INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Claviceps purpurea is an ergot fungus with a wide host range that includes the entire subfamily Pooideae, many members of the Arundinoideae, and some species belonging to the chloridoid and panicoid groups (4, 15). Its distribution is basically Holarctic, but it has been recorded in Arctic regions (14) and also occurs in southern temperate and subtropical regions. Due to movement with cereal and grass seeds by migrants, the center of origin of this species is not known.

C. purpurea is morphologically quite variable. Sclerotial length ranges from 2 to 50 mm, and the color of the stromata varies over a wide range of red shades from wine to purple (25) and even to orange (31). Conidial size and shape also are polymorphic; the conidia range from oval spores that are 5 µm long to cylindric or elongated spores that are up to 13 µm long (15, 25, 31). The sclerotia contain peptide alkaloids that belong to three basic groups, the ergotamines (with alanine as the first amino acid entering the cyclopeptide moiety), the ergotoxines (with valine), and the rarely found ergoxines (with 2-aminoisobutyric acid) (for reviews see references 7 and 33).

For the last 100 years, researchers have tried to use this variation to establish varieties, special forms, or races (1), and the primary focus has been on detection of host-specific groups. Stäger introduced four special forms: secalis, lolii (later joined with secalis) (2), milii (on Milium and Brachypodium only), and glyceriae (suspected to be Claviceps wilsonii) for C. purpurea sensu Tulasne (excluding Claviceps microcephala [Wallr.] Tul.) (26-28, 30). However, biological barriers to host specificity have not been confirmed (2, 3, 5, 16).

Stäger found (29) that sclerotia formed on grasses from wet habitats could float on water but that sclerotia formed on Secale sp., Lolium sp., Brachypodium sylvaticum, Sesleria coerulea, Arrhenatherum elatius, Agropyron repens (now Elytrigia repens), Alopecurus myosuroides, and other land grasses sank in water. On Dactylis glomerata, Calamagrostis epigeios, and some Holcus and Poa spp., sclerotia of both types were observed. For the floating isolates, the new taxon f. sp. Phalaridis arundinaceae natans was defined (29).

Jungehülsing and Tudzynski (10) established two main groups by using randomly amplified polymorphic DNA (RAPD) typing; one group consisted primarily of English isolates from Molinia, Holcus, and Dactylis species, and the other group contained the isolates from land grasses.

Loveless (15) found that the conidia of isolates from grasses from wet and shady habitats were longer (6.5 to 8.5 µm) than those from isolates found on land grasses (5 to 6 µm). Conidial shape and size remained unchanged, even when the isolates from different hosts were inoculated onto wheat or cultivated on agar plates (16), indicating that this trait is characteristic of an isolate and not of the substrate upon which it is raised. However, spores from laboratory cultures vary more than those from a natural host vary. Another group of C. purpurea isolates was found on Spartina spp. populating Atlantic salt marshes in the Americas. This group was characterized (as analyzed by thin-layer chromatography [TLC]) by predominant production of ergocryptine, ergocryptinine, and lysergylvalylmethylester (6). Spartina stands in the British Isles have been colonized by C. purpurea only since 1960 (9, 21). The isolates obtained from these stands have the longest conidia (8.4 µm) of all the British samples studied (15).

Kobel and Sanglier (11) identified 10 chemoraces in sclerotia collected in Europe and North America, with the most common combinations being ergocornine and ergocryptine (23% of the samples), ergocristine and ergosine (20%), and ergotamine (13%). The composition of the alkaloid mixture produced is hereditary and independent of the host (12).

Our objectives in this study were (i) to identify the population structure of C. purpurea and (ii) to characterize the groups and isolates by host or habitat preferences, by phenotypic traits used in previous studies (conidial morphology, alkaloid type, properties of sclerotia) and by DNA polymorphisms. Our goal was to harmonize and relate the ambiguous, even contradictory, groupings made by previous researchers often on the basis of only one or two characters, in a single system.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Isolates. The isolates used, their origins, and other properties are summarized in Table 1. Representative cultures have been deposited in the Culture Collection of Fungi, Charles University, Prague, Czech Republic (CCF), under accession numbers CCF 3145 to 3149. 

Cultivation of fungi. Sclerotia were surface sterilized for 2 to 5 min (depending on their size) in 1.3% sodium hypochlorite and rinsed three times for 3 to 5 min in distilled water. Sterilized sclerotia were placed on T2 agar plates (18) supplemented with 100 µg of ampicillin per ml. Isolates were maintained on T2 agar slants at 4°C and were subcultured every 6 months.

Preparation of genomic DNA. Spore or mycelium suspensions were plated on cellophane discs laid on T2 plates and were grown for 1 to 2 weeks at 24°C. Mycelium was scraped into a mortar and ground in liquid nitrogen. From ca. 0.5 g of the powdered mycelium, DNA was extracted (18) with an additional purification step. To the DNA solution, 0.5 volume of 7.5 M ammonium acetate was added. After incubation for 10 min at room temperature, proteinaceous impurities were pelleted by centrifugation for 10 min at 10,000 × g. DNA was precipitated from the supernatant by adding 0.7 volume of isopropanol, incubating the preparation for 2 h at 4°C, and then centrifuging it for 15 min at 10,000 × g.

Analyses of ITS rDNA. The region containing internal transcribed spacer 1 (ITS1), ITS2, and 5.8S ribosomal DNA (rDNA) was amplified by using ITS1 and ITS4 primers (34). Each mixture (25 µl) contained 50 ng of genomic DNA, 20 pmol of each primer, each deoxynucleoside triphosphate (Promega, Madison, Wis.) at a concentration of 200 µM, and 1 U of DynaZyme along with the buffer supplied by the manufacturer (Finnzymes, Oy, Finland). The reaction mixtures were subjected to 32 cycles in a GeneE thermal cycler (Techne, Cambridge, United Kingdom), as follows: (i) one cycle consisting of 95°C for 3 min, 55°C for 30 s, and 72°C for 1 min; (ii) 30 cycles consisting of 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min; and (iii) one cycle consisting of 95°C for 30 s, 55°C for 30 s, and 72°C for 10 min. The amplicons in 3 to 5 µl of reaction mixture were, without further purification, digested with 10 U of EcoRI for 1 to 2 h in a total volume of 20 µl. Custom sequencing was done with an ABI 373A sequencer (Institute of Biotechnology, Technical University, Graz, Austria) by using dye terminators (18).

RAPD analysis. Primers 1CR (GCCTTGCGGACGGCAATATC), 1CF (TCCTTGATGCATTCGCAACC), 206 (TCAACAATGTCGGCCTCCGT), 257 (CGTGATGTCAGTGATGC), RP2, and RP4-2 (13), as well as primers OPA01, OPA03, OPA04, OPA08, OPA02, OPE01, OPE04, OPE14, and OPE17 (Operon Technologies, Alameda, Calif.), were tested. Each 20-µl reaction mixture contained each deoxynucleoside triphosphate at a concentration of 200 µM, 20 pmol of primer, DynaZyme reaction buffer, DynaZyme polymerase (1 U), and 1.75 mM MgCl₂. DNA (50 to 100 ng) was added, and samples were placed on the cycler plate after the temperature reached 80°C. The following cycling conditions were used: (i) one cycle consisting of 94°C for 3 min, 38°C for 1 min, and 72°C for 20 s; (ii) 33 cycles consisting of 93°C for 20 s, 38°C for 1 min, and 72°C for 20 s; and (iii) one cycle consisting of 93°C for 20 s, 38°C for 1 min, and 72°C for 6 min. The resulting bands were separated on a 1% agarose gel (SeaKem LE agarose; FMC BioProducts, Rockland, Maine) at 4 V/cm in 1× TBE (8.9 mM Tris-borate, 8.9 mM boric acid, 2 mM EDTA) for 2 to 4 h. The same patterns were observed when different DNA preparations from the same isolate were used and also when samples were run on a Mastercycler gradient (Eppendorf AG, Cologne, Germany) instead of GeneE.

Sequencing of amplicons. Amplicons A and C were purified from agarose gels with a Qiaex II gel extraction kit (catalog no. 20021; Qiagen GmbH, Hilden, Germany) and were cloned into SmaI-digested pBluescript/SK (Stratagene, La Jolla, Calif.). The sequences were determined by using T3 (AATTAACCCTCACTAAAGGG) and T7 (GTAATACGACTCACTATAGGGC) universal primers as described above.

Alkaloid extraction. Sclerotia (50 to 500 mg) were powdered and extracted with 6 ml of extraction mixture (80% methanol with 1 ml of NH₄OH per liter). The mixture was stirred for 2 h and extracted further without stirring for 12 h in the dark before paper filtering. The filtrate was vacuum evaporated to dryness at room temperature, and the residue was dissolved in 50 to 200 µl of chloroform.

TLC. Ten microliters of alkaloid extract was loaded on a TLC plate (Silica Gel 60; Merck, Darmstadt, Germany). The plate was exposed to ammonia vapor and developed with a chloroform-acetone (3:1, vol/vol) mobile phase. Alkaloids were detected as blue spots by using Ehrlich reagent spray (5 g of 4-dimethylaminobenzaldehyde, 75 ml of ethanol, 25 ml of concentrated hydrochloric acid).

HPLC. To quantify the compositions of the alkaloid mixtures, reverse-phase high-performance liquid chromatography (HPLC) was used. Separations were carried out on an RP C₁₈ column (150 by 3.3 mm [inside diameter]; Tessek, Prague, Czech Republic) by using gradient elution with the following mobile phases: methanol-water-concentrated ammonium hydroxide (9:1:0.0004) (solvent A) and methanol-water-concentrated ammonium hydroxide (0.5:9.5:0.0004) (solvent B). Gradient elution started with 50% solvent A, which was linearly increased to 95% solvent A within 65 min at a flow rate of 0.5 ml/min. The alkaloids were detected at a wavelength of 310 nm. Chromatographic data were processed with the Millennium 2.15 software (Waters Czech Republic, Prague, Czech Republic). Ergot alkaloid standards were isolated and their identities were confirmed in our laboratory.

Mathematical analyses. RAPD gel photos were scanned with an HP Scanjet 4P, and the images were converted into binary matrices by the Cross Checker fingerprint analysis program (version 2.9; J. B. Buntjer, Wageningen University and Research Centre, Wageningen, The Netherlands). A distance matrix was calculated by using Jaccard's coefficient (23). An alkaloid-based Euclidean distance matrix for 25 isolates was compared with a RAPD-based distance matrix by using the Mantel test (24), as implemented by Mantel (version 2.0; A. Liedloff, Queensland University of Technology, Brisbane, Australia). This program uses two methods which determine significance with a standard normal variate (g) and 1,000 random permutations of the first matrix to determine the possible variation within the data. The values for Z (Mantel coefficient), g, and r (correlation coefficient) from both matrices specified were calculated. The null hypothesis tested was the hypothesis that there was no relationship between the matrices.

Microscopy. Conidial measurements were made at a magnification of ×1,125 by using 30 spores washed from sclerotia. For cultures from other laboratories, conidia from plates were measured. The standard deviations ranged from 15 to 20% of the mean.

Floating test. Sclerotia were placed on the surface of distilled water in a 200-ml beaker. If the sclerotia were still floating after 1 h, the water was swirled with a glass rod. Sclerotia that floated for at least 4 h were considered floaters.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

RAPD. We tested 15 primers that all resulted in band patterns that distinguished three groups. Primer 257 was chosen for routine typing because the patterns obtained with it were the most distinct (Fig. 1). All isolates shared one band, the species-specific amplicon A band derived from a multicopy sequence (19). The first group, group G1 (57 isolates), was characterized by band B; however, other bands were also observed. Forty-one isolates belonging to the second group, group G2, produced the same pattern with most primers. However, with primer 257, 36 of these isolates produced a pattern with a prominent band C, whereas a second pattern appeared only with isolates T8, 236, 473, 474, and 475. 

View larger version (91K): [in this window] [in a new window]   FIG. 1.   Examples of RAPD profiles of G1 and G2 isolates obtained with primer 257. Amplicon A is species specific, amplicon B is specific for G1 isolates, and amplicon C is specific for the majority of G2 isolates. (a) G1 strains. Lane 1, 417; lane 2, 343; lane 3, 374; lane 4, Dla; lane 5, 37-1; lane 6, 134; lane 7, Bay10; lane 8, T5; lane 9, 383; lane 10, 254; lane 11, 478; lane 12, Pepty 695/S; lane 13, 192; lane 14, 150; lane 15, W3; lane 16, W8; lane 17, W10; lane 18, W15; lane 19, 363; lane 20, 317. (b) G2 strains. Lane 1, 231; lane 2, 163; lane 3, 419; lane 4, 420; lane 5, 379; lane 6, 299; lane 7, 413; lane 8, 407; lane 9, 410; lane 10, 421; lane 11, 256; lane 12, 415; lane 13, 386; lane 14, 211; lane 15, 213; lane 16, W9; lane 17, W12; lane 18, 236; lane 19, T8. The solid squares indicate isolates from the study of Jungehülsing and Tudzynski (10).

Intraspecific EcoRI polymorphism. The 5.8S rDNA of C. purpurea G1 isolates Pepty 695/S (17) and 134 (EMBL nucleotide sequence database accession no. AJ000069 and AJ000070) contains a conserved EcoRI site (22). The sequence of isolate 162 (group G2) has a transversion at this site (GAATTC to GACTTC) and is the same as the sequence (GenBank accession no. U57669) of a C. purpurea isolate collected from Dactylis glomerata in Athens, Ga. (8). All of the G1 and G3 isolates were EcoRI positive, and the G2 isolates were EcoRI negative. The representative isolates from the Secale-Agropyron group of Jungehülsing and Tudzynski (10) were EcoRI positive, whereas representative isolates from the Molinia-Dactylis group were EcoRI negative.

Habitats and host plants. G1 isolates originated from fields, from open meadows, and from grasses along roads, i.e., from open, sunny localities that often are dry. We found that Alopecurus pratensis, Ammophila arenaria, Arrhenatherum elatior, Dactylis sp., Festuca ovina, Festuca rubra, Phleum sp., and Poa pratensis could be colonized naturally by both G1 and G2 isolates.

Conidial size. G3 isolates have the longest conidia (length, more than 10 µm), but the number of isolates that have been obtained so far is limited. Conidia shorter than 6.5 µm were always from G1 strains. Conidia between 8.5 and 10 µm long were always from G2 strains (Fig. 2). In the 6.5- to 8.5-µm range, G1 and G2 strains overlapped. Therefore, conidial size is only of secondary importance in distinguishing the three groups.

View larger version (14K): [in this window] [in a new window]   FIG. 2.   Average conidial sizes of isolates belonging to the three C. purpurea groups. The standard deviation of spore size was 15 to 20%.

Floating sclerotia. All of the sclerotia of G2 strains could float, whereas the sclerotia of G1 strains all sank within the first 30 min in the water. The best floating was observed with the sclerotia of G3 strains, which were difficult even to wet.

Alkaloid analyses. Sclerotia of G1 strains contained one or more of seven different alkaloids (Table 2). Sclerotia of G2 strains contained only ergosine, ergocristine, and small amounts of ergocryptine. Sclerotia of G3 strains contained mixtures of ergocristine and ergocryptine. Thus, G2 and G3 constitute stable chemoraces.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Our data suggest that most G1 C. purpurea isolates contain alkaloid mixtures of variable composition and usually occur in meadows, fields and other open, dry localities. Despite considerable internal variation, no subgroups were distinguished on the basis of host plant, locality, or the types of alkaloids produced. In previous studies, this group was probably described as C. purpurea f. sp. secalis (26) or, on the basis of hosts and conidial size, C. purpurea var. purpurea (with conidia that were 5.8 by 3.0 µm) and C. purpurea var. agropyri (with conidia that were 6.7 by 2.4 µm) (31, 32).

G2 isolates differ from G1 isolates in a single base pair in the 5.8S rDNA, are more uniform in terms of the alkaloid production pattern, and produce predominantly elongated conidia and floating sclerotia. They have been found in Belgium and England (10), in the Czech Republic, Poland, and Germany (this study), and in the United States (8), and based on conidial morphology, they probably have been found in Japan as C. purpurea var. alopecuri and C. purpurea var. phalaridis (31, 32). Alkaloid production profiles suggest that about 20% of European and North American isolates are G2 isolates (11). The equivocal nature of host and conidial morphology phenotypes resulted in reduction of specific epithets such as C. wilsonii and C. microcephala to synonyms of C. purpurea (20). As G2 is clearly distinguishable from G1, we suggest that G2 should be called by the original name, C. purpurea f. sp. Phalaridis arundinaceae natans (29). G2 and G3 also are distinct chemoraces.

Regardless of the group, the composition of the alkaloid mixture produced by a given isolate is genetically stable (3, 12). The ratio of ergocornine to ergocryptine can be changed by feeding valine, leucine, and isoleucine to cultures and plants inoculated with an ergocornine and ergocryptine-producing C. purpurea strain. However, feeding phenylalanine did not result in ergocristine production (11). Synthesis of cyclopeptides catalyzed in vitro by the multifunctional enzyme LPS1 from a strain producing high levels of ergotamine yields all three groups of peptide ergot alkaloids if their amino acid precursors are added (33), which implies that this enzyme does not regulate the type of alkaloid produced. Regulation studies are hindered by the fact that natural isolates as a rule do not produce alkaloids in culture and producing mutants may have altered regulatory mechanisms.

Our results suggest that from a large, variable, basal population (group G1) that may correspond to former C. purpurea f. sp. secalis, occasionally smaller homogeneous populations develop that can be differentiated as ecological subspecies or varieties and that specialize to fill adjoining ecological niches. DNA and alkaloid analyses now enable us to clearly define populations, which was hitherto not possible by using only host and conidial data.