Previous Article | Next Article ![]()
Applied and Environmental Microbiology, November 2000, p. 4715-4719, Vol. 66, No. 11
Southern Regional Research Center,
Agricultural Research Service, U.S. Department of Agriculture, New
Orleans, Louisiana 70124
Received 15 March 2000/Accepted 12 August 2000
Two routes for the conversion of 5'-hydroxyaverantin (HAVN) to
averufin (AVF) in the synthesis of aflatoxin have been proposed. One
involves the dehydration of HAVN to the lactone averufanin (AVNN),
which is then oxidized to AVF. Another requires dehydrogenation of HAVN
to 5'-ketoaverantin, the open-chain form of AVF, which then cyclizes
spontaneously to AVF. We isolated a gene, adhA, from the
aflatoxin gene cluster of Aspergillus parasiticus SU-1. The
deduced ADHA amino acid sequence contained two conserved motifs found
in short-chain alcohol dehydrogenases Aflatoxins constitute a family of
toxic and carcinogenic secondary metabolites that are produced by some
members in Aspergillus section Flavi,
particularly Aspergillus flavus, Aspergillus
parasiticus, and Aspergillus nomius (26).
They have been found as contaminants in corn, peanut, cottonseed, and
tree nuts. Aflatoxin B1 (AFB1) is the most
carcinogenic member of this family. The biosynthesis of
AFB1 from acetyl coenzyme A is a complex process which
involves more than 20 enzymatic steps (4, 14, 25). All genes
encoding the biosynthetic enzymes are located in a gene cluster
(5, 28, 31, 34).
The early steps in the synthesis of AFB1 involve the
conversion of norsolorinic acid (NOR) to averantin (AVN), which is
oxidized to 5'-hydroxyaverantin (HAVN) and then to averufin (AVF). Yabe et al. (32) showed that HAVN is an intermediate in the
enzymatic conversion of AVN to AVF. Yu et al. (35) found
that the avnA gene encodes a cytochrome P-450-type
monooxygenase necessary for the conversion of AVN to HAVN. However, the
enzyme involved in the oxidation of HAVN was not identified. Two
possible routes from HAVN to AVF have been proposed (Fig.
1). In one, dehydration of HAVN occurs
first to give the lactone, averufanin (AVNN), which is then oxidized to
AVF (4). In the second route, the 5'-hydroxyl of HAVN is
oxidized to give 5'-ketoaverantin, the open-chain form of AVF, which
then spontaneously cyclizes to AVF (14, 25, 32). As evidence
for the first route, McCormick et al. (24) found that
radiolabeled [14C]AVNN was efficiently converted to
[14C]AFB1 by wild-type A. parasiticus as well as to aflatoxin precursors by blocked A. parasiticus strains. Also, Prieto et al. (27) observed
AVNN buildup in AVF-accumulating mutants. AVNN has been isolated from
A. flavus, Aspergillus versicolor, and
Bipolaris sp. (2, 16, 17). However, in none of
these cases is there direct evidence showing that accumulation of AVNN
is necessary for AVF formation.
0099-2240/00/$04.00+0
adhA in Aspergillus
parasiticus Is Involved in Conversion of 5'-Hydroxyaverantin
to Averufin
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
a glycine-rich loop (GXXXGXG)
that is necessary for interaction with
NAD+-NADP+, and the motif YXXXK, which is found
at the active site. A. parasiticus SU-1, which produces
aflatoxins, has two copies of adhA (adhA1), whereas A. parasiticus SRRC 2043, a strain that accumulates
O-methylsterigmatocystin (OMST), has only one copy.
Disruption of adhA in SRRC 2043 resulted in a strain that
accumulates predominantly HAVN. This result suggests that ADHA is
involved in the dehydrogenation of HAVN to AVF. Those adhA
disruptants that still made small amounts of OMST also accumulated other metabolites, including AVNN, after prolonged culture.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (34K):
[in a new window]
FIG. 1.
Postulated mechanisms for the conversion of HAVN to AVF.
The adhA gene product, a short-chain alcohol dehydrogenase,
proposed to convert HAVN to AVF, is depicted.
In this study, we isolated the adhA gene from the known aflatoxin gene cluster of A. parasiticus. We disrupted this gene in A. parasiticus SRRC 2043, and the resulting clones accumulated predominantly HAVN. We conclude that direct dehydrogenation of HAVN to the open-chain form of AVF is the most likely enzymatic step in the aflatoxin pathway and that AVNN is probably a by-product formed by nonenzymatic dehydration of HAVN.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Fungal strains and media.
A. parasiticus SU-1 (ATCC
56775, SRRC 143), an aflatoxin-producing strain, and A. parasiticus SRRC 2043, a strain that accumulates O-methylsterigmatocystin (OMST) were maintained on V8 agar
plates (5% V-8 vegetable juice and 2% agar, pH 5.2). A. parasiticus RHN1, a NiaD
(nitrate reductase) mutant
derived from SRRC 2043, served as the recipient strain for fungal
transformation. Czapek solution agar (Difco, Detroit, Mich.)
supplemented with 0.6 M KCl was used as the protoplast regeneration
medium. Cove's medium (12) containing 10 mM ammonium or 10 mM nitrite was used as aflatoxin conducive and nonconducive medium,
respectively, in preparation of mycelia for total RNA isolation for
Northern blot analysis. Transformants were grown on potato dextrose
agar (PDA) (Difco) to detect precursor accumulation. Adye and Mateles
(A&M) (1) medium was used to grow submerged cultures for
analysis of aflatoxin precursors, preparation of genomic DNA, and total
RNA for reverse transcription-PCR of adhA cDNA.
Isolation of adhA. The 2.5-kb region downstream of aflR in plasmid pHX (8) was completely sequenced by Sanger's dideoxy chain termination method and analyzed by using the Basic Local Alignment Search Tool. The DNA sequence proximate to the XbaI site encoded a short stretch of 48 amino acids, including a glycine-rich loop that had approximately 40 to 50% identity to various dehydrogenases and ketoreductases that belong to the short-chain alcohol dehydrogenase family. The genomic DNA, a 0.8-kb XbaI fragment, beyond the XbaI site was subcloned from plasmid pHH (8). Nucleotide and deduced amino acid sequences indicated that the majority of an open reading frame, designated adhA, was present in this 0.8-kb region.
Sequencing of adhA cDNA. First-strand cDNA was synthesized with 1 µg of total RNA prepared from a 48-h culture with a 1ST-STRAND cDNA Synthesis kit (Clontech, Palo Alto, Calif.). One-tenth (10 µl) of the resultant first-strand cDNA reaction mixture was used in PCR with UlTma polymerase (Perkin-Elmer Cetus, Norwalk, Conn.) and primers 5'-AAAAGCTTAAGGCAATAGGCATACCGTA-3' and 5'-AAAGAATTCTGGATACAACCGTTGAC-3'. The PCR products were directly cloned with a TA Cloning kit (Invitrogen Corp., San Diego, Calif.). Dideoxy sequencing was performed on several cloned inserts from both directions with a sequencing kit (Amersham Pharmacia Biotech, Piscataway, N.J.).
Construction of the adhA disruption vector and fungal transformation. The adhA disruption vector, pADD, was constructed using a three-step procedure. First, a 369-bp portion of adhA was cloned into pUC18. To accomplish this, PCR primers were constructed matching nucleotides (nt) 147 to 168 and nt 497 to 516 in the adhA gene. In the forward primer (ATATAAGCTTCTAGAGACGGGGCAGAACATC), a HindIII site (boldface type) was placed in front of the gene's XbaI site (underlined), and in the reverse complementary primer (ACAAGTCACTGATCCTCATGGTCGACAATT), a SalI site was added 5' to the sequence. The PCR product was digested with HindIII and SalI and cloned into the same sites in pUC18. Second, a 282-bp SalI-XbaI fragment of adhA (nt 742 to 1024) was cloned into the SalI and XbaI sites of the above construct. Third, a 6.7-kb XbaI fragment containing the niaD gene from A. parasiticus (10) was cloned into the unique SalI site by blunt-end ligation. The resulting adhA disruption construct lacked a 225-bp region including the sequence that encodes the YPASK motif involved in the active site of the putative enzyme. Plasmid pADD was linearized with XbaI to release the portion derived from pUC18 before fungal transformation, which was carried out as previously described (19).
Sequence determination of adhA from A. parasiticus SRRC 2043 and the duplicated copy in A. parasiticus SU-1. The PCR primers 5'-TAAGGGCGGAGAGAGAGAGAGAGAG-3' and 5'-GGATATGAATGGTAGACTATGCTCA-3', corresponding to the N-terminal and C-terminal ends of the deduced coding region of the adhA gene, were used with either SRRC 2043 genomic DNA or cosmid Ver2 (21) as templates. The PCR products were directly sequenced with an ABI Prism 377 fluorescent dye automatic sequencer.
Northern blot analysis of the adhA transcript. A. parasiticus SU-1 spores (~107) were inoculated into 100 ml of Cove's medium (12) containing either 10 mM ammonium or 10 mM nitrite as the sole nitrogen source. We isolated total RNA from fungal cultures grown at 30°C for 3 days with orbital shaking (150 rpm) by using a hot phenol extraction protocol (23), and hybridization was performed using adhA cDNA as a probe.
TLC. Mycelia from fungal cultures were extracted with acetone and chloroform (4:1, vol/vol), and the pigments were separated by silica gel thin-layer chromatography (TLC) with toluene-ethyl acetate-acetic acid (50:30:4, vol/vol/vol) as previously described (24). Compounds on the scale-up analytical TLC plates were scraped and eluted from the silica gel matrix by immersion for 4 h in acetone. The acetone solutions were filtered through a 0.2-µm-pore-size PTFE filter prior to mass spectrometry.
Mass spectrometric analysis. Two mass spectrometers were used for structural characterizations. For electron impact (EI) and chemical ionization (CI) analyses a Micromass Autospec EBE magnetic sector instrument (Altrincham, Manchester, United Kingdom) was used. Samples were directly inserted into the source region using a heated probe. EI mass spectrometry was conducted at 70 eV, and methane gas was used for CI mass spectrometry. Electrospray ionization mass spectra were obtained using a Micromass Quattro II triple quadrupole mass spectrometer (Altrincham). Samples were first dissolved in acetone before being mixed with methanol in a 1:1 volume ratio and directly infused at a flow rate of 5 µl/min using a Harvard Apparatus syringe driver (South Natick, Mass.). The analyses were carried out in both positive-ion and negative-ion mode.
Nucleotide sequence accession number. The GenBank accession number for the adhA gene of A. parasiticus SU-1 is U76621.
| |
RESULTS |
|---|
|
|
|---|
Isolation and characterization of adhA.
Chromosome
walking between aflR and norA in the aflatoxin
gene cluster in A. parasiticus SU-1 (6, 26, 34)
yielded an open reading frame, named adhA, that was
transcribed in the same direction as norA and located
approximately 2.5 kb from aflR. This gene contains no
introns based on a comparison of the genomic and cDNA sequences.
Expression of this gene in A. parasiticus SU-1 grown in
aflatoxin-conducive, ammonium-containing medium gave an approximately
1-kb mRNA, but expression could not be detected in a nonconducive
medium containing nitrite as the sole nitrogen source (Fig.
2). This result was the same as that for
known aflatoxin biosynthetic genes, such as nor1,
ver1, and omtA (unpublished results). A search of
the GenBank DNA sequence database with the Basic Local Alignment Search
Tool protocol indicated that adhA encoded a protein with 50 to 65% amino acid sequence similarity to proteins in the short-chain
alcohol dehydrogenase family. Two functional motifs are conserved in
the short-chain alcohol dehydrogenase family (13, 18). The
first motif was GGASGIG (residues 22 to 28) in ADHA, a glycine-rich loop required for interaction with
NAD+-NADP+, and the second motif was
YPASK (residues 187 to 191), a conserved portion
of the alcohol dehydrogenase catalytic active site. The short-chain
alcohol dehydrogenase family consists of a wide variety of
dehydrogenases, including those with a specific C-terminal extension,
and with a reductase C terminus. ADHA is a typical short-chain alcohol
dehydrogenase based on Pfam (Protein families database of alignments
and HMMs) analysis (3). In contrast, besides the two
conserved motifs, NOR1 encoded by the A. parasiticus nor1
(stcE in Aspergillus nidulans) (5, 30) contains a not-well-defined Pfam-B-7 domain. VER1 encoded by A. parasiticus ver1 (stcU in A. nidulans)
(5, 29) contains a reductase C terminus. NOR1 and VER1 both
function as a ketoreductase (29, 30, 36). A comparison of
the adhA sequence to that of the 60-kb sterigmatocystin gene
cluster (GenBank accession number U34740) suggests that A. nidulans stcG is a homolog of adhA.
|
Sequence analysis of the duplicated adhA gene of
SU-1.
Gene duplication has been reported for some of the aflatoxin
biosynthetic genes in a few A. parasiticus strains (20,
21). An approximately 12-kb region of the known 80-kb aflatoxin
gene cluster (28, 31, 34) is duplicated in A. parasiticus SU-1 (21, 31). To determine if the second
copy of adhA has a nucleotide change(s) that could affect
the function of deduced ADHA in SU-1, we used PCR to amplify the gene
from the cosmid Ver2 (21), which contains the partially
duplicated region of the aflatoxin gene cluster. The duplicated
adhA (adhA1) had eight nucleotide substitutions; three of them are silent mutations and five that would result in amino
acid substitutions are at positions 89 (A
G; Q
R), 94 (A
G;
K
E), 124 (G
T; G
C), 344 (C
T; A
V), and 417 (C
A; D
E). One of these, the replacement of guanine by thymine at nt 124, would
result in conversion of Gly26 to Cys in the glycine-rich loop, which
might affect the binding of NAD+-NADP+.
Disruption of adhA in A. parasiticus SRRC
2043.
Previous studies of norA and aflR have
suggested that the region containing these two genes is not duplicated
in SRRC 2043 (7; unpublished results). The
adhA gene of SRRC 2043 is identical to the adhA
gene of SU-1. We used the vector pADD to disrupt the adhA
gene in SRRC 2043. Eight of more than 200 transformants produced bright-yellow pigment(s) on PDA plates, indicative of the occurrence of
gene disruption events. These strains were otherwise morphologically identical to the recipient strain and to transformants that did not
accumulate the bright-yellow pigment(s). PCR amplification with primers
encompassing the adhA coding region, or the niaD vector and the adhA flanking regions beyond the
XbaI sites of pADD (Fig. 3),
indicated that the adhA gene in the four pigmented transformants we examined was disrupted (data not shown). We also made
Southern analyses with DNA from one of the disruptants, ADD#1, and from
the niaD transformant, SL82. The restriction patterns of
ADD#1 obtained with BamHI and EcoRI were
different from those of SL82 (Fig. 4);
the adhA probe hybridized to a 5.0-kb BamHI and a
4.0-kb EcoRI fragment, respectively, in SL82. In contrast, the adhA probe hybridized to 3.0- and 3.9-kb
BamHI fragments as well as to 1.6- and 6.2-kb
EcoRI fragments in ADD#1. These restriction patterns are
consistent with a double crossover between the linearized pADD
disruption vector and the resident adhA gene of SRRC 2043, thereby introducing restriction sites from the niaD insert
(Fig. 3).
|
|
Identification of metabolites accumulated by adhA
disruptants.
The four adhA disruptants examined
accumulated mainly HAVN. OMST also was produced by the adhA
disruptants, but the amount of OMST was about one-tenth of that
produced by the parental strain RHN1 when equal volumes of extracts
were loaded on the TLC plate (Fig. 5).
HAVN was not detectable in the colonies of untransformed RHN1. The
yellow band at Rf = 0.44 comigrated with an
authentic HAVN standard (32). After the TLC plate was
sprayed with a 1% solution of Naturstoffreagenz A (NA)
(
-aminodiethylester of diphenylboric acid) in methanol, the putative
HAVN spot turned purple, a color change characteristic of
anthraquinones with an uncyclized side chain at position 2. The
identification of this metabolite as HAVN (molecular weight [MW] = 388) was confirmed by mass spectrometry of the band eluted into
acetone. Using electrospray negative-ion mass spectrometry, a peak was
found at m/z 387, corresponding to the
[M
H]
ion of HAVN.
|
H]
ion
at m/z 369 (AVNN; MW = 370), the CI mass spectrum (MS)
indicated the presence of the [M+H]+ ion at
m/z 371, and the EI MS showed a molecular ion
(M+) at m/z 370. In contrast, AVF (MW = 368) had a molecular peak corresponding to the [M
H]
ion at m/z 367 as determined by electrospray MS, a molecular peak corresponding to the [M+H]+ ion at m/z
369 as determined by CI MS, and an M+ ion at m/z
368 as determined by EI MS. Besides AVNN, an unknown compound
(Rf = 0.56 [Fig. 5, lane 3]) gave an
[M
H]
band on negative-ion electrospray mass
spectrometry at m/z 357, indicating a metabolite with a mass
of 358. This metabolite accumulated in larger amounts in the 5-day-old
cultures than in the 2-day-old culture. On being sprayed with NA
reagent, the spot turned purple rather than pink, suggesting that it is
an anthraquinone with a noncyclized hydrocarbon side chain.
| |
DISCUSSION |
|---|
|
|
|---|
The transcription pattern of adhA is consistent with that of other aflatoxin biosynthetic genes; i.e., transcription occurs when the fungus is grown in aflatoxin conducive medium containing glucose and ammonium but is suppressed in nonconducive medium in which ammonium is replaced by nitrite or nitrate (9).
The deduced ADHA protein contains two distinct motifs, GXXXGXG and
YXXXK, found exclusively in short-chain alcohol dehydrogenases. Disruption of the adhA gene results in the accumulation of
mainly HAVN in 2-day-old cultures. These results strongly suggest that adhA encodes a dehydrogenase that is involved in
dehydrogenation of HAVN. Oxidation of the 5'-hydroxyl moiety of HAVN
would lead to formation of 5'-ketoaverantin, the open-chain form of AVF
(Fig. 1). Spontaneous intramolecular ketalization between the resultant ketone and the two adjacent hydroxyls then could lead to formation of
the closed form of AVF [(1'S,5'R)-averufin]
(14, 32). Dutton (14) proposed that the enzyme
responsible for oxidation of the 5'-hydroxy moiety of HAVN is the same
dehydrogenase that catalyzes the reversible reaction of NOR
AVN.
The results from this study argue against this hypothesis, since
the adhA disruptants do not accumulate NOR.
The accumulation of a small amount of OMST in the adhA
disruptants suggests that other enzymes or alternative pathways may exist in the fungi for the conversion of HAVN to AVF. Yabe et al.
(32) showed that when A. parasiticus was cultured
in aflatoxin nonconducive YEP (yeast extract-peptone) medium, which
normally inhibits the transcription of aflatoxin biosynthetic genes
(15, 22), no enzymatic activities responsible for the
conversion of NOR
AVN
HAVN were detected from the cell extract, but
a limited conversion of HAVN to AVF was observed in the presence of
NAD+ when the cytosol fraction of the extract was used.
Their findings might mean that enzyme activities similar to that of
ADHA, but not associated with aflatoxin biosynthesis, convert HAVN to
AVF. This hypothesis, however, does not exclude the possibility that adhA expression might not be completely repressed in YEP
medium. Overlapping enzymatic activities have been implicated in
another aflatoxin biosynthetic step, the conversion of NOR to AVN
(6, 11, 30). Using NOR-agarose chromatography, Chuturgoon
and Dutton (11) isolated a 140-kDa dehydrogenase that
carries out the conversion of NOR
AVN. Yet another gene,
norA, in the aflatoxin gene cluster encodes a 43-kDa protein
that demonstrates a reductase activity similar to that of NOR1
(6). Disruption of the single copy of nor1 in
A. parasiticus, a gene which encodes a 31-kDa ketoreductase
that reduces NOR to AVN, resulted in strains that accumulated NOR and
aflatoxins, although in reduced amounts compared to the strains with
intact nor1 (30).
In addition to OMST, AVNN and another metabolite (MW = 358) accumulated in the cultures depending on the length of time of incubation. The 5-day-old cultures accumulated small amounts of AVNN, but the 2-day-old adhA disruptants produced very little AVNN in A&M medium and on PDA plates. McCormick et al. (24) proposed that AVNN is an intermediate in the conversion of AVN to AVF. However, Yabe et al. (32) did not detect the conversion of AVNN to aflatoxins in their feeding experiments; they also reported the lack of formation of AVNN in the conversion of NA to AVF with cell extracts. Based on the study of McCormick et al. (24), Dutton (14) suggested that AVNN is derived from HAVN by dehydration and acts as a side shunt at the HAVN level. Yabe et al. (33), on the other hand, noticed that rapid drying of HAVN results in AVNN. In spite of the controversy with respect to placement of AVNN in the aflatoxin biosynthetic pathway, it has been agreed upon by all researchers that dehydration of HAVN is essential for the formation of AVNN (14, 24, 25, 26, 32, 33).
No conclusions can be drawn from this study with regard to AVNN, i.e., if it is produced enzymatically or formed spontaneously. Nonetheless, based on the presence of conserved motifs and adhA gene disruption, we conclude that ADHA is a dehydrogenase involved in the dehydrogenation of the 5'-hydroxy moiety of HAVN in the formation of AVF. Since OMST is still formed by the adhA disruptants, other dehydrogenases, either belonging to the aflatoxin pathway or made for other processes, may be able to oxidize HAVN to AVF, thereby avoiding the adhA genetic block. The fact that no dehydratase activity including aflatoxin-specific activity or activity of nonspecific origin has been shown to convert HAVN to AVNN and that no gene encoding a dehydratase has been found in the aflatoxin pathway gene cluster suggests that AVNN is probably a nonenzymatic by-product.
| |
ACKNOWLEDGMENT |
|---|
We thank J. E. Linz for providing the cosmids that made this study possible.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Southern Regional Research Center, Agricultural Research Service, U.S. Department of Agriculture, 1100 Robert E. Lee Blvd., New Orleans, LA 70124. Phone: (504) 286-4208. Fax: (504) 286-4419. E-mail: pkchang{at}nola.srrc.usda.gov.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Adye, J., and R. I. Mateles. 1964. Incorporation of labeled compounds into aflatoxin. Biochim. Biophys. Acta 86:418-420. |
| 2. | Aucamp, P. J., and C. W. Holzapfel. 1970. Polyhydroxyanthraquinones from Aspergillus versicolor, Aspergillus nidulans and Bipolaris sp. Their significance in relation to biogenetic theories of aflatoxin B1. S. Afr. Chem. Inst. J. 23:40-56. |
| 3. |
Bateman, A.,
E. Birney,
R. Durbin,
S. R. Eddy,
R. D. Finn, and E. L. L. Sonnhammer.
1999.
Pfam 3.1: 1313 multiple alignments and profile HMMs match the majority of proteins.
Nucleic Acids Res.
27:260-262 |
| 4. | Bhatnagar, D., K. C. Ehrlich, and T. E. Cleveland. 1992. Oxidation-reduction reactions in biosynthesis of secondary metabolites, p. 255-286. In D. Bhatnagar, E. B. Lillehoj, and D. K. Arora (ed.), Handbook of applied mycology, vol. 5. Mycotoxins in ecological systems. Marcel Dekker, Inc., New York, N.Y. |
| 5. |
Brown, D. W.,
J. H. Yu,
H. S. Kelkar,
M. Fernandes,
T. C. Nesbitt,
N. P. Keller,
T. H. Adams, and T. J. Leonard.
1996.
Twenty-five coregulated transcripts define a sterigmatocystin gene cluster in Aspergillus nidulans.
Proc. Natl. Acad. Sci. USA
93:1418-1422 |
| 6. | Cary, J. W., M. Wright, D. Bhatnagar, R. Lee, and F. S. Chu. 1996. Molecular characterization of an Aspergillus parasiticus dehydrogenase gene, norA, located on the aflatoxin biosynthesis gene cluster. Appl. Environ. Microbiol. 62:360-366[Abstract]. |
| 7. | Cary, J. W., N. Barnaby, K. C. Ehrlich, and D. Bhatnagar. 1999. Isolation and characterization of experimentally induced, aflatoxin biosynthetic pathway deletion mutants of Aspergillus parasiticus. Appl. Microbiol. Biotechnol. 51:808-812[CrossRef][Medline]. |
| 8. |
Chang, P.-K.,
J. Cary,
D. Bhatnagar,
T. E. Cleveland,
J. W. Bennett,
J. E. Linz,
C. P. Woloshuk, and G. A. Payne.
1993.
Cloning of the Aspergillus parasiticus apa-2 gene associated with the regulation of aflatoxin biosynthesis.
Appl. Environ. Microbiol.
59:3273-3279 |
| 9. | Chang, P.-K., K. C. Ehrlich, J. Yu, D. Bhatnagar, and T. E. Cleveland. 1995. Increased expression of Aspergillus parasiticus aflR, encoding a sequence-specific DNA-binding protein, relieves nitrate inhibition of aflatoxin biosynthesis. Appl. Environ. Microbiol. 61:2372-2377[Abstract]. |
| 10. | Chang, P.-K., K. C. Ehrlich, D. Bhatnagar, J. E. Linz, T. E. Cleveland, and J. W. Bennett. 1996. Characterization of the Aspergillus parasiticus niaD and niiA gene cluster. Curr. Genet. 30:68-75[CrossRef][Medline]. |
| 11. | Chuturgoon, A. A., and M. F. Dutton. 1991. The affinity purification and characterization of a dehydrogenase from Aspergillus parasiticus involved in aflatoxin B1 biosynthesis. Prep. Biochem. 21:125-140[Medline]. |
| 12. | Cove, D. J. 1966. The induction and repression of nitrate reductase in the fungus Aspergillus nidulans. Biochim. Biophys. Acta 113:51-56[Medline]. |
| 13. | de Pouplana, L., and L. A. Fothergill-Gilmore. 1994. The active site architecture of a short-chain dehydrogenase defined by site-directed mutagenesis and structure modeling. Biochemistry 33:7045-7055. |
| 14. |
Dutton, M. F.
1988.
Enzymes and aflatoxin biosynthesis.
Microbiol. Rev.
52:274-295 |
| 15. |
Feng, G. H.,
F. S. Chu, and T. J. Leonard.
1992.
Molecular cloning of genes related to aflatoxin biosynthesis by differential screening.
Appl. Environ. Microbiol.
58:455-460 |
| 16. | Heathcote, J. G., and M. F. Dutton. 1969. New metabolite of Aspergillus flavus. Tetrahedron 25:1497-1500[CrossRef]. |
| 17. | Holker, J. S. E., S. A. Kagal, L. J. Mulheirn, and P. M. White. 1966. Some new metabolites of Aspergillus versicolor and a revised structure of averufin. J. Chem. Soc. Sect. D. 24:911-913. |
| 18. | Holm, L., C. Sander, and A. Murzin. 1994. Three sisters, different names. Nat. Struct. Biol. 1:146-147[CrossRef][Medline]. |
| 19. | Horng, J. S., P.-K. Chang, J. J. Pestka, and J. E. Linz. 1990. Development of a homologous transformation system for Aspergillus parasiticus with the gene encoding nitrate reductase. Mol. Gen. Genet. 224:294-296[CrossRef][Medline]. |
| 20. | Kusumoto, K., K. Mori, Y. Nogata, H. Ohta, and M. Manbe. 1996. Homologs of the aflatoxin biosynthetic gene ver-1 in strains of Aspergillus oryzae and related species. J. Ferm. Bioeng. 82:161-164[CrossRef]. |
| 21. | Liang, S.-H., C. D. Skory, and J. E. Linz. 1996. Characterization of the function of the ver-1A and ver-1B genes, involved in aflatoxin biosynthesis in Aspergillus parasiticus. Appl. Environ. Microbiol. 62:4568-4575[Abstract]. |
| 22. |
Liu, B.-H., and F. S. Chu.
1998.
Regulation of aflR and its product, AflR, associated with aflatoxin biosynthesis.
Appl. Environ. Microbiol.
64:3718-3723 |
| 23. | Maramatsu, M. 1973. Preparation of RNA from animal cells. Methods Cell Biol. 7:23-51[Medline]. |
| 24. |
McCormick, S. P.,
D. Bhatnagar, and T. E. Cleveland.
1987.
Averufanin is an aflatoxin B1 precursor between averantin and averufin in the biosynthetic pathway.
Appl. Environ. Microbiol.
53:14-16 |
| 25. | Minto, R. E., and C. A. Townsend. 1997. Enzymology and molecular biology of aflatoxin biosynthesis. Chem. Rev. 97:2537-2555[CrossRef][Medline]. |
| 26. | Payne, G. A., and M. P. Brown. 1998. Genetics and physiology of aflatoxin biosynthesis. Annu. Rev. Phytopathol. 36:329-362[CrossRef][Medline]. |
| 27. | Prieto, R., G. L. Yousibova, and C. P. Woloshuk. 1996. Identification of aflatoxin biosynthesis genes by genetic complementation in an Aspergillus flavus mutant lacking the aflatoxin gene cluster. Appl. Environ. Microbiol. 62:3567-3571[Abstract]. |
| 28. |
Silva, J. C.,
R. E. Minto,
C. E. Barry III,
K. A. Holland, and C. A. Townsend.
1996.
Isolation and characterization of the versicolorin B synthase gene from Aspergillus parasiticus. Expansion of the aflatoxin B1 biosynthetic gene cluster.
J. Biol. Chem.
271:13600-13608 |
| 29. |
Skory, C. D.,
P.-K. Chang,
J. Cary, and J. E. Linz.
1992.
Isolation and characterization of a gene from Aspergillus parasiticus associated with the conversion of versicolorin A to sterigmatocystin in aflatoxin biosynthesis.
Appl. Environ. Microbiol.
58:3527-3537 |
| 30. |
Trail, F.,
P.-K. Chang,
J. Cary, and J. E. Linz.
1994.
Structural and functional analysis of the nor-1 gene involved in the biosynthesis of aflatoxins by Aspergillus parasiticus.
Appl. Environ. Microbiol.
60:4078-4085 |
| 31. | Trail, F., N. Mahanti, R. Mehigh, S.-H. Liang, R. Zhou, M. Rarich, and J. E. Linz. 1995. A physical and transcriptional map of the aflatoxin gene cluster in Aspergillus parasiticus and the functional disruption of a gene involved early in the aflatoxin pathway. Appl. Environ. Microbiol. 61:2665-2673[Abstract]. |
| 32. |
Yabe, K.,
Y. Nakamura,
H. Nakajima,
Y. Ando, and T. Hamasaki.
1991.
Enzymatic conversion of norsolorinic acid to averufin in aflatoxin biosynthesis.
Appl. Environ. Microbiol.
57:1340-1345 |
| 33. |
Yabe, K.,
Y. Matsuyama,
Y. Ando,
H. Nakajima, and T. Hamasaki.
1993.
Stereochemistry during aflatoxin biosynthesis: conversion of norsolorinic acid to averufin.
Appl. Environ. Microbiol.
59:2486-2492 |
| 34. | Yu, J., P.-K. Chang, J. W. Cary, M. Wright, D. Bhatnagar, T. E. Cleveland, G. A. Payne, and J. E. Linz. 1995. Comparative mapping of aflatoxin pathway gene clusters in Aspergillus parasiticus and Aspergillus flavus. Appl. Environ. Microbiol. 61:2365-2371[Abstract]. |
| 35. | Yu, J., P.-K. Chang, D. Bhatnagar, and T. E. Cleveland. 1997. avnA, encoding a putative P-450 monooxygenase, is involved in the conversion of averantin to averufin in aflatoxin biosynthesis in Aspergillus parasiticus. Appl. Environ. Microbiol. 63:1349-1356[Abstract]. |
| 36. |
Zhou, R., and J. E. Linz.
1999.
Enzymatic function of the Nor-1 protein in aflatoxin biosynthesis in Aspergillus parasiticus.
Appl. Environ. Microbiol.
65:5639-5641 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»