Previous Article | Next Article 
Applied and Environmental Microbiology, December 2000, p. 5253-5258, Vol. 66, No. 12
0099-2240/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Application of a Propionyl Coenzyme A Synthetase
for Poly(3-Hydroxypropionate-co-3-Hydroxybutyrate)
Accumulation in Recombinant Escherichia coli
Henry E.
Valentin,1,*
Timothy A.
Mitsky,1
Debbie A.
Mahadeo,1
Minhtien
Tran,2 and
Kenneth J.
Gruys2
Monsanto Company, St. Louis, Missouri
63167,1 and Monsanto Company, St.
Louis, Missouri 631982
Received 21 June 2000/Accepted 24 September 2000
 |
ABSTRACT |
The genetic operon for propionic acid degradation in
Salmonella enterica serovar Typhimurium contains an open
reading frame designated prpE which encodes a propionyl
coenzyme A (propionyl-CoA) synthetase (A. R. Horswill and J. C. Escalante-Semerena, Microbiology 145:1381-1388, 1999). In this
paper we report the cloning of prpE by PCR, its
overexpression in Escherichia coli, and the substrate specificity of the enzyme. When propionate was utilized as the substrate for PrpE, a Km of 50 µM and a
specific activity of 120 µmol · min
1 · mg
1 were found at the saturating substrate concentration.
PrpE also activated acetate, 3-hydroxypropionate (3HP), and butyrate to their corresponding coenzyme A esters but did so much less efficiently than propionate. When prpE was coexpressed with the
polyhydroxyalkanoate (PHA) biosynthetic genes from Ralstonia
eutropha in recombinant E. coli, a PHA
copolymer containing 3HP units accumulated when 3HP was
supplied with the growth medium. To compare the utility of acyl-CoA
synthetases to that of an acyl-CoA transferase for PHA production,
PHA-producing recombinant strains were constructed to coexpress the PHA
biosynthetic genes with prpE, with acoE (an acetyl-CoA synthetase gene from R. eutropha [H. Priefert
and A. Steinbüchel, J. Bacteriol. 174:6590-6599, 1992]), or
with orfZ (an acetyl-CoA:4-hydroxybutyrate-CoA transferase
gene from Clostridium propionicum [H. E. Valentin, S. Reiser, and K. J. Gruys, Biotechnol. Bioeng. 67:291-299, 2000]).
Of the three enzymes, PrpE and OrfZ enabled similar levels of 3HP
incorporation into PHA, whereas AcoE was significantly less effective
in this capacity.
 |
INTRODUCTION |
Polyhydroxyalkanoates (PHAs) are a
diverse group of bacterial storage polyesters, which are accumulated
when carbon and energy sources are available in excess and cell growth
is restricted by the lack of an essential nutrient (1, 25).
Some of these polyesters exhibit material characteristics comparable to
those of petrochemical-derived polymers. For example, the physical
properties of poly(3-hydroxybutyrate-co-3-hydroxyvalerate)
resemble those of polyethylene and polypropylene (8). In
contrast to petrochemical-based polymers, PHAs are completely
biodegradable to CO2 and water and can be produced from
renewable resources. Unfortunately, PHA production by bacterial
fermentation is costly and, due to inefficient use of resources, not
necessarily environmentally benign (6). However, if a
plant-based PHA production system can be implemented, significantly lower production costs are predicted (12, 17).
Poly(3-hydroxybutyrate-co-3-hydroxyvalerate) has been commercially
produced through fermentation using a glucose-utilizing mutant of
Ralstonia eutropha that requires cofeeding of propionic acid
for 3-hydroxyvalerate formation. This polymer was sold under the trade
name Biopol. In contrast to a bacterial production system, production
of PHA copolyesters in plants requires that all metabolites be derived
from available intermediates of plant metabolism. While the production
of the simple but brittle homopolymer poly(3-hydroxybutyrate) (PHB) has
been well established in recombinant bacterial and plant systems
(18, 21, 24), only recent investigations have demonstrated the engineered production of more complex PHAs (7, 13, 16, 22, 23,
28). Production of
poly(3-hydroxypropionate-co-3-hydroxybutyrate) (PHPB) in a
recombinant system like Escherichia coli has not been reported. This particular copolymer, with incorporated
3-hydroxypropionate (3HP) monomers in the polymer backbone, has reduced
crystallinity relative to that of PHB (J. Asrar, personal communication).
The PHB biosynthetic pathway in R. eutropha is amenable to a
plant production system, since the starting biosynthetic metabolite is
acetyl coenzyme A (acetyl-CoA). The pathway enzymes consist of a
3-ketothiolase (PhaA), an acetoacetyl-CoA reductase (PhaB), and a PHB
synthase (PhaC) (21, 24). The 3-ketothiolase catalyzes a
Claisen condensation of two molecules of acetyl-CoA to form acetoacetyl-CoA, which is then reduced in an NADPH-dependent reaction to form D-(
)-3-hydroxybutyryl-CoA (3HB-CoA).
3HB-CoA serves as substrate for the PHB synthase, which catalyzes
the polymerization reaction of 3HB-CoA to form PHB.
In PHA-producing microbial systems only a small fraction of the diverse
group of PHAs are obtained from structurally unrelated carbon sources
(25), and those pathways are only partially characterized. Successful engineering of plants for PHA production will require greater understanding of both the enzymes involved in these microbial pathways and the complications of cellular compartmentalization of
biochemical processes in plants. Information on enzymes potentially useful for PHA production in designed pathways, but not necessarily naturally involved in PHA biosynthesis, will also be of importance. One
such enzyme is PrpE, a propionyl-CoA synthetase involved in propionate
degradation in Salmonella enterica serovar Typhimurium (9).
All known PHA synthases require hydroxyacyl-CoAs as substrates.
Precursor organic acids must therefore be activated to CoA-thioesters before entering the PHA biosynthetic pathway (5, 27).
Although CoA-activated short-chain fatty acids are required for a wide variety of other metabolic pathways, only acetyl-CoA synthetases or
acyl-CoA synthetases with a chain length specificity of greater than 10 carbon atoms have been characterized in detail. Acyl-CoA synthetases
with preference for fatty acids of chain lengths in the range of
C3 to C10 have not yet been characterized. The
characterization of one such enzyme in this class, PrpE, is reported in
this communication.
In addition to acyl-CoA synthetases, acyl-CoA transferases found in
anaerobic bacteria are known to catalyze the formation of short- to
medium-chain-length CoA-thioesters (14). However, these
enzymes are thought to be less suitable for metabolic engineering, since they depend on the availability of a donor CoA-thioester substrate in addition to the free organic acid for sufficient production of the desired organic acyl-CoA. These enzymes do not use
the free energy of nucleoside triphosphate hydrolysis to drive CoA-thioester formation as do acyl-CoA synthetases.
A comparison of an acyl-CoA synthetase to an acyl-CoA transferase in an
integrated pathway for PHA production has not yet been done. For these
reasons, and to learn more about the significance of substrate
specificity, we compared PHPB formation under similar conditions using
prpE, acoE (encoding an acetyl-CoA synthetase from
R. eutropha [20]), or orfZ
(encoding an acetyl-CoA:4-hydroxybutyrate-CoA transferase from
Clostridium kluyveri [26]) coexpressed with the PHA biosynthetic operon from R. eutropha
(phaCAB) in E. coli. All of these enzymes (AcoE,
OrfZ, and PrpE) have been found to activate 3HP to 3HP-CoA under in
vitro conditions (reference 20 and this study).
 |
MATERIALS AND METHODS |
Bacterial strains and plasmids.
All strains and plasmids
used in this study are listed in Table 1.
Maps of expression plasmids are shown in Fig.
1. For routine cloning, plasmids were
introduced into E. coli DH5
. For PHA accumulation experiments, plasmids were transferred into E. coli
XL1-Blue.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 1.
Plasmids used for PHA accumulation experiments in this
study. The runaway replication vector pJM9238 harbors the R. eutropha PHA biosynthetic operon (phaCAB) under
tac promoter control (11). PHA accumulation is
induced by heat shock or by growing the bacteria at temperatures
exceeding 34°C. Plasmid pSES38 harbors a 3.8-kbp fragment of genomic
DNA from R. eutropha encoding an acetyl-CoA synthetase
required for acetoin degradation. The gene is collinear with the
lac promoter of the pBluescript parent vector. However, gene
expression is thought to be driven by an internal 70
dependent promoter. The acetyl-CoA:4-hydroxybutyrate-CoA transferase
(OrfZ) is expressed from pBluescript KS ::orfZ,
which harbors the orfZ gene on a 1.8-kbp
ClaI/EcoRI fragment of genomic DNA from C. kluyveri, collinear with the lacZ promoter. The
multicopy vector pMON34576 harbors the engineered prpE gene
under lac promoter control.
|
|
Media.
For batch culture studies, bacteria were grown in
Luria-Bertani (LB) medium (15) that contained the
appropriate antibiotics (Sigma, St. Louis, Mo.) at the following
concentrations: ampicillin, 100 µg · ml
1;
chloramphenicol, 25 µg · ml
1. When specified,
isopropyl-
-D-thiogalactopyranoside (IPTG) (Sigma) was
added at a final concentration of 1 mM. Unless otherwise stated, all
cultures were incubated at 37°C and shaken at 225 rpm in an orbital
shaker. Cell growth was monitored by measuring optical density at a
wavelength of 600 nm (OD600).
PCR.
For amplification of prpE, an aliquot of
total genomic DNA from S. enterica serovar Typhimurium was
incubated for 41 cycles with prpE-specific primers (upper
primer,
5'-GGGGGGGAATTCAGATCTCCATGGGCATGCCTTTTAGCGAATTTTATCAGCGTTCG; lower primer,
5'-GGGGGGGAATTCTAATAACCCGTTGCCGAACGCGGCCTTATCCGGC) (Gibco-BRL, Rockville, Md.) in a thermocycler (DNA Thermal
Cycler, Perkin-Elmer, Norwalk, Conn.) using a Boehringer (Mannheim,
Germany) PCR core kit. To relax GC-rich DNA, 10% (vol/vol) dimethyl
sulfoxide was added to each reaction mixture. The first PCR
amplification cycle was done under the following conditions: 2 min of
incubation at 95°C for denaturation, 1 min at 50°C for annealing,
and 2 min at 72°C for extension. All other amplification cycles were
done with 1 min of incubation at 94°C for denaturation, 1 min for
annealing at 50°C, and 2 min for extension at 72°C.
Plasmid construction.
For cloning of prpE, the
PCR products were purified using a Qiagen (Valencia, Calif.) PCR
purification kit, digested with EcoRI, and ligated into
EcoRI-digested pSP72, resulting in the formation of
pMON34555. For high-level expression, prpE was subcloned under the control of the trc promoter into pSE380
(Invitrogen, Carlsbad, Calif.), resulting in the formation of
pMON34564. Cloning of pMON34564 was performed as follows. pMON34555 was
digested with NcoI and EcoRI. The 1,933-bp
fragment encoding the prpE gene was separated from the
vector component in a 1.0% agarose gel in Tris-acetate buffer
(15). The isolated fragment was purified using a Qiagen
gel extraction kit and ligated into the NcoI- and EcoRI-digested and purified pSE380. For PHA accumulation
experiments, prpE was subcloned under lac
promoter control into pMON34610, resulting in the formation of
pMON34576. For cloning of pMON34576, plasmid pMON34564 was digested
with NcoI and EcoRI. The 1,933-bp fragment was
isolated and purified as described above, and the isolated fragment was
ligated into the NcoI- and EcoRI-digested pMON34610.
Plasmid pBluescriptvector KS
::orfZ was
obtained by digesting pCK3 (28) with ClaI and
EcoRI. Restriction fragments were separated in a 0.8%
agarose gel. The 1.8-kbp fragment carrying orfZ was purified
and ligated into ClaI- and EcoRI-digested
pBluescriptvector KS
(Stratagene, La Jolla, Calif.).
Acyl-CoA synthetase assay.
The general acyl-CoA synthetase
assay mixture contained 5 mM ATP, 10 mM organic acid sodium salt, 1.25 mM CoASH, 5 mM dithiothreitol (DTT), and 5 mM magnesium chloride in 100 mM potassium phosphate buffer (pH 7.5). To start the reaction, 20 µl
of enzyme sample was added to a final volume of 200 µl of assay
mixture. After 15 min of incubation at room temperature, the reaction
was quenched by adding 20 µl of 10% (vol/vol) formic acid. Acyl-CoA
reaction products were separated by high-pressure liquid chromatography on a reversed-phase column (Beckman C8; 5 µm, 4.6 mm by
15 cm) using a 5 to 45% acetonitrile gradient in 50 mM ammonium
acetate buffer (pH 6.0). The linear gradient was obtained by altering the ratio of buffers A (50 mM ammonium acetate buffer [pH 6.0] plus
5% acetonitrile) and B (acetonitrile) from 100% buffer A at the
beginning of each run to 60% buffer A and 40% buffer B within 15 min.
Peak elution was monitored by absorbance at 260 nm. Quantitation of
acyl-CoA products was accomplished using a generated standard curve
with acyl-CoA standards. Assays to determine kinetic constants were
done by varying the concentration of organic acid substrate in a series
of reactions. All assays were quenched in the steady-state portion of
the reaction, where there was less than 20% utilization of the
limiting substrate.
Purification of PrpE.
A 3-ml preculture of E. coli DH5
cells harboring pMON34564 was grown overnight at
37°C. Subsequently, a 250-ml LB culture was inoculated with 1 ml of
the preculture and incubated at 37°C. When an OD600 of
0.6 was obtained, IPTG was added at a final concentration of 1 mM to
induce PrpE expression. Following 2 h after induction, cells were
harvested by centrifugation and washed once in phosphate-buffered saline (1 mM KH2PO4, 10 mM
Na2HPO4, 137 mM NaCl, 2.7 mM KCl [pH 7.4].
Subsequently, the cells were resuspended in 20 mM potassium phosphate
buffer (pH 7.4) containing 20% (vol/vol) glycerol and 2 mM DTT. Cell
suspensions were disrupted by sonication (Sonifier 450; Branson,
Danbury, Conn.) for a period of 2 mins (30-s sonication followed by
30-s rest) at setting 0.3 for output control and 30% for the duty
cycler using a 3-mm probe. The cell lysate was cleared by 10 min of
centrifugation at 31,000 × g using a Beckman SA-17 rotor. Proteins were precipitated with 80% saturated ammonium sulfate
and sedimented by centrifugation, and the resulting pellet was
dissolved in buffer B (100 mM sodium phosphate buffer) [pH 7.0]
containing 1 mM DTT and 1 M ammonium sulfate). The solution was passed
through a 0.2-µm-pore-size membrane filter (Aerodisc; Gelman
Sciences, Ann Arbor, Mich.) and then loaded onto a phenyl-Sepharose column (1 by 10 cm) (using the Biologic system from Bio-Rad). Proteins
were separated on the phenyl-Sepharose column using a two-step gradient
at a flow rate of 2 ml · min
1 with buffer A (100 mM sodium phosphate buffer [pH 7.0] containing 1 mM DTT) and buffer
B; the gradient was run with 100 to 50% buffer B in 15 min and then
with 50 to 0% buffer B in 30 min. One fraction was collected every
minute. The majority of PrpE was eluted in fractions 37 to 59. These
fractions were pooled, desalted, and concentrated by the Ultrafree-15
(30,000-molecular-weight cutoff; Millipore) ultrafiltration system to a
final volume of 2 ml. Proteins were then separated on a Mono-Q HR5/5
column (Pharmacia, Piscataway, N.J.) using buffer C (10 mM Tris [pH
7.8], 1 mM DTT) and buffer D (buffer C plus 1 M KCl). Separation was
done using a stepwise gradient with 0 to 20% buffer D in 5 min, 20 to
35% buffer D in 25 min, and then 35 to 100% buffer D in 10 min. The
flow rate was 1 ml · min
1, and one fraction was
collected per minute. The main peak of PrpE was eluted in fractions 14 to 19. Acyl-CoA synthetase in fractions 15 to 17 was >95% pure based
on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Daiichi
brand pre-cast gels; Owl Scientific Co., Woburn, Mass.) with Pro-Blue
staining (Emprotech).
PHA accumulation experiments.
PHA accumulation experiments
were done in a two-plasmid system. Plasmid pJM9238, a runaway
replication vector for the induction of the PHA biosynthetic pathway
(11), is induced to amplify by heat shock or temperature
shift to 37°C. Using the method of Chung et al. (4), a
second IPTG-inducible plasmid (pMON34576, pSES38, or pBluescript
KS
::orfZ), was transformed into E. coli XL1-Blue that previously contained pJM9238. These recombinant
E. coli strains were grown in LB medium containing 1% 3HP
at 30°C until a OD600 of 0.6 was reached. Subsequently,
the cultivation temperature was shifted to 37°C to induce PHA
accumulation, and IPTG was added to a final concentration of 1 mM to
induce the second plasmid. After an incubation period of 48 h,
cells were harvested for analysis of PHA content and composition.
PHA analysis.
For polyester content and composition
analysis, E. coli cells were harvested by centrifugation,
washed once with phosphate-buffered saline (Boehringer), and
lyophilized overnight. The dried cell pellet was extracted with hot
chloroform in screw-capped tubes at 100°C for 2 h. The
chloroform extract was filtered through glass wool, and PHAs were
precipitated in ethanol. The polyester content was obtained by
comparing the mass of the precipitated PHA to the dry mass of the
bacterial cell pellet used for the polymer extraction process.
NMR spectroscopic analysis.
The PHA composition was analyzed
by nuclear magnetic resonance (NMR) studies using a Varian 300 MHz
spectrometer. Proton spectra were obtained at 22°C from PHA samples
of approximately 20 mg dissolved in 1 ml of deuterochloroform. The
polymer composition was calculated based on the peak areas of all
protons of the polymer units. Pulses were taken at a 45° angle with a
2.46-s acquisition time, collecting 16,000 data points and 1,024 accumulations. Chemical shifts were measured relative to
CHCl3 (
= 7.24 ppm). The
13C{1H} spectra (75 MHz) were taken at
22°C on a solution of approximately 50 mg of PHA in 1 ml of
deuterochloroform. The spectra were obtained using Waltz decoupling,
30° pulses, a 1-s relaxation delay, a 12-kHz spectral width, 32,000 data points, and 20,000 accumulations. Chemical shifts were measured
relative to CHCl3 (
= 77.0 ppm). (See Fig. 2 for an
example of a proton spectrum of PHPB extracted from recombinant
E. coli.)
 |
RESULTS |
Cloning of prpE.
Total genomic DNA was isolated
from S. enterica serovar Typhimurium LT2 by the method of
Ausubel et al. (2) and used as template for PCR
amplification of the prpE gene. Primers were designed to
introduce EcoRI restriction sites at the 5' and 3' ends
of the gene. The 5' region of the gene was further modified to
introduce an NcoI restriction site at the translational
start codon. In order to avoid possible gene toxic effects, PCR
products were purified, digested with EcoRI, and cloned into
pSP72. This cloning vector contains only viral promoters which are not
recognized in E. coli DH5
. High-level expression of the
prpE gene was achieved by cloning the gene in pSE380 under
trc promoter control. The resulting plasmid is pMON34564.
For PHA accumulation experiments, the prpE gene was cloned
under the expression control of the more moderate lac
promoter. This vector is pMON34576.
Enzymatic characterization of PrpE.
As shown in Table
2, the pooled Mono-Q fractions of
purified PrpE gave 1.4% of the starting ammonium sulfate-precipitated protein and resulted in a 30-fold increase in propionyl-CoA synthetase specific activity. Based on sodium dodecyl sulfate-polyacrylamide gel
electrophoresis analysis, the protein at this final purification step
was >95% pure. The specific activity of PrpE under conditions of
saturating substrate is 120 U/mg of protein. In addition to propionate,
PrpE was found to activate acetate and 3HP, and it displayed normal
Michaelis-Menten kinetics with all three substrates. However, the
Km values demonstrate a strong binding
preference for propionate (Km of 0.050 ± 0.003 mM) versus acetate (0.9 ± 0.1 mM) or 3HP (27 ± 1 mM).
The Vmax values for acetate and 3HP are two- and
threefold less than that for propionate, respectively, based on kinetic
measurements that directly compared the three substrates with a
partially purified enzyme. Butyrate also was a substrate for PrpE but
produced only low levels of the corresponding CoA-thioester. No
detailed kinetic analysis was done using this substrate because of the
very low reaction rate. There were no detectable products when
4-hydroxybutyrate or DL-3-hydroxybutyrate was used as a
substrate with PrpE. Based on these results, it is concluded that PrpE
is a propionyl-CoA synthetase and only poorly utilizes other
short-chain-length organic acids as substrates.
Application of PrpE, AcoE, and OrfZ for PHA formation.
Figure
2 shows a typical spectrum for PHPB,
where in this case the 3HP fraction is the major component of the
copolymer. As can be seen, the signature resonances for the 3HP
and 3HB components allow for clear quantitation. As shown in Tables
3 and 4,
copolyesters containing 3HP units were obtained only when an acyl-CoA
synthetase or a CoA transferase was expressed in connection with the
PHA biosynthetic operon. When recombinant E. coli cells
expressing prpE or orfZ were grown in LB medium
plus 1% 3HP, polyesters containing approximately 90 mol% 3HP were
accumulated. The expression of AcoE under such growth conditions
resulted in significantly lower levels of 3HP in the polyester (Table
3).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 2.
1H NMR spectroscopic analysis of PHPB
extracted from E. coli XL1-Blue (pJM9238, pMON34576) grown
on 1% 3HP in LB medium. Brackets and numbers below the abcissa
indicate the signal areas. Based on those numbers, this polyester
contains 15 mol% 3HB and 85 mol% 3HP. TMS, tetramethylsilane.
|
|
In a second experiment, the cells were cultured in the presence of 1%
(wt/vol) 3HP plus 1% (wt/vol) mannitol. All other parameters were kept
constant. Under these conditions, the use of PrpE or OrfZ for
activating 3HP resulted in the accumulation of polyesters with similar
compositions. In comparison to experiments without manitol as an
additional carbon source, the total amount of 3HP in these polyesters
decreased to 20 to 25 mol%. AcoE-expressing strains did not accumulate
any detectable amounts of 3HP under these conditions, although previous
results had indicated that AcoE could utilize 3HP as substrate
(20), and expression levels of AcoE appeared to be
comparable to PrpE levels based on acetyl-CoA synthetase activity. The
total amounts of polyesters accumulated by these strains did not vary
significantly (Table 4).
 |
DISCUSSION |
The kinetic data presented in this study confirm that
prpE encodes a propionyl-CoA synthetase, as suggested
previously (9, 10). Our results indicate that PrpE can also
activate acetate, 3HP, and butyrate to their corresponding
CoA-thioesters, in addition to propionic acid, although less
efficiently. Activation of butyrate by PrpE contradicts previous
results which were obtained with crude E. coli extracts
expressing recombinant prpE (9). However, in our
hands butyrate activation to the CoA-thioester by PrpE was very inefficient.
The combination of prpE expression with the expression of
the R. eutropha PHA biosynthetic pathway in E. coli XL1-Blue demonstrated that PrpE can be utilized for the
biosynthesis of specific PHAs that cannot be obtained without the
presence of a CoA-activating enzyme. We further demonstrated that
formation of PHPB in E. coli can be obtained by expressing
phaCAB from R. eutropha with either an acetyl-CoA
synthetase from R. eutropha (acoE), a
propionyl-CoA synthetase from S. enterica serovar
Typhimurium (prpE), or an acetyl-CoA:4-hydroxybutyrate-CoA
transferase from C. kluyveri (orfZ).
Surprisingly, similar amounts of 3HP were accumulated by using either
PrpE or OrfZ.
A CoA synthetase should be able to promote CoA-thioester formation and
give high concentrations of the corresponding CoA-thioesters due to the
use of free energy from ATP. This should favor incorporation of 3HP
into PHA. In contrast, the acetyl-CoA:4-hydroxybutyrate-CoA transferase
depends on the pools of available acetyl-CoA and free acids and in our
case generates an equilibrium between acetyl-CoA, acetate, 3HP, and
3HP-CoA. Acetyl-CoA is abundant in E. coli cells under
certain growth conditions, reaching millimolar levels (3), and we supplied 1% 3HP (approximately 0.1 M) to the growth medium in
our experiments. These conditions apparently allowed sufficient 3HP-CoA
formation in the presence of the acyl-CoA transferase for high-level
incorporation in the copolymer.
An improvement to the pathway for recombinant systems would be to rely
on endogenous 3HP formation. While certainly more attractive, such a
system would result in a significantly lower supply of 3HP. Moreover,
if such a pathway were to be utilized in a plant production system, the
levels of available acetyl-CoA would likely be below 50 µM (19,
29). Under such conditions, an acyl-CoA synthetase may be more
favorable than an acyl-CoA transferase for efficient activation of 3HP
to the corresponding 3HP-CoA.
Other reasons for similar polyester compositions using PrpE or OrfZ for
3HP activation could also be differing expression levels of the two
enzymes or differences in substrate specificity rather than specific
metabolite pools within the bacterial cells. We attempted to keep
expression levels in our experiments constant by cloning all three
genes in high-copy-number plasmids behind the lac promoter,
even though previous studies have indicated that acoE as
well as orfZ can be expressed from their own promoters in
E. coli (20, 28). Unfortunately, OrfZ was found
to be very unstable in E. coli crude extracts. Western blot
analysis indicated proteolytic cleavage (data not shown), and based on
activity assays OrfZ has a half-life of approximately 20 min at room
temperature in the presence of the protease inhibitors benzamidine (1 mM), leupeptin (10 mg · ml
1) and
4-(2-aminoethyl)benzenesulfonyl fluoride (10 mg · ml
1). For this reason, in vitro enzyme activities were
difficult to reproduce and do not necessarily represent in vivo
activities for this enzyme.
This study also indicates that AcoE, although it had been demonstrated
to activate 3HP to 3HP-CoA under in vitro conditions with a rate
similar to that for acetate (20), is not as effective for
this task in vivo as either PrpE or OrfZ. This is particularly surprising since enzyme activities of AcoE and PrpE were comparable based on acetyl-CoA synthetase activity. In previous studies
(20) AcoE had been shown to activate 3HP with a rate similar
to that for acetic acid. However, this study indicates that AcoE is not as effective for this task as PrpE or OrfZ in vivo.
 |
ACKNOWLEDGMENTS |
We thank A. Steinbüchel for providing plasmid pSES38 and
Steven C. Slater and Katey L. Houmiel for reviewing the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Monsanto Co.,
800 North Lindbergh Boulevard, St. Louis, MO 63167. Phone: (314)
694-4902. Fax: (314) 694-8275. E-mail:
henry.e.valentin{at}monsanto.com.
 |
REFERENCES |
| 1.
|
Anderson, A. J., and E. A. Dawes.
1990.
Occurrence, metabolism, metabolic role, and industrial uses of bacterial polyhydroxyalkanoates.
Microbiol. Rev.
54:472-450.
|
| 2.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1987.
Current protocols in molecular biology.
Green Publishing Associates, New York, N.Y.
|
| 3.
|
Chohnan, S.,
H. Furukawa,
T. Fujio,
H. Nishihara, and Y. Takamura.
1997.
Changes in the size and composition of intracellular pool of nonesterfied coenzyme A and coenzyme A thioesters in aerobic and facultatively anaerobic bacteria.
Appl. Environ. Microbiol.
63:553-560[Abstract].
|
| 4.
|
Chung, C. T.,
S. L. Niemela, and R. H. Miller.
1989.
One-step preparation of competent Escherichia coli: transformation and storage of bacterial cells in the same solution.
Proc. Natl. Acad. Sci. USA
86:2172-2175[Abstract/Free Full Text].
|
| 5.
|
Doi, Y.,
A. Segawa,
S. Nakamura, and M. T. Kunioka.
1990.
Production of biodegradable copolyesters by Alcaligenes eutrophus, p. 37-48.
In
E. A. Dawes (ed.), NATO ARW: novel biodegradable microbial polymers. Kluwer Academic Publishers, Dordrecht, The Netherlands.
|
| 6.
|
Gerngross, T. U.
1999.
Can biotechnology move us toward a sustainable society?
Nat. Biotechnol.
17:541-544[CrossRef][Medline].
|
| 7.
|
Hein, S.,
B. Söhling,
G. Gottschalk, and A. Steinbüchel.
1997.
Biosynthesis of poly(4-hydroxybutyric acid) by recombinant Escherichia coli.
FEMS Microbiol. Lett.
153:411-418[Medline].
|
| 8.
|
Holmes, P. A.
1985.
Applications of PHB a microbially produced biodegradable thermoplastic.
Phys. Technol.
16:32-36.
|
| 9.
|
Horswill, A. R., and J. C. Escalante-Semerena.
1999.
The prpE gene of Salmonella typhimurium LT2 encodes propionyl-CoA synthase.
Microbiology
145:1381-1388[Abstract].
|
| 10.
|
Horswill, A. R., and J. C. Escalante-Semerena.
1997.
Propionate catabolism in Salmonella typhimurium LT2: two divergently transcribed units comprise the prp locus at 8.5 centisomes, prpR encodes a member of the sigma-54 family of activators, and the prpBCDE genes constitute an operon.
J. Bacteriol.
179:928-940[Abstract/Free Full Text].
|
| 11.
|
Kidwell, J.,
H. E. Valentin, and D. E. Dennis.
1995.
Regulated expression of the Alcaligenes eutrophus polyhydroxyalkanoate biosynthetic genes in Escherichia coli.
Appl. Environ. Microbiol.
61:1391-1398[Abstract].
|
| 12.
|
Kishore, G. M., and C. R. Somerville.
1993.
Genetic engineering of commercially useful biosynthetic pathways in transgenic plants.
Curr. Opin. Biotechnol.
4:152-158[CrossRef][Medline].
|
| 13.
|
Langenbach, S.,
B. H. A. Rehm, and A. Steinbüchel.
1997.
Functional expression of the PHA synthase gene phaCl from Pseudomonas aeruginosa in Escherichia coli results in poly(3-hydroxyalkanoate) synthesis.
FEMS Microbiol. Lett.
150:303-309[Medline].
|
| 14.
|
Mack, M., and W. Buckel.
1997.
Conversion of glutaconate CoA-transferase from Acidaminococcus fermentans into an acyl-CoA hydrolase by site-directed mutagenesis.
FEBS Lett.
405:209-212[CrossRef][Medline].
|
| 15.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1982.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 16.
|
Mittendorf, V.,
E. J. Robertson,
R. M. Leech,
N. Krüger,
A. Steinbüchel, and Y. Poirier.
1998.
Synthesis of medium-chain-length polyhydroxyalkanoates in Arabidopsis thaliana using intermediates of peroxisomal fatty acid -oxidation.
Proc. Natl. Acad. Sci. USA
95:13397-13402[Abstract/Free Full Text].
|
| 17.
|
Nawrath, C.,
Y. Poirier, and C. Sommerville.
1994.
Targeting of the polyhydroxybutyrate biosynthetic pathway to the plastids of Arabidopsis thaliana results in high levels of polymer accumulation.
Proc. Natl. Acad. Sci. USA
91:12760-12764[Abstract/Free Full Text].
|
| 18.
|
Poirier, Y.,
D. E. Dennis,
K. Klomparens, and C. Sommerville.
1992.
Polyhydroxybutyrate, a biodegradable thermoplastic, produced in transgenic plants.
Science
256:520-523[Abstract/Free Full Text].
|
| 19.
|
Post-Beittenmiller, D.,
G. Roughan, and J. B. Ohlrogge.
1992.
Regulation of plant fatty acid biosynthesis.
Plant Physiol.
100:923-930[Abstract/Free Full Text].
|
| 20.
|
Priefert, H., and A. Steinbüchel.
1992.
Identification and molecular characterization of the acetyl coenzyme A synthetase (acoE) of Alcaligenes eutrophus.
J. Bacteriol.
174:6590-6599[Abstract/Free Full Text].
|
| 21.
|
Schubert, P.,
A. Steinbüchel, and H. G. Schlegel.
1988.
Cloning of the Alcaligenes eutrophus genes for synthesis of poly- -hydroxybutyric acid (PHB) and synthesis of PHB in Escherichia coli.
J. Bacteriol.
170:5837-5847[Abstract/Free Full Text].
|
| 22.
|
Slater, S.,
T. Gallaher, and D. Dennis.
1992.
Production of poly-(3-hydroxybutyrate-co-3-hydroxyvalerate) in a recombinant Escherichia coli strain.
Appl. Environ. Microbiol.
58:1089-1094[Abstract/Free Full Text].
|
| 23.
|
Slater, S.,
T. A. Mitsky,
H. L. Houmiel,
M. Hao,
S. E. Reiser,
N. B. Taylor,
M. Tran,
H. E. Valentin,
D. J. Rodriguez,
D. A. Stone,
S. R. Padgette,
G. Kishore, and K. J. Gruys.
1999.
Metabolic engineering of Arabidopsis and Brassica for poly(3-hydroxybutyrate-co-3-hydroxyvalerate) copolymer production.
Nat. Biotechnol.
17:1011-1016[CrossRef][Medline].
|
| 24.
|
Slater, S. C.,
W. H. Voige, and D. E. Dennis.
1988.
Cloning and expression in Escherichia coli of the Alcaligenes eutrophus H16 poly- -hydroxybutyrate biosynthetic pathway.
J. Bacteriol.
170:4431-4436[Abstract/Free Full Text].
|
| 25.
|
Steinbüchel, A., and H. E. Valentin.
1995.
Diversity of bacterial polyhydroxyalkanoic acids.
FEMS Microbiol. Lett.
128:219-228[CrossRef].
|
| 26.
|
Valentin, H. E.,
S. Reiser, and K. J. Gruys.
2000.
Poly(3-hydroxybutyrate-co-4-hydroxybutyrate) formation from -aminobutyrate and glutamate.
Biotechnol, Bioeng.
67:291-299[CrossRef][Medline].
|
| 27.
|
Valentin, H. E., and A. Steinbüchel.
1995.
Accumulation of poly(3-hydroxybutyric acid-co-3-hydroxyvaleric acid-co-4-hydroxyvaleric acid) by mutants and recombinant strains of Alcaligenes eutrophus.
J. Environ. Pol. Degrad.
3:169-175.
|
| 28.
|
Valentin, H.E., and D. Dennis.
1997.
Production of poly(3-hydroxybutyrate-co-4-hydroxybutyrate) in recombinant Escherichia coli grown on glucose.
J. Biotechnol.
58:33-38[CrossRef][Medline].
|
| 29.
|
Winter, H.,
D. G. Robinson, and H. W. Heldt.
1994.
Subcellular volumes and metabolic concentrations in spinach leaves.
Planta
193:530-535[CrossRef].
|
Applied and Environmental Microbiology, December 2000, p. 5253-5258, Vol. 66, No. 12
0099-2240/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.