Previous Article | Next Article 
Applied and Environmental Microbiology, November 2000, p. 4998-5004, Vol. 66, No. 11
0099-2240/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Purification and Properties of an Enzyme Capable of
Degrading the Sheath of Sphaerotilus natans
Minoru
Takeda,*
Keishi
Iohara,
Sachie
Shinmaru,
Ichiro
Suzuki, and
Jun-Ichi
Koizumi
Division of Materials Science and Chemical
Engineering, Faculty of Engineering, Yokohama National University,
Tokiwadai 79-5, Hodogaya, Yokohama 240-8501, Japan
Received 25 May 2000/Accepted 6 September 2000
 |
ABSTRACT |
Microorganisms which can degrade and grow on the purified sheath of
a sheathed bacterium Sphaerotilus natans were collected from soil and river water. Two bacterial strains were isolated from the
soil and designated strains TB and TK. Both strains are rod shaped,
negatively stained by gram staining, facultatively anaerobic, and
formed ellipsoidal endospores. These characteristics suggested that the
isolates belong to the genus Paenibacillus, according to Ash et al. (C. Ash, F. G. Priest, and M. D. Collins, Antonie Leeuwenhoek 64:253-260, 1993). Phylogenetic analysis
based on the 16S rDNA supported this possibility. Purification of the sheath-degrading enzyme was carried out from the culture broth of
strain TB. The molecular weight of the enzyme was calculated to be
78,000 and 50,000 by sodium dodecyl sulfate-polyacrylamide electrophoresis and gel filtration chromatography, respectively. Enzyme
activity was optimized at pH 6.5 to 7.0 and 30 to 40°C. The reaction
was accelerated by the addition of Mg2+, Ca2+,
Fe3+, and iodoacetamide, whereas it was inhibited by the
addition of Cu2+, Mn2+, and dithiothreitol. The
enzyme acted on the polysaccharide moiety of the sheath, producing an
oligosaccharide the size of which was between the sizes of
maltopentaose and maltohexaose. As the reaction proceeded, the
absorbance at 235 nm of the reaction mixture increased, suggesting the
generation of unsaturated sugars. Incorporation of unsaturated
sugars was also suggested by the thiobarbituric acid reaction. It is
possible that the enzyme is not a hydrolytic enzyme but a kind of
polysaccharide eliminase which acts on the basic polysaccharide.
 |
INTRODUCTION |
Sphaerotilus natans is
one of the sheathed bacteria that construct a tube-like sheath
surrounding each cell and is often referred to as one of the
filamentous bacteria which cause poor settling problems (bulking) in
activated sludge (23). There are two genera of sheathed
bacteria, Sphaerotilus, which is often found in polluted streams, and Leptothrix, which is a typical
inhabitant of metal-rich streams. Because of their similarities in
morphological and physiological characteristics, the classification
"Sphaerotilus-Leptothrix group" has been proposed
(23). Their similarity has been further confirmed by
phylogenetic analysis based on 16S rRNA sequences (17, 18). The sheaths of both genera are a complex of protein and polysaccharide (5, 20). The sheath of S. natans is extremely
rich in cysteine and contains galactosamine (or
N-acetylgalactosamine) and glucose as sugar components
(20). The sugar components of the sheath of Leptothrix
discophora are N-acetylgalactosamine and uronic acids,
and its protein moiety is rich in cysteine (5). The sheath
of L. discophora is easily broken down by the addition of
disulfide bond-reducing reagents, suggesting that the fibrous matrix
composed of heteropolysaccharide and peptide is cross-linked by
disulfide bonds and constructs a sheath structure (6). In contrast, the sheath of S. natans is resistant to disulfide
bond-reducing reagents (20). Decomposition of the sheath of
S. natans is achieved by selective cleavage of amide bonds
by the addition of hydrazine releasing heteropolysaccharide composed of
glucose and galactosamine (20). It can be assumed that the
sheath of S. natans is constructed by covalent cross-linking
of the polysaccharide and peptide.
No attempts to elucidate the chemical structures of bacterial sheaths
have been carried out. A promising way of analyzing the structure of
such complicated macromolecules is to decompose them into the
constitutional units by applying specific degrading enzymes. For
example, the structure of murein was elucidated by analyzing the
enzymatic products of lysozyme. However, no proteases or glucanases
which achieve bacterial sheath degradation have ever been known.
In the present study, we searched for bacteria capable of growth
on the sheath of S. natans and attempted to purify
sheath-degrading enzymes potentially applicable for elucidation of the
sheath structure.
 |
MATERIALS AND METHODS |
Preparation of sheath and sheath polysaccharide.
The sheath
of S. natans IFO 13543T was prepared by the
method previously described (20). The sheath polysaccharide
was prepared by the following procedure. The sheath (20 mg) was
suspended in 20 ml of 3 N NaOH and allowed to settle at 30°C for 3 days under an N2 or Ar atmosphere. After the solution was
acidified to pH 2 to 3 by the addition of 2 N HCl, it was filtered
through a glass filter to remove the residual sheath. Two volumes of
ethanol was added to the filtrate, and the released
polysaccharide was precipitated. The precipitate was rinsed with
cold 70% ethanol, dissolved in distilled water, and dialyzed against
distilled water. The dialysate (deacetylated sheath polysaccharide) was
lyophilized (about 10 mg), and N-acetylation was performed
as follows. The deacetylated sheath polysaccharide was dissolved in 10 ml of saturated NaHCO3 solution. While mixing the solution
at room temperature, 2 ml of acetic anhydride was added 5 times at
15-min intervals. After the last addition of acetic anhydride, the
solution was further stirred for 30 min to complete the reaction. The
solution was passed through a column of Amberlite 50W-X8
(H+) (2.5 by 20 cm) and then dialyzed against distilled
water. The N-acetylated sheath polysaccharide was obtained
by lyophilization of the dialysate.
Screening and isolation of sheath-degrading bacteria.
Soils
and river waters were collected from 20 and 10 sites, respectively, in
Kanagawa Prefecture, Japan. The screening medium was composed of the
following: sheath, 0.1 g/liter; NaNO3, 2 g/liter; K2HPO4, 0.1 g/liter; MgSO4 · 7H2O, 0.5 g/liter; KCl, 0.5 g/liter; and
FeSO4 · 7H2O, 0.01 g/liter. To the
flasks (100 ml) containing 20 ml of screening medium, about 0.2 g
of soil or 1 ml of water was added, and the mixture was allowed to
settle at 30°C for 2 weeks. In one culture inoculated with wet garden
soil, sheath flocs disappeared. A portion of this culture (0.1 ml) was
transferred into a flask containing fresh sheath medium and incubated
for 1 week, with this procedure being repeated eight times. A loopful of culture was then streaked on agar plates composed of 0.05 g of beef
extract/liter and incubated at 30°C. Colonies that formed on the
plates were reinoculated into the screening medium to test sheath
degradation. A bacterial strain capable of sheath degradation was
obtained and was designated strain TB.
Another sheath-degrading bacterium was isolated from the soil by the
following procedure. Soils were collected from 10 sites in Yamanashi
Prefecture, Japan. One soil sample exhibited sheath decomposition in
the screening medium. After reinoculation into the same medium five
times, the culture was heat treated at 50°C for 24 h. A
sheath-degradable bacterium isolated on the beef extract agar plates
was designated strain TK.
Cultivation and characterization of the isolates.
Strains TB
and TK were cultured in the sheath medium composed of the following:
sheath, 0.1 g/liter; Proteose Peptone no. 3 (Difco), 2 g/liter;
K2HPO4, 0.1 g/liter; MgSO4 · 7H2O, 0.5 g/liter; KCl, 0.5 g/liter; and
FeSO4 · 7H2O, 0.01 g/liter. Unless
otherwise described, the strains were inoculated into 20 ml of the
medium contained in a 100-ml flask and were statically cultured at
30°C. To test the utilization of several organic compounds as sole
carbon and nitrogen sources, liquid media and solid media (solidified with 1.5% agar) composed of 0.05% beef extract, tryptone, yeast extract, Bacto Peptone, Proteose Peptone no. 3, Casamino Acids, or malt
extract were prepared. Utilization of carbohydrates (including sheath
polysaccharide) was tested using media which had the same composition
as that of the sheath medium, except that the sheath was replaced with
0.1 g of carbohydrate/liter. Utilization of the sheath polysaccharide
was also examined using two other media. One was omitted from Proteose
Peptone but supplied with 0.2 g of
(NH4)2SO4/liter in substitution,
and another was not supplied with any nitrogen sources. Anaerobic
cultivation was performed in a BBL GasPak pouch (Becton Dickinson
Microbiology Systems, Cockeysville, Md.) packed with a flask containing
the sheath medium inoculated with strain TB or TK just before packing.
Phylogenetic analysis.
The DNA of strains TB and TK grown on
the sheath medium was prepared using the GenomicPrep cells and tissue
DNA isolation kit (Amersham Pharmacia Biotech, Little Chalfont,
Buckinghamshire, United Kingdom). Amplification of the 16S rRNA gene
(28-1391, Escherichia coli numbering) was performed using
primers designed to bind 8 to 27 (5'AGAGTTTGATCATGGCTCAG3')
and 1406 to 1392 (5'ACGGGCGGTGTGTAC3'). The product
was cloned into pCR2.1 with the TA cloning method (Invitrogen, San
Diego, Calif.), and the nucleotide sequences were determined using a
373S DNA sequencer (Applied Biosystems, Foster City, Calif.) with dye
dideoxynucleotide terminators. Homology searches were carried out by
the BLASTN program. Multiple alignments were done by Clustal W, and a
phylogenetic tree was drawn by a TREECON package (22) based
on the neighbor-joining method.
Quantification of cell and sheath.
Because strain TB does
not form distinctive colonies on any solid media, it is difficult to
estimate its cell densities by colony counting. The growth of the
bacterium was estimated by counting the number of cells in the culture
with an epifluorescence microscope (Zeiss Axioskop). Culture (10 µl)
was mixed with 1 µl of 0.02% acridine orange solution, applied onto
an agar slide, and covered with a 1.8- by 1.8-mm glass. Average cell
concentration was calculated from observations of 20 to 50 sites.
The sheath amount was estimated by measuring the amount of glucose
incorporated in the sheath. Cell and sheath were precipitated
by
centrifugation. The pellet was suspended in 5 ml of 30 mM Tris-HCl
buffer (pH 8.0) supplemented with 0.5 g of EDTA disodium salt/liter,
5 mg of lysozyme was added, and it was incubated at 37°C for 1
h.
To destroy the cells, 0.5 ml of 10% sodium dodecyl sulfate
(SDS)
solution was added, mixed, and then heated at 110°C for
10 min.
Because the sheath resists these treatments, it was harvested
by
centrifugation and washed with distilled water. The glucose
amount in
the sheath pellet was determined by phenol-sulfuric
acid reaction. The
glucose content of the sheath was calculated
to be around 30% (wt/wt)
by the phenol-sulfuric acid reaction
(
20). The sheath amount
was estimated based on the glucose amount
detected.
Sheath degradation by crude enzyme.
Strain TB was grown on
sheath medium at 20°C for 6 days; cells and residual sheath were
removed by centrifugation, and the culture fluid was passed through a
0.22-µm-pore-size membrane filter. The filtrate was dialyzed against
distilled water at 4°C for 24 h and filtered through a sterile
0.22-µm filter. The filtrate was used as crude enzyme. The crude
enzyme (15 ml) was aseptically added to 20 ml of fresh sheath medium
and incubated at 30°C. A portion (1 ml) of the reaction mixture was
recovered every 24 h and filtered through a membrane filter, and
then the degree of sheath degradation was monitored by determining the
amounts of released saccharide (phenol-sulfuric acid reaction) and
protein. The amount of residual sheath was also measured.
Detection of protease activity.
Azocasein was dissolved in
100 mM Tris-HCl (pH 8.0) with 2 mM CaCl2 to be 5 mg/ml. To
this solution (0.5 ml), 0.1 ml of culture filtrate of strain TB was
added, followed by incubation at 30°C. After 18 h of incubation,
0.4 ml of 15% (wt/vol) trichloroacetic acid was added to terminate the
reaction, the mixture was centrifuged, and 1 ml of the supernatant was
recovered. After neutralization by the addition of 50 µl of 10 M
NaOH, the absorbance at 440 nm was measured.
Purification of sheath polysaccharide-degrading enzyme.
Cultivation of strain TB for enzyme preparation was done in 500-ml
flasks containing 100 ml of medium with shaking at 30°C for 72 h. The supernatant of the culture broth (3 liters) was obtained by
centrifugation and was brought to 90% saturation with ammonium
sulfate. The precipitate formed was collected by centrifugation, suspended in 10 mM Tris-HCl buffer (pH 8.0), and dialyzed against the
same buffer at 4°C. To the dialysate, ammonium sulfate was added to
40% saturation, and the result was filtered through a glass filter.
The filtrate was loaded on a column (2.5 by 17 cm) of phenyl-Toyopearl
650M (Tosoh, Tokyo, Japan) preequilibrated with 10 mM Tris-HCl buffer
(pH 8.0) supplemented with ammonium sulfate (40% saturation). After
the column was washed with the equilibration buffer, it was washed with
a linear gradient of ammonium sulfate (40 to 0% saturation) in the
buffer. Sheath polysaccharide-degrading activity was eluted by washing
further with the final buffer.
Assay of sheath polysaccharide-degrading activity.
Sheath
polysaccharide-degrading activity was assayed by measurement of the
rate of the increase in reducing power in the reaction mixture. The
reaction mixture consisted of 0.7 ml of 50 mM Tris-HCl buffer (pH 8.0)
containing 0.2 mg/ml of N-acetylated sheath polysaccharide and an appropriate amount (usually 0.1 ml) of the enzyme. The enzyme
reaction was carried out for 18 h at 30°C. After the reaction, the amount of reducing sugars was determined by the
3,6-dinitrophthalic acid method (10). One unit of enzyme
activity was defined as the quantity of the enzyme which produces a
reducing power equal to 1 µmol of glucose per min.
Protein assays.
The amount of protein was determined by the
Bio-Rad DC protein assay kit (Bio-Rad, Hercules, Calif.) with bovine
serum albumin as a standard. SDS-polyacrylamide gel electrophoresis
(PAGE) was performed on a 5 to 20% gradient gel for assessment of the
purity and estimation of the molecular weight of the enzyme. The gel was stained with Coomassie brilliant blue R-250. Isoelectric focusing in polyacrylamide was performed using an Ampholine PAGplate, pH 3.5 to
9.5 (Pharmacia, Uppsala, Sweden). The molecular mass of the native
enzyme was determined by gel filtration chromatography with Sephacryl
S-300 (Pharmacia). The size of the column was 1.5 by 50 cm, and the
mobile phase was 66 mM phosphate buffer (pH 7.0) supplemented with 250 mM NaCl.
Amino acid sequence analysis.
The N-terminal amino acid
sequence was determined with a Shimadzu PPSQ-10 protein sequencer
(Shimadzu, Kyoto, Japan). The enzyme was subjected to SDS-PAGE and then
blotted onto a polyvinylidene difluoride membrane. The enzyme on the
membrane was visualized with Coomassie brilliant blue G-250 and applied
to the protein sequencer. To determine the internal amino acid
sequence, the purified enzyme was subjected to SDS-PAGE together with
V8 protease (about 1/50 mol). Digestion was done at room temperature
for 6 h in the stacking gel (5%) at a low current of 2 to 5 mA,
and then the separation of the digests was done in the running gel (20%) at 25 mA. After SDS-PAGE, the digests were blotted onto a
polyvinylidene difluoride membrane. A major fragment of 18 kDa was
utilized for amino acid sequence analysis.
Analysis of the enzymatic products.
The molecular mass of
the enzymatic digest of deacetylated sheath polysaccharide was
determined by gel filtration chromatography. Deacetylated sheath
polysaccharide (5 mg) was suspended (deacetylated sheath polysaccharide
is insoluble in aqueous solutions under neutral and alkali conditions)
(20) in 0.5 ml of 66.6 mM phosphate buffer (pH 7.0), and the
reaction was then initiated by 0.1 ml of purified enzyme. After
incubation for 18 h at 30°C, the reaction mixture was applied to
a Toyopearl HW-40S column (1.5 by 70 cm). The flow rate was set at 0.5 ml/min. The mobile phase was 10 mM HCl, and the elution of the product
was detected by a refractive index detector.
The monosaccharide composition of the enzymatic digest of sheath
polysaccharide was performed by gas liquid chromatography.
The digest
(originated from 5 mg of sheath polysaccharide) eluted
from the
Toyopearl column was dried under reduced pressure and
used for
analysis. The sample preparation and analytical conditions
were the
same as in the method previously described (
20).
The formation of unsaturated sugars during enzymatic digestion of the
sheath polysaccharide was detected by monitoring the
absorbance at 235 nm based on the generation of double bonds.
The existence of
unsaturated sugars was also confirmed by the
thiobarbituric acid
reaction (
24).
Nucleotide sequence accession numbers.
The nucleotide
sequences of the 16S rRNA gene of strains TB and TK have been deposited
in the DDBJ, EMBL, and GenBank DNA databases under the respective
accession numbers of AB041720 and AB041721.
 |
RESULTS |
Isolation and some properties of sheath-degrading bacteria.
Sheath degradation was not observed in any cultures inoculated with
river water. In a culture supplemented with soils from Kanagawa
Prefecture, the sheath was broken down. From the culture, a bacterial
strain (TB) capable of degrading the sheath was isolated. The colonies
of strain TB on the beef extract agar plate did not exceed 1 mm in
diameter even after incubation for 2 weeks. It took more than a 5-day
incubation to form colonies on the plate. The colony was colorless,
thin, and translucent with a ragged edge and surface. Some of the cells
of TB in the colonies had an ellipsoidal endospore with the sporangium
being swollen (Fig. 1). TB was still
viable after heating at 85°C for 1 h or at 50°C for 24 h,
indicating its spore-forming capability. Most of the cells in the
colonies were slightly curved rods, and their length and width were 1.0 to 10 µm and 0.4 to 0.5 µm, respectively. However, cells grown on
sheath medium were shorter (1.0 to 2.5 µm in length) and were mostly
straight rods. A few spores were observed in sheath medium.

View larger version (164K):
[in this window]
[in a new window]
|
FIG. 1.
Microscopic observation of strain TB. Strain TB was
cultured on a 0.05% beef extract agar plate and incubated at 30°C
for 7 days. Cells were stained with saffronin for microscopic
observation. Note that most rod-shaped cells were irregularly curved,
and some bore thick ellipsoidal spores (see arrowheads). The bar
indicates 10 µm.
|
|
Considering this heat stability, other sheath-degrading bacteria which
have characteristics similar to those of strain TB
were searched. Only
one type of bacterial colony was formed on
the isolation plate, and the
isolate was designated strain TK.
The colony appearance and cell
morphology of strain TK were the
same as those of strain
TB.
Strains TB and TK grown on sheath medium were negatively stained in a
Gram stain even in an early stage of cultivation, and
ellipsoidal
endospores were formed in old cultures, suggesting
they belong to the
genus
Paenibacillus (
1). No pigments were
produced. A few motile cells were observed in younger cultures
(24 to
48 h). Both strains are facultative anaerobes because cell
growth
and sheath degradation were observed under strictly anaerobic
conditions. They did not form colonies anaerobically on plates
of beef
extract, tryptone, or yeast
extract.
A homology search of the GenBank/EMBL/DDBJ databases revealed that the
16S rDNA sequences of strains TB and TK were similar
to those of
bacteria belonging to the genus
Paenibacillus (Fig.
2). A 22-base sequence specific for the
genus
Paenibacillus (
1),
TCGATACCCTTGGTGCCGAAGT, exists in the 16S rDNA of both
strains.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 2.
Phylogenetic network based on 16S rDNA sequences showing
the interrelationships of sheath-degrading bacteria and
Paenibacillus spp. Bootstrap values (100 replications) are
shown near the branch points. Database accession numbers of the
reference sequences are in parentheses. The scale bar indicates 0.05 changes per nucleotide position.
|
|
Effects of culture conditions on the growth of strain TB.
Typical time courses of the degradation of the sheath and the growth of
strain TB in a medium mainly composed of sheath and Proteose Peptone
are shown in Fig. 3. The sheath was
broken down within 100 h, and cell concentration increased in
inverse proportion to the concentration of the residual sheath. Even
when Proteose Peptone was omitted from the medium, strain TB was able
to grow utilizing the sheath as a sole source of carbon and nitrogen. In this case, more than a 7-day cultivation was required to break down
the same amount of sheath. It must be emphasized here that cell growth
did not occur when the sheath was omitted from the medium. Both cell
growth and sheath degradation were most active at pH 7 and at 30°C.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 3.
Typical time courses of sheath degradation by and growth
of strain TB. Strain TB was statically cultured at 30°C in a series
of 500-ml flasks containing 100 ml of a medium composed of sheath
(0.01%), peptone (0.2%), and K2HPO4 (0.1%).
At intervals of 24 h, one flask was taken out and utilized for
determinations of sheath and cells. Symbols: , amount of sheath;
, cell concentration.
|
|
Strain TB could grow on both
N-acetylated and deacetylated
sheath polysaccharide, utilizing them as sole carbon sources in
the
presence of Proteose Peptone or
(NH
4)
2SO
4 as a nitrogen source.
Growth was not observed on either glucose, galactosamine, or
N-acetylgalactosamine,
even when these saccharides were
added together, though these
monosaccharides are components of the
sheath polysaccharide (
20).
Sheath polysaccharides (whether
N-acetylated or deacetylated)
were applicable only as carbon
sources but did not serve as nitrogen
sources because the addition of
Proteose Peptone or (NH
4)
2SO
4 was
required for cell growth on these
polysaccharides.
Enzymatic degradation of sheath.
The
time-dependent changes in concentrations of soluble saccharide
and protein in the sheath medium supplemented with the cell-free
culture filtrate of strain TB are shown in Fig.
4. Both saccharide and protein
concentrations increased with time. The sheath was almost broken down
in 3 days. The heat-treated culture filtrate did not break down the
sheath and released neither saccharide nor protein. The optimum
temperature and pH for sheath degradation by the crude enzyme were
30°C and 7 to 8, respectively. Additionally, no protease activity was
detected in the crude enzyme (culture filtrate) when azocasein was used
as a substrate.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 4.
Release of saccharide and protein during enzymatic
degradation of sheath. Sheath medium supplemented with crude enzyme was
incubated at 30°C. At intervals of 24 h, the amounts of soluble
saccharide ( , based on glucose), protein ( , based on bovine serum
albumin), and residual sheath ( ) were measured. Heat-denatured
(95°C, 30 min) enzyme was prepared and incubated with sheath in the
same manner as the control, with the amounts of saccharide ( ),
protein ( ), and sheath ( ) being measured.
|
|
Purification and molecular weight of the sheath
polysaccharide-degrading enzyme.
In consideration of convenience
and sensitivity, the N-acetylated sheath polysaccharide was
used as a substrate for measuring the sheath-degrading activity. In the
culture of strain TB, the activity of sheath degradation was not
detected at the beginning of cultivation, until 24 h; then it rose
to a maximum at 84 h. Because sufficient activity was already
obtained at 50 h, cultivation for the preparation of
sheath-degrading enzyme was carried out for 72 h. Table
1 shows the recoveries and purities of
the enzyme at each purification step. The enzyme was purified 984-fold
with a 1.5% yield with these purification steps. The purity of the enzyme effectively increased by hydrophobic chromatography. A typical
elution profile of the sheath polysaccharide-degrading activity on a
phenyl-Toyopearl column is shown in Fig.
5. The purity of the enzyme recovered
from the peak eluted with the final buffer was confirmed by SDS-PAGE,
giving one protein band in the position of about 78 kDa (Fig.
6). The molecular mass of the enzyme was
determined to be about 50 kDa by gel filtration chromatography. Rather
low molecular mass in gel filtration may be caused by the interaction
between the enzyme and the resin. The isoelectric point of the
enzyme was determined to be 6.7 by isoelectric focusing. The N-terminal
amino acid sequence of the purified enzyme was determined to be
NH2-ATVYEVGPGKTYTSIGSVPF. The internal sequence of
NH2-EGNYIYGNGN was obtained from the major V8 protease
digest of the TB enzyme. No relative protein was indicated by a BLASTp search based on these two partial amino acid sequences.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 5.
Elution of sheath polysaccharide-degrading activity on
hydrophobic interaction chromatography. Proteins were eluted by
decreasing the concentration of ammonium sulfate in the mobile phase
(······). Fractions of 200 drops were collected to measure
protein concentration ( ) and enzyme activity ( ).
|
|

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 6.
SDS-PAGE analysis of sheath-degrading enzyme from strain
TB. A denatured sheath-degrading enzyme eluted and pooled from a
phenyl-Toyopearl column was separated on a 5 to 20% gradient
polyacrylamide gel and stained with Coomassie brilliant blue. Lane 1, sheath-degrading enzyme; lane 2, molecular mass standards (kDa).
|
|
Factors affecting the activity of the sheath
polysaccharide-degrading enzyme.
The effects of metal ions on the
polysaccharide-degrading activity are summarized in Table
2. K+, Na+,
Ni2+, and Al3+ had little effect on the
activity. Cu2+, Mn2+, and Zn2+
inhibited the enzyme activity by 10 to 94%. In contrast,
Mg2+, Ca2+, and Fe3+ enhanced the
enzyme activity, causing a 23 to 30% stimulation. The effects of
chemical reagents on the enzyme activity were examined, with the
results being shown in Table 3. Sodium
azide and EDTA had no influence on the activity, suggesting that metal
ions were not necessarily required. The serine residue was not supposed to be important to exhibit the enzyme activity because
phenylmethylsulfonyl fluoride and diisopropylfluorophosphate
showed little effect. Strong inhibition was observed with the
addition of dithiothreitol (DTT), revealing the importance of
disulfide bonds to maintain the activity. Carboxylation of
sulfhydryl groups by monoiodoacetic acid resulted in a 27%
decrease in activity. In contrast, carboxyamidation of sulfhydryl
groups by the addition of iodoacetamide extremely accelerated the
reaction, causing a 140% increase in activity. Sulfhydryl groups may
play an important role in sheath depolymerase activity.
The optimum pH for the sheath polysaccharide-degrading activity was in
the range of 7 to 8. The enzyme was most stable at
about pH 7. The
optimum temperature for the enzyme activity was
30 to 40°C. The
enzyme was stable up to 40°C, but it was immediately
inactivated at
70°C. The apparent
Km value at 30°C (pH 8.0)
for
the
N-acetylated sheath polysaccharide generated from a
Lineweaver-Burk
double-reciprocal plot was 43.5 mg/ml. The enzyme
depolymerizes
both
N-acetylated and deacetylated sheath
polysaccharides but
not starch, dextran, cellulose, polygalactosamine,
chitin, or
chitosan, showing a strict substrate
specificity.
Mode of action of the sheath polysaccharide-degrading enzyme.
Polysaccharide-degrading enzymes can be classified into hydrolytic
enzymes and eliminative enzymes (19). The eliminase activity which generates unsaturated oligosaccharides by cleaving glycosidic linkages through an elimination mechanism is known to be detected by
measurement at 235 nm or by interaction with thiobarbituric acid after
periodate oxidation (19). During the degradation of sheath
polysaccharide by the enzyme produced by strain TB, the increase in
absorbance at 235 nm and thiobarbituric acid reaction were observed
(Fig. 7). These increases were observed
whether the N-acetylated or deacetylated sheath
polysaccharide was supplied as an enzyme substrate. From these
results, the sheath polysaccharide-degrading enzyme of strain TB is
suggested to be a kind of eliminase but not a hydrolytic enzyme.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 7.
Generation of unsaturated sugar residues during
enzymatic depolymerization of the sheath polysaccharide.
N-acetylated sheath polysaccharide (1 mg) was
dissolved in 0.5 ml of water, and 0.5 ml of the purified degrading
enzyme (originated from 12.5 ml of culture) in 10 mM Tris-HCl buffer
(pH 8.0) was added. To investigate the generation of unsaturated
sugars, the increase in the absorbance at 235 nm ( ) of the reaction
mixture was monitored with respect to incubation time. A thiobarbituric
acid reaction was also performed, and the generation of unsaturated
sugars was detected by the absorbance at 550 nm ( ).
|
|
The elution profile of the enzymatic product on gel filtration
chromatography is shown in Fig.
8. Buffer
components were eluted
at 110 to 125 min. The negative detector output
at 127 to 138
min was probably due to the elution of water in the
reaction mixture.
A peak at 89 min was found to be the enzymatic
product, because
the fraction was positive to thiobarbituric acid
reaction exhibiting
maximum absorbance at 550 nm. The molecular mass of
the product
was assumed to be a pentamer or hexamer by comparing the
elution
time with those of maltooligosaccharides.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 8.
Gel filtration of sheath polysaccharide digested with
purified enzyme. Deacetylated sheath polysaccharide was digested by
purified enzyme and applied onto a column of Toyopearl HW-40S.
Chromatographic conditions are described in Materials and Methods.
|
|
The monosaccharide composition of the product recovered from the
gel filtration column was investigated by gas liquid
chromatography.
Although the sheath polysaccharide is
formed from glucose and
galactosamine (or
N-acetylgalactosamine) in a molar ratio of 1:4
as previously
reported (
20), the molecular ratio of glucose
and
(
N-acetylated) galactosamine in the purified product was
calculated
to be in the range of 1:2 to 1:3, depending on the
analysis.
 |
DISCUSSION |
A sheath-degrading bacterium strain, TB, can grow on a
sheath as the sole carbon and nitrogen source. However, it
requires some nitrogen sources when cultured on the polysaccharide
prepared from the sheath, suggesting that galactosamine residues cannot be utilized as a nitrogen source. Therefore, the protein moiety of the
sheath was proven to be assimilated as a nitrogen source. Unexpectedly,
no protease activity was detected in the culture filtrate. Sheath
polysaccharide, which is composed of glucose and galactosamine (or
N-acetylgalactosamine) (20), is assumed to be
digested not into monosaccharides but into oligosaccharide(s) because
strain TB cannot utilize either glucose or galactosamine (N-acetylgalactosamine) as carbon sources. Strain TB
was revealed to extracellularly digest the sheath polysaccharide into
oligosaccharide(s) but not into monosaccharides. Probably, the
sheath polysaccharide is constructed by a repeating unit of the
pentasaccharide consisting of one glucose and four galactosamine
residues, considering that the overall composition of the
polysaccharide is glucose and galactosamine in a molar ratio of 1:4
(20). The restricted digestion of the sheath into
specific oligomers should be profitable for strain TB to compete with
other first-growing bacteria of wide substrate utilization if the
specific peptide and oligosaccharide are not easily assimilated by
these competitors.
Because the enzymatic product is positive to thiobarbituric acid
reaction, it can be assumed that the product is incorporated with a
deoxilated sugar residue or an unsaturated sugar residue. An increase
in the absorbance at 235 nm during the enzymatic reaction suggests that
the generation of an unsaturated sugar residue is more probable.
Based on such an assumption, the sheath
polysaccharide-degrading enzyme is considered to be not
a hydrolytic enzyme but an eliminase-type enzyme. A number of
polysaccharide eliminases (lyases) (EC 4.2.2) which depolymerize acidic
polysaccharides, such as alginate, hyaluronate, chondroitin, heparin,
xanthan, and emulsan, are known (19). Lyases are defined as
a class of eliminative enzymes that act on a wide variety of acidic
polysaccharides degraded into oligomers incorporated with unsaturated
derivatives of uronic acids at the nonreducing terminal
(13). According to this description, the TB enzyme reported
in this paper is not a lyase but a new type of eliminase specific for
basic polysaccharides. Considering the result in which the molar ratio
of N-acetylgalactosamine decreased due to enzymatic
digestion of the N-acetylated sheath polysaccharide, a
double bond is likely to be introduced into the galactosamine residue.
Most bacterial lyases require metal ions such as Mg2+,
Ca2+, Na+, and K+ (2, 3, 4, 7,
8, 9, 12, 15, 16, 21) for their activation. In contrast, sheath
polysaccharide-degrading activity was not metal ion dependent, because
activity was detected in the presence of EDTA. An enhancing effect was
observed from the addition of Mg2+, Ca2+, or
Fe3+, although Cu2+, Zn2+, and
Mn2+ negatively affected the activity. In addition to these
three metal ions, DTT strongly inhibited sheath
polysaccharide-degrading activity, suggesting the importance of
disulfide bonds to exhibiting activity.
According to Ash et al. (1), the cells of
Paenibacillus strains have gram-positive structure but
usually stain negatively in the laboratory Gram stain. Phenotypic
characteristics such as cell shape, gram-negative, motility, formation
of swollen sporangia, and growth under anaerobic conditions
suggest that the sheath-degrading bacteria isolated in this
study are members of the genus Paenibacillus (1).
Another typical phenotypic characteristic of the genus Paenibacillus is the ability to degrade macromolecules,
including polysaccharides and proteins, by extracellular enzymes
(1). Strains belonging to Paenibacillus polymyxa
(formerly called Bacillus polymyxa) capable of secreting
lyases that act on pectin were isolated, though the lyases secreted by
these bacteria were not purified and characterized (11, 14).
Every known Paenibacillus strain utilizes glucose
accompanied by gas production. However, the isolate (strain TB) hardly
utilized glucose. Though some characteristics of the
sheath-degrading bacteria we isolated are not identical to those of
other known Paenibacillus strains, they might be new members
of the genus Paenibacillus. The phylogenetic analysis supported this possibility.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Materials Science and Chemical Engineering, Faculty of Engineering,
Yokohama National University, Tokiwadai 79-5, Hodogaya, Yokohama
240-8501, Japan. Phone: 81 45 339 4266. Fax: 81 45 339 4267. E-mail:
mtake{at}ynu.ac.jp.
 |
REFERENCES |
| 1.
|
Ash, C.,
F. G. Priest, and M. D. Collins.
1993.
Molecular identification of rRNA group 3 bacilli (Ash, Farrow, Wallbanks and Collins) using a PCR probe test. Proposal for the creation of a new genus Paenibacillus.
Antonie Leeuwenhoek
64:253-260.
|
| 2.
|
Bekri, M. A.,
J. Desair,
V. Keijers,
P. Proost,
M. Searle-van Leeuwen,
J. Vanderrleyden, and A. V. Broek.
1999.
Azospirillum irakense produces a novel type of pectate lyase.
J. Bacteriol.
181:2440-2447[Abstract/Free Full Text].
|
| 3.
|
Boyen, A.,
M. Ghosh,
T. B. May,
D. Shinaberger,
R. Koegh, and A. M. Chakrabarty.
1993.
Sequence of the algL gene of Pseudomonas aeruginosa and purification of its alginate lyase product.
Gene
131:1-8[CrossRef][Medline].
|
| 4.
|
Chatterjee, A. K.,
G. E. Buchanan,
M. K. Behrens, and K. P. Starr.
1978.
Synthesis of excretion of polygalacturonic acid trans-eliminase in Erwinia, Yersinia, and Klebsiella species.
Can. J. Microbiol.
25:94-102.
|
| 5.
|
Emerson, D., and W. C. Ghiorse.
1993.
Ultrastructure and chemical composition of the sheath of Leptothrix discophora SP-6.
J. Bacteriol.
175:7808-7818[Abstract/Free Full Text].
|
| 6.
|
Emerson, D., and W. C. Ghiorse.
1993.
Role of disulfide bonds in maintaining the structural integrity of the sheath of Leptothrix discophora SP-6.
J. Bacteriol.
175:7819-7827[Abstract/Free Full Text].
|
| 7.
|
Gacesa, P.
1992.
Enzymic degradation of alginates.
Int. J. Biochem.
24:545-552[CrossRef][Medline].
|
| 8.
|
Hansen, J. B.,
R. S. Doublet, and J. Ram.
1984.
Alginase production by Bacillus circulans.
Appl. Environ. Microbiol.
47:704-709[Abstract/Free Full Text].
|
| 9.
|
Haraguchi, K., and T. Kodama.
1996.
Purification and properties of poly( -D-mannuronate) lyase from Azotobacter chroococcum.
Appl. Microbiol. Biotechnol.
44:576-581[CrossRef].
|
| 10.
|
Iwasaki, M.,
M. Ota, and Y. Otani.
1974.
Microdetermination of serum amylase activity utilizing the 3,6-dinitrophthalic acid method of determining reducing sugar.
Yakugaku Zasshi
94:138-144[Medline]. (In Japanese.)
|
| 11.
|
Karbassi, A., and R. H. Vaughn.
1980.
Purification and properties of polygalacturonic acid trans-eliminase from Bacillus stearothermophilus.
Can. J. Microbiol.
26:377-384[Medline].
|
| 12.
|
Lange, B.,
J. Wingender, and U. K. Winkler.
1989.
Isolation and characterization of an alginate lyase from Klebsiella aerogenes.
Arch. Microbiol.
152:302-308[CrossRef][Medline].
|
| 13.
|
Linhardt, R. J.,
P. M. Galliher, and C. L. Cooney.
1986.
Polysaccharide lyases.
Appl. Biochem. Biotechnol.
12:135-176[Medline].
|
| 14.
|
Obi, S. K. C., and G. M. Umerzurike.
1981.
Pectic enzyme activities of bacteria associated with rotted onions (Allium cepa).
Appl. Environ. Microbiol.
42:585-589[Abstract/Free Full Text].
|
| 15.
|
Peciña, A.,
A. Pascual, and A. Paneque.
1999.
Cloning and expression of the algL gene, encoding the Azotobacter chroococcum alginate lyase: purification and characterization of the enzyme.
J. Bacteriol.
181:1409-1414[Abstract/Free Full Text].
|
| 16.
|
Romeo, A., and J. F. Perston.
1986.
Purification and structural properties of an extracellular (1 4)- -D-mannuronan specific alginate lyase from a marine bacterium.
Biochemistry
25:8385-8391[CrossRef].
|
| 17.
|
Siering, P. L., and W. C. Ghiorse.
1996.
Phylogeny of the Sphaerotilus-Leptothrix group inferred from morphological comparisons, genomic fingerprinting, and 16S ribosomal DNA sequence analysis.
Int. J. Syst. Bacteriol.
46:173-182[Abstract/Free Full Text].
|
| 18.
|
Siering, P. L., and W. C. Ghiorse.
1997.
Development and application of 16S rRNA-targeted probes for detection of iron- and manganese-oxidizing sheathed bacteria in environmental samples.
Appl. Environ. Microbiol.
63:644-651[Abstract].
|
| 19.
|
Sutherland, I. W.
1990.
Lyases (eliminases), p. 47-53.
In
Sir J. Baddiley, N. H. Carey, I. J. Higgins, and W. G. Potter (ed.), Biotechnology of microbial exopolysaccharides. Cambridge University Press, Cambridge, United Kingdom.
|
| 20.
|
Takeda, M.,
F. Nakano,
T. Nagase,
K. Iohara, and J. Koizumi.
1998.
Isolation and chemical composition of the sheath of Sphaerotilus natans.
Biosci. Biotechnol. Biochem.
62:1138-1143[CrossRef][Medline].
|
| 21.
|
Tardy, F.,
W. Nasser,
J. Robert-Baudouy, and N. Hugouvieux-Cotte-Pattat.
1997.
Comparative analysis of the five major Erwinia chrysanthemi pectate lyases: enzyme characteristics and potential inhibitors.
J. Bacteriol.
179:2503-2511[Abstract/Free Full Text].
|
| 22.
|
Van de Peer, Y., and R. De Wachter.
1993.
TREECON: a software package for the construction and drawing of evolutionary trees.
Comput. Appl. Biosci.
9:177-182[Abstract/Free Full Text].
|
| 23.
|
van Veen, W. L.,
E. G. Mulder, and M. H. Deinema.
1978.
The Sphaerotilus-Leptothrix groups of bacteria.
Microbiol. Rev.
42:329-356[Free Full Text].
|
| 24.
|
Weissbach, A., and J. Hurwitz.
1958.
The formation of 2-keto-3-deoxyheptonic acid in extracts of Escherichia coli B. I and II.
J. Biol. Chem.
234:705-712.
|
Applied and Environmental Microbiology, November 2000, p. 4998-5004, Vol. 66, No. 11
0099-2240/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Takeda, M., Suzuki, I., Koizumi, J.-i.
(2005). Paenibacillus hodogayensis sp. nov., capable of degrading the polysaccharide produced by Sphaerotilus natans. Int. J. Syst. Evol. Microbiol.
55: 737-741
[Abstract]
[Full Text]
-
Suzuki, T., Kanagawa, T., Kamagata, Y.
(2002). Identification of a Gene Essential for Sheathed Structure Formation in Sphaerotilus natans, a Filamentous Sheathed Bacterium. Appl. Environ. Microbiol.
68: 365-371
[Abstract]
[Full Text]