D-degradative enzymes, TfdR, a
LysR-type DNA binding protein, is required (25). In order to
efficiently incorporate both of these elements into the construct, a
1.1-kb fragment containing both tfdPDII and
tfdR was amplified from the plasmid pJP4. Amplification of
this fragment was facilitated by two PCR primers made using a DNA 1000 Oligo Synthesizer (Beckman, Fullerton, Calif.). The first primer,
GCGGCCGCCTATTTCTGTCCTTTCCCGCG, targeted the
region just downstream of the 3' end of tfdR and contained
an introduced NotI site on its 5' end (underlined). The
second primer, ACTAGTCGCAGCGGCAGATCG, was
targeted to the 5' end of tfdDII and contained an
SpeI site on its 5' end (underlined). PCR was achieved using
a modified touchdown protocol (34) in a PT200 thermocycler
(MJ Research, Watertown, Mass.). After an initial 5-min denaturation at
95°C, 10 cycles were executed in which the denaturing, annealing, and
extension times and temperatures were 95°C for 30 s, 65°C for
1 min, and 72°C for 2 min. During these first 10 cycles the annealing
temperature was lowered by 1°C per cycle. An additional 20 cycles
were then executed with an annealing temperature of 55°C. The
resulting amplicon containing the promoter sequence upstream of
tfdDII and tfdR in its entirety was cloned into
pCR2.1-TOPO using a TOPO TA cloning kit from Invitrogen (Carlsbad,
Calif.). The resulting plasmid, pTFDR, was digested with
NotI and SpeI, yielding a 1.1-kb fragment which
was ligated into pUTK215 (20), a modified
mini-Tn5 suicide delivery system containing a promoterless
luxCDABE cassette from Vibrio fischeri (33) that was previously digested with NotI and
XbaI. The ligation mix was transformed into electrocompetent
Escherichia coli S17(
pir) (9) using
an Electroporation System Electro Cell Manipulator 600 (BTX, San Diego,
Calif.) according to the manufacturer's instructions. Transformants
were selected on Luria-Bertani plates containing kanamycin (50 mg/liter). Plasmid DNA was isolated from the transformants and analyzed
using restriction endonucleases to confirm the presence of the
tfdPDII-tfdR fragment. A plasmid containing this
insert was named pUTK220 (Fig. 1). In all
cases plasmid and chromosomal DNA were isolated and enzymatically
modified according to procedures outlined by Ausubel et al.
(4).
View larger version (13K):
[in this window]
[in a new window]
|
FIG. 1.
Construction of mini-Tn5 tfd-lux suicide
vector pUTK220 from pUTK215, a pUT derivative (18). No,
NotI; X, XbaI; S/X,
SpeI-XbaI heterologous cloning sites; tnp,
transposase; rrnB T1T2,
transcriptional terminators from E. coli rrnB
(2); Ampr, ampicillin resistance;
Kmr, kanamycin resistance. RP4 ori, replication origin of
RP4, Mob RP4, mobilization region of RP4.
|
|
E. coli SV17(
pir) pUTK220 was mated with
R. eutropha JMP134. Transformants were plated on minimal salts medium
(MSM) containing
2.25 mM 2,4-D and kanamycin (50 mg/liter)
(
40). Colonies able
to grow on 2,4-D in the presence of
kanamycin were transferred
to Luria-Bertani plates containing 2.25 mM
2,4-D and were inspected
in the dark for the production of light. Two
transformants producing
enough light to be visible in a dark room were
further analyzed
with regard to the kinetics of light production in the
presence
of 2,4-D at various concentrations (data not shown). Of these
two, a transformant designated strain JMP134-32 was chosen for
further
analyses.
To ascertain whether transposition from pUTK220 had occurred in the
chromosome or into the endogenous plasmid pJP4, both total
DNA and
plasmid DNA were loaded independently onto a Biotrans
nylon membrane
from ICN (Irvine, Calif.) using a Bioslot apparatus
from Bio-Rad
(Hercules, Calif.). The membrane was first hybridized
with a
32P-labeled, PCR-generated
luxAB probe amplified
from
V. fischeri (
2) and was then stripped and
reprobed with a
32P-labeled, PCR-generated
tfdC
probe amplified from pJP4 (
31).
Blots were hybridized and
washed as described previously (
1)
and were then visualized
on a Storm 840 PhosphorImager from Molecular
Dynamics (Sunnyvale,
Calif.). Results from these slot blot hybridizations
(Fig.
2) demonstrated that transposition from
pUTK220 resulted
in insertion of the
tfdRPDII-luxCDABE fusion into the chromosome
of
JMP134-32.
View larger version (16K):
[in this window]
[in a new window]
|
FIG. 2.
Slot blot analysis of DNA from strain JMP134 (lanes 1)
and strain JMP134-32 (lanes 2). The blot was probed with a
32P-labeled luxAB fragment (A), stripped, and
then reprobed with a 32P-labeled tfdC fragment
(B).
|
|
Construct stability was assessed by repeated passages of JMP134-32 on
nonselective YEPG medium (
1). After 10 passages or
approximately 65 generations, the culture was serially diluted
and
spread onto YEPG plates amended with kanamycin (50 mg/liter).
Colony
hybridizations (
3) were then performed using the
luxAB probe mentioned above and visualized using the Storm
840 PhosphorImager.
All colonies probed positive for the
lux
genes, demonstrating
maintenance of the construct in
recombination-proficient JMP134-32
without
selection.
Bioluminescent response.
The bioluminescent response to 2,4-D
was determined using a growing-cell assay that has been described
previously (17). Briefly, JMP134-32 was grown to an optical
density at 600 nm of 0.35 in YEPG at 28°C. Strain JMP134-32 was
exposed to 2,4-D (98% pure) from Aldrich Chemical Company (Milwaukee,
Wis.) by adding 50 µl of the YEPG-grown cells to 50 µl of MSM
containing 2,4-D at various concentrations. The 2,4-D additions were
serially diluted into MSM from a 5.0 mM stock dissolved in MSM. Light
was measured in quadruplicate, using static opaque 96-well plates, in a
Wallac 1450 Microbeta Plus liquid scintillation counter (Wallac, Turku, Finland) at room temperature. Preliminary experiments showed that 60- to 100-min incubations were sufficient to provide a consistent light
response. The mean light response to 2,4-D concentrations from 0.0 µM
to 1.1 × 102 µM was obtained after 100 min of
incubation and is plotted (Fig. 3). There
was a statistically significant (P < 0.05) linear
bioluminescent response by R. eutropha JMP134-32 to
increasing concentrations of 2,4-D (from 2.0 µM to approximately 112 µM) (R2 = 0.9825). At concentrations
above 112 µM and up to 1.25 mM, the response appeared to follow
saturation kinetics, with a maximal bioluminescent response induced by
1.25 mM 2,4-D (Fig. 4).
View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3.
Bioluminescent response of strain JMP134-32 to various
concentrations of 2,4-D. Inset shows response to low-level
concentrations and is plotted on a different scale. CPS, luminescence
counts per second.
|
|
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 4.
Comparison of the bioluminescent response of strain
JMP134-32 to those of different compounds known to induce the genes
involved in 2,4-D degradation: 3-CB,  ; DCP,  ; and 2,4-D,  .
Inset shows response to low-level concentrations and is plotted on a
different scale.
|
|
Toxic effects, as measured by a 10 to 20% reduction in optical density
at 600 nm, were observed at 2,4-D concentrations greater
than 1.25 mM.
The observed decrease in optical density is consistent
with published
reports which demonstrate that the accumulation
of DCP during 2,4-D
degradation in more complex media can be toxic
(
8,
23). The
decrease in optical density alone, however,
cannot explain the
magnitude of the decrease in light output observed
at 2,4-D
concentrations above 1.25 mM (Fig.
4). The mechanism
of DCP toxicity is
assumed to be the same as that for other chlorinated
phenols which are
known to act as uncouplers of electron transport
and can make membranes
permeable to small molecules, such as ATP
(
15,
23). It is
therefore possible that decreased light output
at higher 2,4-D
concentrations (Fig.
4) results in part from the
rapid loss of ATP to
the extracellular milieu when DCP accumulates
and disrupts the
membrane. ATP is a reactant required for light
production
(
39), and its loss to the supernatant would dramatically
reduce both cellular energy level and total light
output.
R. eutropha JMP134-32 was also incubated with several other
compounds to determine the range of inducing substrates. DCP,
3-chlorobenzoate, and benzoate were 99% pure, while
2,4,5-trichlorophenoxyacetic
acid (2,4,5-T) was 97% pure. The
chemicals listed above were obtained
from Aldrich. 4-Nitrophenoxyacetic
acid was obtained from TCI
America (Portland, Oreg.) and was 98% pure.
Light production was
not induced by 2,4,5-T during the same time period
(0 to 4 h).
Bioluminescence was not observed in the presence of
either benzoic
acid or 4-nitrophenoxyacetic acid but was induced in the
presence
of both DCP and 3-chlorobenzoic acid (3-CB). The
bioluminescent
response to 3-CB was measured in the same manner as was
that induced
by 2,4-D. However, the volatile nature of DCP precluded
its measurement
using the Wallac 1450. DCP was therefore measured in
triplicate
by placing sealed sample vials into a light-tight box
connected
to a Detection System 7070 photomultiplier (Oriel, Stratford,
Conn.) via a liquid light pipe (
17). Light from samples
containing
100, 75, 50, or 25 µM 2,4-D was also measured using the
Oriel
System 7070. As responses to 2,4-D measured by both instruments
were linear in this range, a conversion factor was derived that
allowed
the direct normalization of Oriel-derived DCP data to
output from the
Wallac 1450. The means of the normalized data
obtained after 100 min of
incubation are plotted (Fig.
4).
Not surprisingly, the bioluminescent response of strain JMP134-32 to
low levels of DCP was very similar to its response to
2,4-D. DCP is
known to be an intermediate in the metabolism of
2,4-D (
11)
and has been used as an inducing agent for increasing
the production of
enzymes involved in 2,4-D degradation (
26).
This is likely
due to its conversion to 2,4-dichloromuconate,
a breakdown product of
both 2,4-D and DCP and a known inducing
agent of the 2,4-D pathway
(
12). Strain JMP134-32 showed a statistically
significant
increase in light production concomitant with increasing
DCP
concentrations from 1.0 µM to 1.1 × 10
2 µM.
However, toxic effects were observed at much lower concentrations
of
DCP than with 2,4-D. These toxic effects are consistent with
published
observations concerning the effects of DCP concentrations
greater than
200 µM on 2,4-D-degrading organisms (
28).
Given the strong bioluminescent response of strain
JMP134-32 to 2,4-D and DCP, the limited response to 3-CB,
especially at
low concentrations, was surprising (Fig.
4). Although
light production
was statistically greater than the control at 3-CB
concentrations
of 12 µM, the amount of light was not statistically
significantly
different from that produced in the presence of 3-CB
concentrations
as high as 5.0 × 10
2 µM. More
dramatic increases in light production did not occur
in the presence of
3-CB until concentrations exceeded 1.0 mM,
with maximal measured light
production occurring in the presence
of 2.5 mM 3-CB (Fig.
4).
Light production in the presence of 1.2 mM 3-CB was approximately
twofold greater than background levels. This is consistent
with the
findings of Leveau and van der Meer (
25), who reported
a
two- to threefold increase in 3,5-dichlorocatechol dioxygenase
activity
toward 3-chlorocatechol by cells containing a functional
regulatory
protein (TfdR) grown in the presence of 1.0 mM 3-CB.
When knockout
mutants of JMP134 unable to degrade the inducer,
2,4-dichloromuconate,
were grown in the presence of 2.25 mM 2,4-D,
Filer and Harker
(
12) were also able to detect an approximately
twofold
increase in transcription of the
tfdCDEF operon.
The bioluminescent response of strain JMP134-32 in the presence of
approximately 2.25 mM 2,4-D was more than 20-fold higher
than the
background level and 10-fold higher than that reported
by Filer and
Harker (
12). Comparisons between different reporter
systems
are difficult to make due to possible differences in the
stability of
the reporter transcript, the strength of the ribosomal
binding site,
and the longevity of the protein (
43). However,
it is
unlikely that the observed differences between the reporter
constructs
are related to the strengths of the different promoters,
as Leveau et
al. (
23) have recently shown that the relative
abundance of
mRNA transcribed from the
tfdC and
tfdDII promoters
is not dramatically different.
Although the reasons for differences
in signal strength are unclear,
the low signal-to-noise ratio
in response to 2,4-D, combined with the
easily measured bioluminescent
signal, makes JMP134-32 a candidate for
use as a bioreporter in
more complex substrates than just minimal
media.
To assess the usefulness of JMP134-32 in more environmentally relevant
samples, bioluminescence assays were performed on soil
extracts and
soil slurries from Agent Orange-contaminated soils.
Soil was obtained
from a loading-unloading area at Hardstand 7,
Eglin Air Force Base
(Niceville, Fla.). To determine the concentrations
of the contaminants,
soil was extracted by shaking it for 30 min
with a 1:1 mixture of
hexane and acetone. The extracts were analyzed
using a Supelcosil
LC-18-T reverse-phase C
18 column (Supelco,
Bellefonte, Pa.)
attached to a binary LC 250 series pump (Perkin-Elmer,
Foster City,
Calif.) and a Perkin-Elmer model LC-235 diode array
detector. Data
analysis was achieved using the Turbochrome version
4.1 software
package (Perkin-Elmer, PE Nelson Division, San Jose,
Calif.). Samples
were eluted at a flow rate of 1.0 ml/min with
a 0.025%
H
3PO
4-acetonitrile gradient, as follows: 0%
acetonitrile
(isocratic, 5.0 min), 0 to 50% acetonitrile (5.0-min
ramp), 50%
acetonitrile (isocratic, 20 min), and 50 to 0%
acetonitrile (5.0-min
ramp). Absorbance of eluted compounds was
monitored at 210
nm.
High-performance liquid chromatography (HPLC) analysis revealed the
soil to have 22.4-mg/kg and 73.8-mg/kg concentrations
of 2,4-D and
2,4,5-T, respectively, while DCP and 2,4,5-trichlorophenol
concentrations were both found to be less than 1 mg/kg (
31).
Initial experiments involved washing 5.0 g of soil with 5.0 ml
of
MSM. The slurries were centrifuged at 10,000 ×
g for
10 min
after being shaken for 24, 48, or 120 h. Then 100 µl of
the supernatant
was added to 100 µl of JMP134-32 that had been grown
in YEPG medium
to an optical density at 600 nm of 0.35. Cells were also
added
to a negative control consisting of MSM alone and a positive
control
consisting of MSM plus 2,4-D (20 mg/liter). No bioluminescence
was observed in the soil extracts. HPLC analysis of these soil
washings
revealed trace levels of 2,4-D and 2,4,5-T that were
below the HPLC
quantitation limit (2.3 × 10
2 nM) and below the level
required to induce a significant bioluminescent
response in MSM (2.0 µM).
Under the assumption that cells added directly to a soil slurry may act
as a sink for 2,4-D (
5), JMP134-32 was grown to
an optical
density at 600 nm of 0.5 in YEPG and centrifuged at
10,000 ×
g for 10 min. The cells were then resuspended in 0.5
volume of
MSM to a final optical density at 600 nm of 1.0 and
were added to soil
(1.0 ml of cells/g of soil). Triplicate 100-µl
samples of the slurry
were monitored for bioluminescence as described
above. To control for
nonspecific induction of bioluminescence,
the procedure described above
was repeated using a previously
characterized bioreporter,
Pseudomonas fluorescens 5RL, which
is insensitive to 2,4-D
(
19). No bioluminescence was observed
when 5RL was added to
the contaminated soil (data not
shown).
Although there appeared to be a significant lag compared to the
performance of the aqueous positive control, a significant
bioluminescent response was observed after the addition of JMP134-32
to
2,4-D-contaminated soil (Fig.
5). A
similar lag in bioluminescent
response was observed when
P. fluorescens HK44, a bioluminescent
reporter bacterium responsive
to naphthalene, was incubated with
naphthalene-contaminated soils
(
21). The authors suggested that
the lag was due to the
quenching of emitted light by soil particles
in the slurry. Since the
soil-washing experiment demonstrated
that 2,4-D and DCP concentrations
in the extracts were below the
levels required for significant light
induction (>2.0 µM), the
bioluminescent signal recorded most likely
resulted from metabolism
of 2,4-D that had partitioned from the soil to
the cells. The
observed lag may therefore indicate that desorption of
2,4-D from
the soil is a rate-limiting step. This is consistent with
the
findings of Ogram et al., who demonstrated that only solution-phase
2,4-D was readily degraded in soil slurries (
29).
View larger version (13K):
[in this window]
[in a new window]
|
FIG. 5.
Bioluminescent response of strain JMP134-32 to Agent
Orange-contaminated soil,  ; MSM containing 90 µM 2,4-D, ; and
MSM control, .
|
|
The decrease in bioluminescence observed in the aqueous control after
80 min (Fig.
5) was not seen during the initial experiments
that used a
much lower concentration of cells (optical density
at 600 nm, 1.0 versus 0.18). Leveau et al. have shown that challenging
actively
growing, dense cultures (optical densities at 600 nm
of >0.8) with
2,4-D results in the rapid accumulation of DCP and
is accompanied by
cell death (
23). This accumulation may be
a result of
disproportionate synthesis rates of
tfdA and
tfdB,
resulting in a transient 100-fold relative increase in
tfdA transcript
abundance (
23). As mentioned
earlier, the resultant accumulation
of DCP may also damage cell
membrane integrity, resulting in the
rapid loss of ATP (
15),
thereby limiting
bioluminescence.
Conclusions.
The limited responsiveness to 3-CB combined with
sensitivity to low concentrations of both 2,4-D and DCP makes strain
JMP134-32 a potentially useful bioreporter for the detection of 2,4-D
and its breakdown products in aqueous samples. The specific nature of
this reporter is a simple alternative to fingerprinting methods which
rely on the response of multiple bioreporters, each consisting of the
promoter from a general stress gene fused to a reporter gene
(6). Such systems relying on multiple reporters could give
misleading signals that cannot be controlled for if unknowns contain
solvents (16). Producing a positive signal specifically in
response to 2,4-D and DCP, strain JMP134-32 also differs from Burkholderia sp. strain RASC c2, a recently described
DCP-degrading bacterium that contains a lux cassette
expressed from an uncharacterized constitutive promoter
(37). Strain RASC c2 has no reported response to 2,4-D and
responds to DCP only as one of many potential food sources or toxicants
(38).
Having its reporter element chromosomally encoded, strain JMP134-32 is
not prone to problems encountered by plasmid-based
systems, such as
copy number effects (
42) or the need for selective
pressure
in order to ensure that plasmid loss does not occur (
32).
The inclusion of
tfdR also makes for a versatile autonomous
reporter
that could be placed in other organisms unable to degrade
2,4-D,
thereby allowing measurement of extracellular metabolite
concentrations.
This reporter construct has been used to successfully detect 2,4-D in
aqueous media and also in slurries containing soil with
aged 2,4-D
residues. Response to aged 2,4-D residues in soil took
longer than
response to 2,4-D in aqueous media. Although the soil
slurry may have
quenched some of the bioluminescent signal, more
work needs to be done
to determine the correlation between this
observed lag in
bioluminescence and the bioavailability of 2,4-D
residues in
soil.
Specific applications of this bioreporter must be carefully evaluated,
as underestimation of 2,4-D or DCP concentration or
false-negative
results may occur if 2,4-D or DCP is at toxic levels
in the sample.
This limitation is easily addressed by performing
analyses on samples
that have been serially diluted in an appropriate
medium
(
14). Increased bioluminescence in more dilute samples
would
indicate diminished toxicity and serve as an effective control.
Spiking
samples that do not emit light with known concentrations
of 2,4-D is
another means of assessing possible false negatives
as a result of
toxicity-related issues. Despite these limitations,
the work described
in this report details the development of a
whole-cell bioluminescent
reporter for the detection of 2,4-D
that is rapid and easy to perform
and may be useful in elucidating
factors involved in the
bioavailability of 2,4-D in environmentally
relevant
samples.
| |
ACKNOWLEDGMENTS |
This work was supported in part by a Dow Foundation Sphere award to
G.S.S. and in part by the Waste Management Research and Education
Institute, University of Tennessee, Knoxville. A.G.H. was supported by
an appointment to the Alexander Hollaender Distinguished Postdoctoral
Fellowship Program sponsored by the U.S. Department of Energy, Office
of Health and Environmental Research, and administered by the Oak Ridge
Institute for Science and Education.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Center for
Environmental Biotechnology, 676 Dabney Hall, University of Tennessee,
Knoxville, Knoxville, TN 37996-1605. Phone: (423) 974-8080. Fax: (423)
974-8086. E-mail: Sayler{at}utk.edu.
Present address: Department of Microbiology, Cornell University,
Ithaca, NY 14853.
Present address: Monsanto Company, St. Louis, MO 63167-0001.
| |
REFERENCES |
| 1.
|
Applegate, B.,
C. Kelly,
L. Lackey,
J. McPherson,
S. Kehrmeyer,
F. M. Menn,
P. Bienkowski, and G. Sayler.
1997.
Pseudomonas putida B2: a tod-lux bioluminescent reporter for toluene and trichloroethylene co-metabolism.
J. Ind. Microbiol. Biotechnol.
18:4-9[CrossRef][Medline].
|
| 2.
|
Applegate, B. M.,
S. R. Kehrmeyer, and G. S. Sayler.
1998.
A chromosomally based tod-luxCDABE whole-cell reporter for benzene, toluene, ethylbenzene, and xylene (BTEX) sensing.
Appl. Environ. Microbiol.
64:2730-2735[Abstract/Free Full Text].
|
| 3.
|
Applegate, B. M.,
U. Matrubutham,
J. Sanseverino, and G. S. Sayler.
1995.
Biodegradation genes as marker genes in microbial ecosystems, p. 6.1.8.
, 1-14. In A. D. L. Akerman, J. D. Van Elsas, and F. J. de Bruijn (ed.), Molecular microbial ecology. Kluwer Academic Publishers, Dordrecht, The Netherlands.
|
| 4.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1989.
Current protocols in molecular biology.
John Wiley & Sons, New York, N.Y.
|
| 5.
|
Baveye, P., and R. Bladon.
1999.
Bioavailability of organic xenobiotics in the environment: a critical perspective, p. 227-248.
In
P. Baveye, et al. (ed.), Bioavailability of organic xenobiotics in the environment. Kluwer Academic Publishers, Dordrecht, The Netherlands.
|
| 6.
|
Ben-Israel, O.,
H. Ben-Israel, and S. Ulitzur.
1998.
Identification and quantification of toxic chemicals by use of Escherichia coli carrying lux genes fused to stress promoters.
Appl. Environ. Microbiol.
64:4346-4352[Abstract/Free Full Text].
|
| 7.
|
Burlage, R. S.,
A. V. Palumbo,
A. Heitzer, and G. Sayler.
1994.
Bioluminescent reporter bacteria detect contaminants in soil samples.
Appl. Biochem. Biotechnol.
45:731-740.
|
| 8.
|
Daugherty, D. D., and S. F. Karel.
1994.
Degradation of 2,4-dichlorophenoxyacetic acid by Pseudomonas cepacia DBO1(pRO101) in a dual-substrate chemostat.
Appl. Environ. Microbiol.
60:3261-3267[Abstract/Free Full Text].
|
| 9.
|
De Lorenzo, V.,
S. Fernandez,
M. Herrero,
U. Jakubzik, and K. N. Timmis.
1993.
Engineering of alkyl- and haloaromatic-responsive gene expression with mini-transposons containing regulated promoters of biodegradative pathways of Pseudomonas.
Gene
130:41-46[CrossRef][Medline].
|
| 10.
|
Don, R. H., and J. M. Pemberton.
1981.
Properties of six pesticide degradation plasmids isolated from Alcaligenes paradoxus and Alcaligenes eutrophus.
J. Bacteriol.
145:681-686[Abstract/Free Full Text].
|
| 11.
|
Don, R. H.,
A. J. Weightman,
H.-J. Knackmuss, and K. N. Timmis.
1985.
Transposon mutagenesis and cloning analysis of the pathways for degradation of 2,4-dichlorophenoxyacetic acid and 3-chlorobenzoate in Alcaligenes eutrophus JMP134(pJP4).
J. Bacteriol.
161:85-90[Abstract/Free Full Text].
|
| 12.
|
Filer, K., and A. R. Harker.
1997.
Identification of the inducing agent of the 2,4-dichlorophenoxyacetic acid pathway encoded by plasmid pJP4.
Appl. Environ. Microbiol.
63:317-320[Abstract].
|
| 13.
|
Fukumori, F., and R. Hausinger.
1993.
Alcaligenes eutrophus JMP134 "2,4-dichlorophenoxyacetate monooxygenase" is an  -ketoglutarate-dependent dioxygenase.
J. Bacteriol.
175:2083-2086[Abstract/Free Full Text].
|
| 14.
|
Harkey, G. A., and T. M. Young.
1999.
Effect of soil contaminant extraction method in determining toxicity using the Microtox assay.
Environ. Toxicol. Chem.
19:276-282[CrossRef].
|
| 15.
|
Heipieper, H. J.,
H. Keweloh, and H. J. Rehm.
1991.
Influence of phenols on growth and membrane permeability of free and immobilized Escherichia coli.
Appl. Environ. Microbiol.
57:1213-1217[Abstract/Free Full Text].
|
| 16.
|
Heitzer, A.,
B. Applegate,
S. Kehrmeyer,
H. Pinkart,
O. F. Webb,
T. J. Phelps,
D. C. White, and G. S. Sayler.
1998.
Physiological considerations of environmental applications of lux reporter fusions.
J. Microbiol. Methods
33:45-57[CrossRef].
|
| 17.
|
Heitzer, A.,
O. F. Webb,
J. E. Thonnard, and G. S. Sayler.
1992.
Specific and quantitative assessment of naphthalene and salicylate bioavailability by using a bioluminescent catabolic reporter bacterium.
Appl. Environ. Microbiol.
58:1839-1846[Abstract/Free Full Text].
|
| 18.
|
Herrero, M.,
V. de Lorenzo, and K. N. Timmis.
1990.
Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable chromosomal insertion of foreign genes in gram-negative bacteria.
J. Bacteriol.
172:6557-6567[Abstract/Free Full Text].
|
| 19.
|
Johnston, W.
1996.
Ph.D. dissertation.
University of Tennessee, Knoxville.
|
| 20.
|
Kehrmeyer, S. R.
1998.
Ph.D. dissertation.
University of Tennessee, Knoxville.
|
| 21.
|
King, J. M. H.,
P. M. Digrazia,
B. Applegate,
R. Burlage,
J. Sanseverino,
P. Dunbar,
F. Larimer, and G. S. Sayler.
1990.
Rapid sensitive bioluminescent reporter technology for naphthalene exposure and biodegradation.
Science
249:778-781[Abstract/Free Full Text].
|
| 22.
|
Layton, A. C.,
M. Muccini,
M. M. Ghosh, and G. S. Sayler.
1998.
Construction of a bioluminescent reporter strain to detect polychlorinated biphenyls.
Appl. Environ. Microbiol.
64:5023-5026[Abstract/Free Full Text].
|
| 23.
|
Leveau, J. H.,
F. Konig,
H. Fuchslin,
C. Werlen, and J. R. van der Meer.
1999.
Dynamics of multigene expression during catabolic adaptation of Ralstonia eutropha JMP134 (pJP4) to the herbicide 2,4-dichlorophenoxyacetate.
Mol. Microbiol.
33:396-406[CrossRef][Medline].
|
| 24.
|
Leveau, J. H. J., and J. R. van der Meer.
1997.
Genetic characterization of insertion sequence ISJP4 on plasmid pJP4 from Ralstonia eutropha JMP134.
Gene
202:103-114[CrossRef][Medline].
|
| 25.
|
Leveau, J. H. J., and J. R. van der Meer.
1996.
The tfdR gene product can successfully take over the role of the insertion element-inactivated TfdT protein as a transcriptional activator of the tfdCDEF gene cluster, which encodes chlorocatechol degradation in Ralstonia eutropha JMP134(pJP4).
J. Bacteriol.
178:6824-6832[Abstract/Free Full Text].
|
| 26.
|
Leveau, J. H. J.,
A. J. B. Zehnder, and J. R. van der Meer.
1998.
The tfdK gene product facilitates uptake of 2,4-dichlorophenoxyacetate by Ralstonia eutropha JMP134(pJP4).
J. Bacteriol.
180:2237-2243[Abstract/Free Full Text].
|
| 27.
|
Matrubutham, U., and A. R. Harker.
1994.
Analysis of duplicated gene sequences associated with tfdR and tfdS in Alcaligenes eutrophus JMP134.
J. Bacteriol.
176:2348-2353[Abstract/Free Full Text].
|
| 28.
|
Mungkarndee, P.,
S. M. R. Bhamidimarri,
A. J. Mawson, and R. Chong.
1997.
The role of a metabolic intermediate in the biodegradation of inhibitory substrates.
Water Sci. Technol.
36:27-36.
|
| 29.
|
Ogram, A. V.,
R. E. Jessup,
L. T. Ou, and P. S. C. Rao.
1985.
Effects of sorption on biological degradation rates of (2,4-dichlorophenoxy)acetic acid in soils.
Appl. Environ. Microbiol.
49:582-587[Abstract/Free Full Text].
|
| 30.
|
Pérez-Pantoja, D.,
L. Guzmán,
M. Manzano,
D. Pieper, and B. González.
2000.
Role of tfdCIDIEIFI and tfdDIICIIEIIFII gene modules in catabolism of 3-chlorobenzoate by Ralstonia eutropha JMP134(pJP4).
Appl. Environ. Microbiol.
66:1602-1608[Abstract/Free Full Text].
|
| 31.
|
Rice, J. F.
1999.
Ph.D. dissertation.
University of Tennessee, Knoxville.
|
| 32.
|
Rice, J. F.,
R. F. Fowler,
A. A. Arrage,
D. C. White, and G. S. Sayler.
1995.
Effects of external stimuli on environmental bacterial strains harboring an algD-lux bioluminescent reporter plasmid for the study of corrosive biofilms.
J. Ind. Microbiol.
15:318-328[CrossRef].
|
| 33.
|
Rogowsky, P. M.,
T. J. Close,
J. A. Chimera,
J. J. Shaw, and C. I. Kado.
1987.
Regulation of the vir genes of Agrobacterium tumefaciens plasmid pTiC58.
J. Bacteriol.
169:5101-5112[Abstract/Free Full Text].
|
| 34.
|
Roux, K. H.
1994.
Using mismatched primer-template pairs in touchdown PCR.
BioTechniques
16:812-814[Medline].
|
| 35.
|
Selifonova, O.,
R. Burlage, and T. Barkay.
1993.
Bioluminescent sensors for detection of bioavailable Hg(II) in the environment.
Appl. Environ. Microbiol.
59:3083-3090[Abstract/Free Full Text].
|
| 36.
|
Selifonova, O. V., and R. W. Eaton.
1996.
Use of an ipb-lux fusion to study regulation of the isopropylbenzene catabolism operon of Pseudomonas putida RE204 and to detect hydrophobic pollutants in the environment.
Appl. Environ. Microbiol.
62:778-783[Abstract].
|
| 37.
|
Shaw, L. J.,
L. Beaton,
K. Glover,
K. Killham, and A. A. Meharg.
1999.
Development and characterization of a lux-modified 2,4-dichlorophenol-degrading Burkholderia sp.
RASC. Environ. Microbiol.
1:393-399.
|
| 38.
|
Shaw, L. J.,
Y. Beaton,
A. Glover,
K. Killham, and A. A. Meharg.
2000.
Interactions between soil, toxicant, and a lux-marked bacterium during solid phase-contact toxicity testing.
Environ. Toxicol. Chem.
19:1247-1252[CrossRef].
|
| 39.
|
Simpson, M. L.,
G. S. Sayler,
B. M. Applegate,
S. Ripp,
D. E. Nivens,
M. J. Paulus, and G. E. Jellison, Jr.
1998.
Bioluminescent-bioreporter integrated circuits form novel whole-cell biosensors.
Trends Biotechnol.
16:332-338[CrossRef].
|
| 40.
|
Stanier, R. Y.,
N. J. Palleroni, and M. Doudoroff.
1966.
The aerobic pseudomonads: a taxonomic study.
J. Gen. Microbiol.
41:159-271.
|
| 41.
|
Streber, W. R.,
K. N. Timmis, and M. H. Zenk.
1987.
Analysis, cloning, and high-level expression of 2,4-dichlorophenoxyacetate monooxygenase gene tfdA of Alcaligenes eutrophus JMP134.
J. Bacteriol.
169:2950-2955[Abstract/Free Full Text].
|
| 42.
|
Wang, Y.,
M. Rawlings,
D. T. Gibson,
D. Labbe,
H. Bergeron,
R. Brousseau, and P. C. K. Lau.
1995.
Identification of a membrane protein and a truncated LysR-type regulator associated with the toluene degradation pathway in Pseudomonas putida F1.
Mol. Gen. Genet.
246:570-579[CrossRef][Medline].
|
| 43.
|
Wood, K. V.
1996.
Marker proteins for gene expression.
Curr. Opin. Biotechnol.
6:50-58.
|
| 44.
|
Yabuuchi, E.,
Y. Kosako,
I. Yano,
H. Hotta, and Y. Nishiuchi.
1995.
Transfer of two Burkholderia and an Alcaligenes species to Ralstonia gen. nov.: proposal of Ralstonia pickettii (Ralston, Palleroni and Doudoroff 1973) comb. nov., Ralstonia solanacearum (Smith 1896) comb. nov. and Ralstonia eutropha (Davis 1969) comb. nov.
Microbiol. Immunol.
39:897-904[Medline].
|
Applied and Environmental Microbiology, October 2000, p. 4589-4594, Vol. 66, No. 10
0099-2240/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Suar, M., van der Meer, J. R., Lawlor, K., Holliger, C., Lal, R.
(2004). Dynamics of Multiple lin Gene Expression in Sphingomonas paucimobilis B90A in Response to Different Hexachlorocyclohexane Isomers. Appl. Environ. Microbiol.
70: 6650-6656
[Abstract]
[Full Text]
-
Dionisi, H. M., Chewning, C. S., Morgan, K. H., Menn, F.-M., Easter, J. P., Sayler, G. S.
(2004). Abundance of Dioxygenase Genes Similar to Ralstonia sp. Strain U2 nagAc Is Correlated with Naphthalene Concentrations in Coal Tar-Contaminated Freshwater Sediments. Appl. Environ. Microbiol.
70: 3988-3995
[Abstract]
[Full Text]
-
Werlen, C., Jaspers, M. C. M., van der Meer, J. R.
(2004). Measurement of Biologically Available Naphthalene in Gas and Aqueous Phases by Use of a Pseudomonas putida Biosensor. Appl. Environ. Microbiol.
70: 43-51
[Abstract]
[Full Text]
Top
Abstract
Text
