INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

A host-vector system for the efficient extracellular production of heterologous proteins, involving Bacillus brevis as the host, has been developed (22). Many proteins of bacterial origin could be produced at high levels without much difficulty. However, certain proteins, especially some mammalian ones, still exhibited low productivity. Sagiya et al. improved the B. brevis protein expression system by means such as modification of the signal sequence (17) and isolation of a protease-deficient mutant (7), which was successfully applied to the secretion and accumulation of not only prokaryotic but also eukaryotic proteins. In fact, a change of the signal peptide sequence in the B. brevis system resulted in the higher secretion of many proteins, for example, growth hormones (7, 17), interleukin 2 (21), and protein disulfide isomerase (PDI) (8), and the use of protease-deficient mutants increased the production of extracellular proteins (6, 7). Still another way of increasing protein productivity is to link the gene of interest to a second gene which is already known to be expressed well in the host to generate a fusion protein (9). In most of the successful fusion protein systems the protein of interest is positioned at the C-terminal end of the highly expressed fusion partner (12, 19) to ensure efficient translation initiation. The thioredoxin gene fusion system also provided the solution for another major problem which has bedeviled heterologous gene expression in E. coli, i.e., the formation of inclusion bodies (11). PDI catalyzes the formation, reduction, and isomerization of disulfide bonds in vitro (5) and facilitates the folding of disulfide-bonded proteins in vivo (18). Even though the physiological roles of these multiple functions of PDI during protein folding in the cell remain obscure, PDI, promoting in vitro folding, can be used to improve an expression system for foreign genes. In fact, in a coexpression system, PDI exhibits chaperone-like activity which suppresses the aggregation and increases the yields of heterologous proteins (3, 4).

In this paper, we describe a novel fusion gene expression system based on the use of thermostable PDI as a fusion partner and also report the effect of the disulfide oxidoreductase activity of the fused PDI as to increases in the production of the light chain of immunoglobulin G (IgG) against 11-deoxycortisol, as a disulfide-bonded protein, and geranylgeranyl pyrophosphate synthase (GGPS) from an extremely thermophilic archaea, Sulfolobus acidocaldarius, as a non-disulfide-bonded protein.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Strains, plasmids, and media. B. brevis 31-OK was used as the host (7). Plasmid pNU212 is an expression-secretion vector containing a multiple promoter region and the signal peptide-encoding region of the gene that codes for middle wall protein (MWP) (22) of B. brevis 47. pNH326 was constructed from pNH300 (16) by replacing the MWP signal peptide with a modified signal peptide, R2L6 (17), and by adding the transcription terminator of pHT926 (2). Plasmids pNU211L4PDI (8) and pMalcGG2 (15), containing the fungal PDI gene and the archaeal GGPS gene, respectively, were described previously. Plasmid pFCA-SCHL (13) contained the gene encoding the LC, a chimeric protein of the V_L-C_L domain of anti-11-deoxycortisol Fab and the two Fc binding domains of protein A from Staphylococcus aureus. For the expression of LC, DNA fragments encoding LC were amplified by PCR, for which pFCA-SCHL was used as a template and synthetic oligonucleotides 5'-CCGCCCATGGCTTTCGCTGACATCGAGCTCACC-3' (named MWPLC) and 5'-GCCGCTCGAGAAGCTTTATTAATTCGCGTCTACTTTCGGCGCCTGAGC-3' (named LCSTOP) were used as primers. The nucleotide sequence of MWPLC comprises the 3' terminal sequence of the signal-peptide-encoding region of the mwp gene directly connected to the sequence encoding the N terminus of the LC. An NcoI site is present at its 5' end. The nucleotide sequence of LCSTOP is complementary to that encoding the C terminus of the LC. A stop codon and the HindIII site sequence are attached to its 5' end. The amplified fragment was digested with NcoI and HindIII and then inserted between the NcoI and HindIII sites of pNH326. The plasmid thus constructed was named pNH326LC (Fig. 1A). The fragment comprising the region from SD to the 3' terminus of the PDI-encoding sequence of pNU211L4PDI, an expression vector of PDI, was amplified by PCR, for which the oligonucleotides 5'-CTCGAGAAGCTTAGAGCAGGAGAACACAAGGTATGAAA-3' (named SDMWP) and 5'-GCCAAGCTTATTGAGCTCGTCGTGCTCCGTCGCCGTCTCC-3' (named PDISTOP) were used. The sequence of SDMWP is comprised of that around SD of the mwp gene with a HindIII site attached to its 5' end. The sequence of PDISTOP is complementary to that encoding the C terminus of PDI. A HindIII site sequence was attached to its 5' end. The amplified fragment was digested with XhoI and HindIII and then inserted between the XhoI site, located immediately downstream of the sequence encoding the LC, and the HindIII site of pNH326LC. The constructed plasmid was named pNH326LC/PDI (Fig. 1A).

View larger version (32K): [in this window] [in a new window]   FIG. 1.   Structures of the expression and secretion vectors. (A) Structure of the vector for LC expression. SD, ribosome-binding site of the middle wall protein; SP, signal-peptide-encoding sequence; LC, LC-encoding sequence; Nm, neomycin resistance gene; Pr, promoter of the cell wall protein gene operon in B. brevis; Ori, replication origin. The nucleotide and amino acid sequences of the regions denoted by a, b, c, and d are shown below. *, stop codon. (B) Structure of pNH326PDI-GGPS. The abbreviations and symbols are the same as above.

Enterokinase cleavage. A supernatant containing the PDI-LC fusion protein was dialyzed against EK buffer (5 mM EDTA, 25 mM HEPES-NaOH [pH 8.0]) prior to enterokinase cleavage. The dialyzed culture supernatant was then mixed with porcine enterokinase (specific activity, 100 U/mg; Sigma) in EK buffer at an enzyme-to-substrate ratio of 1:100 (wt/wt) and then incubated at 37°C for 15 h. The reaction was terminated by the addition of p-aminobenzamidine to 5 mM.

Analysis of the expressed proteins. The amounts of the expressed proteins were routinely determined by Western blot analysis according to the method of Burnette (1), except that an anti-Fab fragment polyclonal antibody, as the primary antibody, and an alkaline phosphatase-conjugated goat anti-rabbit IgG, as the secondary antibody, were used for detection of the LC. Rabbit anti-GGPS fused to maltose binding protein antiserum (15) and an alkaline phosphatase-conjugated goat anti-rabbit IgG monoclonal (Fab')₂ were used as the primary and secondary antibodies, respectively, for GGPS detection. BCIP-NBT (5-bromo-4-chloro-3-indolylphosphate-nitroblue tetrazolium) was used as the substrate for the color reaction. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed according to the method of Laemmli (10). For nonreducing SDS-PAGE, dithiothreitol was omitted from the sample buffer. The PDI activity of the fused protein was assayed with scrambled RNase as a substrate according to the method described previously (20). GGPS activity was assayed by the method described previously (15).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Construction of genes encoding fusion proteins. DNA fragments encoding fusion proteins PDI-LC and PDI-GGPS were constructed by the recombinant PCR method. The DNA fragment encoding PDI was amplified with MWPPDI (5'-CCGCCCATGGCTTTCGCTTCGGATGTTGTCCAGCTGAAGA AGG-3') and PDIEK (5'-CTTGTCATCGTCATCACCAGAACCAGAACCGAGCTCGTCGTGCTCCGTCGCCGTCTC C-3') as primers and pNU211L4PDI as a template. The DNA fragment encoding LC was also amplified with a template, pFCA-SCHL, and primers EKLC (5'-GGTTCTGGTTCTGGTGATGACGATGACAAGGACATCGAGCTCACCCAGT CTCCAGCC-3') and LCSTOP (described under Materials and Methods). In the amplified DNA, a polylinker region was joined to the 3' end of the PDI gene and to the 5' end of the LC gene. The DNA fragment encoding the PDI-LC fusion protein was amplified by recombinant PCR with DNAs that were prepared as described above as templates and MWPPDI and LCSTOP as primers. The LC gene was connected in-frame to the C-terminal-encoding end of the PDI gene through a linker sequence. The polylinker peptide was composed of the sequence DDDDK, which is the recognition sequence for the mammalian intestinal protease, enterokinase, to separate PDI from the fusion protein. PDI-LC DNA was digested with NcoI and HindIII and then inserted between the NcoI and HindIII sites of pNH326, an expression vector for B. brevis. The plasmid thus constructed was named pNH326PDI-LC (Fig. 1A).

Production of fusion proteins. The expression vector for LC or GGPS was introduced into B. brevis. Clones expressing the fusion proteins were grown under various conditions, and then the amounts of extracellular fusion proteins were estimated from the intensities of the bands obtained by Western blot analysis or calculated on the basis of the specific activity of the purified enzyme (Table 1). Clones expressing a heterologous protein by itself or coexpressing PDI and LC were also cultured under the same conditions to compare their productivities with fusion expression. The maximum amounts of LC expressed by itself and coexpressed with PDI were only 20 and 10 mg/liter, respectively, even in YC-P2 medium containing 0.3% Tween 40, which was effective for increasing the production levels of some mammalian proteins (21). The addition of PEG 4000 or EDTA, which were also effective for increasing the productivity, also did not increase the productivity, whereas the production level of PDI-LC reached 150 mg/liter. On the other hand, the amounts of extracellular GGPS and GGPS-PDI were 8 and 100 mg/liter, respectively. Thus, the production of LC and GGPS, when expressed as fusion proteins with PDI, was about 8 and 12 times, respectively, greater than when they were expressed by themselves.

View larger version (32K): [in this window] [in a new window]   FIG. 2.   Localization of heterologous proteins expressed by B. brevis. B. brevis 31-OK cells carrying pNH326LC, pNH326LC/PDI, pNH326PDI-LC, pNU212GGPS, or pNH326PDI-GGPS were grown for 6 days at 30°C in YC-P2 medium containing 0.3% Tween 40. The culture supernatant was used as the soluble fraction. The cell pellet was suspended in the same volume as the culture of the sample buffer (62.5 mM Tris-HCl [pH 6.7], 1% SDS, 5% -mercaptoethanol) and then sonicated. This suspension was incubated in boiling water for 2 min and then centrifuged. The resulting supernatant was used as the insoluble fraction. Ten microliters of each of the insoluble and soluble fractions was subjected to SDS-PAGE, followed by immunoblot analysis as described under Materials and Methods. The gels show the localization of LC (A) and GGPS (B). Lanes 1, 3, and 5, insoluble fraction expressed by itself, expressed as a fusion form with PDI, and coexpressed with PDI, respectively; lanes 2, 4, and 6, soluble fraction expressed by itself, expressed as a fusion form with PDI, and coexpressed with PDI, respectively.

The effect of the oxidoreductase activity of PDI on the formation of insoluble aggregates. PDI used as a fusion partner contains two CGHC catalytic sites and can act as an oxidoreductase. When the cysteine residues in each active site of PDI were changed to serine ones (SGHS), the oxidoreductase activity was lost. It has been reported that PDI exhibits chaperone-like activity, e.g., it suppresses rhodanase aggregation in yeast (9), and that the chaperone-like activity of PDI remains unaffected even when both its active sites are changed to SGHS (12). To clarify what function of PDI suppresses aggregation of fusion proteins, LC and GGPS fused with the mutant PDI (mPDI), whose two catalytic site sequences were substituted with SGHS, were expressed in B. brevis. We confirmed that the chimeric proteins fused with mPDI had completely lost their isomerase activity while that of the native PDI fusion remained unaffected. The fusion with mPDI had no effect on the high level of extracellular production of the PDI-GGPS fusion protein (Fig. 3, lanes 3 and 4), indicating that the isomerase activity of PDI is not responsible for the increase in the production of PDI-GGPS, whereas the fusion with mPDI made aggregates appear in the insoluble fraction and decreased the production of soluble PDI-LC in the extracellular fraction (Fig. 3, lanes 1 and 2). These results suggested that the oxidoreductase activity of PDI in the fusion proteins was partly responsible for the suppression of the aggregation of the proteins with disulfides, such as the LC of an IgG, but not those without disulfides, such as GGPS.

View larger version (34K): [in this window] [in a new window]   FIG. 3.   The effect of oxidoreductase activity on aggregate formation. B. brevis 31-OK cells carrying the expression vector for LC or GGPS fused to the native or mutant PDI, respectively, were cultured and treated as described in the legend to Fig. 2. Ten microliters of each of the insoluble and soluble fractions of LC (A) and GGPS (B) was analyzed by SDS-PAGE, followed by immunostaining as described under Materials and Methods. Lanes 1 and 3, the accumulated protein fused to the native and mutant PDI, respectively, in the insoluble fraction; lanes 2 and 4, the secreted protein fused to the native and mutant PDI, respectively, in the soluble fraction.

Characterization of the fusion proteins. The fusion proteins produced by B. brevis were examined as to their biological functions. The expressed LC could not assemble with the heavy chain (HC) in the fusion form. PDI-LC was incubated with bovine enterokinase. PDI-LC was successfully cleaved specifically at the cleavage site in the linker peptide, resulting in a 40-kDa product corresponding to the native LC, as in the case of that expressed by itself (Fig. 4). The LC cleaved from the fusion protein exhibited significant assembly with HC, forming a 70-kDa product corresponding to the Fab' form under nonreducing conditions (data not shown), whereas PDI-GGPS produced by B. brevis exhibited the same GGPS activity as the native GGPS throughout the temperature range examined (Fig. 5). PDI-GGPS specifically produced geranylgeranyl diphosphate from an allylic diphosphate (data not shown). These results indicate that the fusion protein showed the same properties in the fusion form as native archaeal GGPS (14).

View larger version (66K): [in this window] [in a new window]   FIG. 4.   Specific cleavage of the PDI-LC fusion protein by enterokinase. An immunostained SDS-polyacrylamide gel (see Materials and Methods) is shown. Lane 1, marker proteins; lane 2, PDI-LC secreted by B. brevis; lane 3, PDI-LC following cleavage with enterokinase.

View larger version (15K): [in this window] [in a new window]   FIG. 5.   Optimal reaction temperature of PDI-GGPS. Using 50 mM bis-Tris propane (pH 9.5), PDI-GGPS produced by B. brevis was reacted with [14C]isopentenyl diphosphate, dimethylallyl diphosphate, and 5 mM MgCl2 for 30 min at the indicated temperatures. The reaction products were extracted with H2O-saturated butanol, and then the radioactivity of the products was measured with a liquid scintillation counter. The activity at 40°C was defined as 1. Closed and open circles indicate GGPS fused to PDI and native GGPS from the archaea, respectively. The data are the means of at least four independent experiments.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

We succeeded in the efficient secretion and accumulation of the soluble forms of an LC of IgG and an archaeal GGPS by means of a PDI fusion system in B. brevis. PDI has at least two characteristics which may make it a particularly suitable choice for the fusion partner. PDI of H. insolens, a thermophilic fungus, can be secreted and accumulated in the culture medium to a concentration of up to 1.1 g/liter by B. brevis, and even at this production level, all of the PDI remains in a soluble form (8). It was thought that the secretion is affected by the sequence of the signal peptide and the following N-terminal sequence of the protein of interest. It is, however, generally undesirable to change the sequence of a protein to increase its secretion since the N-terminal sequence following the signal peptide is often responsible for the function of the protein of interest. When a fusion protein is expressed, more stable secretion can be expected because the signal peptide can be tuned up to result in efficient secretion of the N-terminal fusion partner regardless of the sequence of the partner. Thus, PDI can act as a leader peptide, which allows efficient secretion of heterologous proteins.

There is another advantage that a PDI fusion can provide: it can act as a molecular chaperone which prevents aggregation and facilitates correct folding. The aggregation of secreted proteins is one of the causes of a decrease in extracellular productivity. In some cases of heterologous protein expression by B. brevis, mature-sized heterologous proteins in the insoluble fraction have been obtained. It is possible that by physically linking a heterologous protein to a stable and highly soluble fusion partner such as PDI, these aggregates might be prevented from forming, allowing correct folding to occur eventually. The fact that PDI is secreted first may allow it to fold before its nascent C-terminal fusion partner, and in this way it is able to passively interact with the partner as it emerges from the outer membrane. In contrast to coexpressed PDI, expression as a fusion form would enable close physical contact between PDI and the heterologous protein domain, facilitating any potential interaction. The enhanced extracellular production of the soluble LC by B. brevis required a physical linkage to PDI and could not be accomplished through coexpression of PDI, suggesting that the PDI domain acts as a covalently linked chaperone. The mechanism suppressing the aggregation through fusion with PDI was not elucidated.

We showed that the oxidoreductase activity of PDI was partially responsible for the suppression of the aggregation of the secreted LC, a protein containing intradisulfides, whereas the aggregation of GGPS, a protein without intradisulfides, could be prevented even with the fusion with PDI lacking oxidoreductase activity (SGHS). From these results, we can speculate that PDI prevents the aggregation of a fusion partner through the synergistic effect of its oxidoreductase and its other chaperone-like activity, leading to an increase in the extracellular production of a heterologous protein. Although each domain of PDI and GGPS in the fusion protein exhibited the expected biological function, the LC did not. Partial biological activity is not unexpected for fusion proteins, since some functional site may be masked by the fusion partner. However, the LC, while inactive in a fusion form, exhibited significant biological activity when cleaved from its partner. This suggests that both PDI and the fused heterologous protein are able to fold correctly when linked together. The PDI used as a fusion partner is a thermostable PDI from a thermophilic fungus and seems to have a very tight tertiary fold, judging from its thermal stability. This folding property is probably very resistant to any perturbation that may be caused by the presence of fused heterologous proteins. This may be the underlying reason why thermostable PDI is such a good fusion partner.