This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Löffler, F. E.
Right arrow Articles by Tiedje, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Löffler, F. E.
Right arrow Articles by Tiedje, J. M.
Agricola
Right arrow Articles by Löffler, F. E.
Right arrow Articles by Tiedje, J. M.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, April 2000, p. 1369-1374, Vol. 66, No. 4
0099-2240/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

16S rRNA Gene-Based Detection of Tetrachloroethene-Dechlorinating Desulfuromonas and Dehalococcoides Species

Frank E. Löffler,1,2,* Qing Sun,1 Jieran Li,1 and James M. Tiedje1

Center for Microbial Ecology, Michigan State University, East Lansing, Michigan 48824-1325,1 and School of Civil and Environmental Engineering, Georgia Institute of Technology, Atlanta, Georgia 30332-05122

Received 19 August 1999/Accepted 29 November 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Members of the genera Desulfuromonas and Dehalococcoides reductively dechlorinate tetrachloroethene (PCE) and trichloroethene. Two primer pairs specific to hypervariable regions of the 16S rRNA genes of the Dehalococcoides group (comprising Dehalococcoides ethenogenes and Dehalococcoides sp. strain FL2) and the acetate-oxidizing, PCE-dechlorinating Desulfuromonas group (comprising Desulfuromonas sp. strain BB1 and Desulfuromonas chloroethenica) were designed. The detection threshold of a nested PCR approach using universal bacterial primers followed by a second PCR with the Desulfuromonas dechlorinator-targeted primer pair was 1 × 103 BB1 cells added per gram (wet weight) of sandy aquifer material. Total community DNA isolated from sediments of three Michigan rivers and six different chloroethene-contaminated aquifer samples was used as template in nested PCR. All river sediment samples yielded positive signals with the BB1- and the Dehalococcoides-targeted primers. One chloroethene-contaminated aquifer tested positive with the Dehalococcoides-targeted primers, and another contaminated aquifer tested positive with the Desulfuromonas dechlorinator-targeted primer pair. Restriction fragment analysis of the amplicons could discriminate strain BB1 from other known Desulfuromonas species. Microcosm studies confirmed the presence of PCE-dechlorinating, acetate-oxidizing Desulfuromonas and hydrogenotrophic Dehalococcoides species in samples yielding positive PCR signals with the specific primers.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Tetrachloroethene (PCE) and trichloroethene (TCE) are abundant groundwater pollutants (1). PCE and TCE can be transformed to less chlorinated ethenes in anaerobic cometabolic processes mediated by methanogenic, homoacetogenic, and sulfate-reducing microorganisms (6, 13). Other groups of bacteria, like Desulfuromonas sp. strain BB1 and Desulfuromonas chloroethenica, Dehalospirillum multivorans, Dehalobacter restrictus strains PER-K23A and TEA, Enterobacter sp. strain MS1, Dehalococcoides ethenogenes, and Desulfitobacterium sp. strain PCE-S (summarized in reference 8), can reduce PCE and TCE in terminal electron accepting processes (chlororespiration). Reductive dechlorination of PCE and TCE in respiratory processes is orders of magnitude faster than anaerobic cometabolic reduction. Hence, the stimulation of respiratory organochlorine reducing bacteria (OCRB) is a promising and cost-effective approach for the remediation of PCE-contaminated sites.

The only available pure culture to date that is capable of complete reductive dechlorination of PCE to ethene is the obligately hydrogenotrophic organism D. ethenogenes (16, 17). Hydrogen is generally considered the ultimate electron donor to stimulate the reductive dechlorination of chloroethenes. Desulfuromonas sp. strain BB1 and D. chloroethenica are unique dechlorinators in regard to their electron donor requirements: acetate, but not hydrogen, supports the reductive dechlorination of PCE and TCE (9; F. E. Löffler, J. Li, J. W. Urbance, and J. M. Tiedje, Abstr. 98th Gen. Meet. Am. Soc. Microbiol. 1998, abstr. Q-177, p. 450, 1998). Members of both groups of PCE dechlorinators are promising candidates to be used in engineered bioremediation approaches and are potentially relevant contributors to the natural attenuation of chloroethenes. Unfortunately, their distribution in anaerobic environments is unknown. Two engineered remediation approaches can be distinguished: (i) the stimulation of indigenous PCE dechlorinating organisms (biostimulation) and (ii) the introduction of organisms that manifest a desired activity which are not present at the contaminated site (bioaugmentation). Both approaches require methods to monitor the presence, distribution, and fate of the organisms of interest; hence, sensitive and specific monitoring systems need to be developed. 16S rDNA-based PCR methods have been used to detect and enumerate particular populations in the environment and to monitor bacterial species in bioaugmentation studies (3-5, 10, 21, 25). However, none of these methods has been applied to strict anaerobic chloroethene-respiring OCRB. The goal of this study was to develop reproducible, sensitive, and specific detection systems for PCE-dechlorinating Dehalococcoides and Desulfuromonas species and to evaluate the presence of these populations in environmental samples.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Cultures and growth conditions. Desulfuromonas sp. strain BB1 was isolated from pristine freshwater sediment collected from the Père Marquette River in Michigan (12; Löffler et al., Abstr. 98th Gen. Meet. Am. Soc. Microbiol. 1998). Strain BB1 was grown in a basal salts mineral medium described previously (11, 13) and amended with 2.5 mM acetate and PCE (27 µl in 1 ml of hexadecane, resulting in an initial aqueous PCE concentration of 0.1 mM). Other Desulfuromonas strains, including Desulfuromonas acetexigens (DSM 1397), Desulfuromonas acetoxidans (DSM 684), Desulfuromonas succinoxidans (DSMZ 8964), and Desulfuromonas thiophila (DSM 8987) were obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ; http://www.dsmz.de) and grown in media recommended by the DSMZ. A culture of D. chloroethenica was kindly provided by L. Krumholz, University of Oklahoma, Norman. E. Harris and D. Lovley, University of Massachusetts, Amherst, kindly provided cultures of Geobacter metallireducens and Pelobacter acetylenicus.

A highly enriched PCE-to-ethene dechlorinating mixed culture was obtained from Red Cedar River sediment (12, 13). A 16S rDNA clone library was established, and the 16S rDNA genes were cloned into the vector pCRII (Invitrogen, San Diego, Calif.) as previously described (19). Sequencing of the cloned 16S rDNA genes revealed the presence of three distinct populations: two Spirochaete species and a population that was related to D. ethenogenes (96.6% sequence similarity). Both Spirochaete populations have been isolated in pure culture and were unable to dechlorinate PCE. Hence, the Dehalococcoides species, designated strain FL2, was inferred to be responsible for PCE-to-ethene dechlorination in this culture. The PCE-dechlorinating mixed culture was maintained in a basal salts mineral medium (11) amended with 0.5 mM acetate, 0.2 mM neat PCE, and hydrogen (10 kPa). Hydrogen and PCE consumption were followed by gas chromatography as previously described (13), and both substrates were replenished as they were depleted.

Primer design. Specific PCR primers were designed using Primer Selecter (DNASTAR, Inc., Madison, Wis.) based on the nearly complete 16S rDNA sequences of strains BB1 and FL2. The specificity of the selected primer combinations was examined with the PROBE-MATCH program of the Ribosomal Database Project (RDP) (14) and the PROBE-CHECK function of the ARB software (www.mikro.biologie.tu-muenchen.de/pub/ARB/documentation/arb.ps). The BB1- and Dehalococcoides-targeted primers yielded amplicons of 835 and 434 bp, respectively. The nucleotide sequences of the Desulfuromonas dechlorinator-targeted forward primer was 5'AACCTTCGGGTCCTACTGTC3' (Escherichia coli 16S rRNA positions 205 to 222), and the sequence of the reverse primer was 5'GCCGAACTGACCCCTATGTT3' (1033 to 1015). The nucleotide sequences of the Dehalococcoides-targeted forward primer was 5'AAGGCGGTTTTCTAGGTTGTCAC3' (728 to 750), and the sequence of the reverse primer was 5'CGTTTCGCGGGGCAGTCT3' (1172 to 1155).

DNA isolation. Genomic DNA from pure cultures was obtained by following a standard protocol described by Maniatis et al. (15). Genomic DNA from G. metallireducens was kindly provided by J. Champine, Southeast Missouri State University, Cape Girardeau. Total DNA from aquifer and sediment material (0.25 g [wet weight]) was isolated with the UltraClean Soil DNA Kit from Mo Bio Laboratories, Inc. (Solana Beach, Calif.), by following the manufacturer's recommendations. DNA from the Bachman aquifer samples was also extracted from a larger sample of 5 g (wet weight) according to a previously described method (27). Purified DNA was dissolved in ultraclean water (Sigma, St. Louis, Mo.), and its concentration was determined spectrophotometrically and adjusted to 10 µg/ml.

PCR. Amplification reactions were performed in a total volume of 20 µl. The reaction mixtures contained 2 µl of 10× reaction buffer (Boehringer GmbH, Mannheim, Germany), 2.5 mM MgCl2, 250 nM concentrations of each primer, 250 µM concentrations of each deoxynucleoside triphosphate (Gibco BRL, Gaithersburg, Md.), 2.5 U of AmpliTaq polymerase (Gibco), 14 µg of bovine serum albumin (Boehringer Mannheim), and 10 ng of template DNA. Amplifications were carried out in a 9600 GeneAmp PCR system (PE Biosystems, Norwalk, Conn.). The following thermocycling program was used for the specific primers: 94°C for 3 min (1 cycle); 94°C for 45 s, 58°C for 30 s, and 72°C for 1.5 min (30 cycles); 72°C for 7 min (1 cycle). Annealing temperatures ranging from 48 to 68°C were tested, and a temperature of 58°C resulted in reproducible amplifications of the 16S rDNA sequences of the target organisms. For nested PCR, the initial amplification was performed with a pair of universal bacterial primers (8F [5'AGAGTTTGATCCTGGCTCAG3', E. coli 16S rRNA positions 8 to 27] and 1541R [5'AAGGAGGTGATCCAGCCGCA3', E. coli 16S rRNA positions 1541 to 1522]) (26) under the same conditions described above except that the annealing temperature was 55°C. The specific primers were then used in the second PCR, using the amplified products (0.2 to 10 µl) from the initial PCR as templates. Aliquots (3 to 5 µl) of the PCR products were resolved in 0.9% (wt/vol) agarose gels in Tris-acetate-EDTA buffer (15) and stained in aqueous ethidium bromide solution (0.5 µg/ml) for 25 min. After rinsing the gels with water, the bands were visualized by UV excitation and pictures were taken with a digital camera (Genomic Solutions Inc., Ann Arbor, Mich.). The 1-kb DNA ladder from Gibco was used as the size marker.

To perform PCR on cell lysates, bacterial cells from 1 ml of culture fluid were collected by centrifugation. The pellets were washed twice with 50 mM filter-sterilized potassium phosphate buffer (pH 7.5) and suspended in 10 µl of water. Aliquots (1 µl) or 10-fold dilutions in water of these suspensions were then used as templates for amplification. To estimate the detection threshold with the Dehalococcoides-targeted primer pair, strain FL2's 16S rDNA gene was cloned into vector pCR2.1 (TA Cloning Kit; Invitrogen, Carlsbad, Calif.). Plasmid DNA containing a single copy of strain FL2's 16S rDNA gene was isolated with the QIAGEN Plasmid Mini Kit (QIAGEN Inc., Valencia, Calif.) according to the manufacturer's protocol. Purified plasmid DNA was serially diluted with water and used as the template for nested PCR. The nested PCR approach was used for all experiments, unless indicated otherwise. When defined templates were used, the identities of the PCR products obtained with the BB1- and the Dehalococcoides-targeted primers were confirmed by double-stranded sequencing of the entire amplicons. Amplicons obtained from environmental samples were partially sequenced to verify their identity and further characterized by restriction fragment length polymorphism (RFLP) analysis.

In order to determine the sensitivity of detection with heterogeneous templates, PCR was performed with DNA extracted from aquifer solids amended with Desulfuromonas sp. strain BB1 alone or with strain BB1 and E. coli cells together. A sandy aquifer material that showed no PCE dechlorination activity under a variety of electron donor conditions and that never yielded amplification products with the specific primers was used in this experiment. E. coli JM109 was grown in Luria-Bertani LB medium at 37°C for 6 h, and Desulfuromonas sp. strain BB1 was grown with acetate and PCE. To quantify biomass, the cells were washed with phosphate buffer and diluted 10-, 20-, and 100-fold in 50 mM filter-sterilized potassium phosphate buffer (pH 7.5). The cells were stained with acridine orange (final concentration, 0.1% [wt/vol]) for 1 h in the dark. Samples were then filtered through 0.2-µm-pore-size polycarbonate membranes (Millipore, Bedford, Mass.), and the cells were counted by computer-assisted light microscopy (20). A 0.1-ml suspension of 0 to 106 BB1 cells was added to 0.25 g (wet weight) of nonsterilized aquifer material and incubated for 1 h at room temperature under aerobic conditions. In another experiment, 0.1 ml of 10-fold diluted suspensions of BB1 cells and 3 × 107 E. coli JM109 cells (0.1 ml) were mixed with 0.25 g of sterilized aquifer material. Total DNA was extracted from the samples by using the UltraClean Soil DNA Kit and used as the template for PCR.

Sample collection. Samples were collected from three Michigan rivers and six contaminated aquifers (Table 1). The Au Sable River and the Père Marquette River sampling sites are located in quality fly fishing zones in National Forest Recreation Areas and are considered pristine environments. The Red Cedar River and the Au Sable River were sampled repeatedly at the same location. The Père Marquette River samples were collected twice from the same site (location PM 0) and once in September 1998 from three additional locations approximately 25, 75, and 150 m downstream (locations PM 1, PM 2, and PM 3, respectively). The aquifer samples from the Cape Canaveral site (Fla.), the Jacksonville site (Fla.), the Schoolcraft site (Mich.), and the B&J Industrial site (Mich.) were kindly provided by D. Fennell, G. Sewell, M. Dybas, and E. Petrovskis, respectively. Samples from the Jacksonville site were available from locations MW 510 (dissolved plume) and IW001 (source area). Samples from the Bachman Road site in Oscoda, Mich., were obtained from four different locations inside the chloroethene-plume (samples 1At, 1Bb, 2At, and 2Bb). Material was also collected from the noncontaminated area upstream of the plume (locations A and D). Individual samples were mixed by hand under sterile conditions to visual homogeneity and kept at 4°C under nitrogen.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Characteristics of sediment and aquifer samples used as starting material for DNA extraction and anaerobic microcosms and test resultsa

Microcosms. Microcosms were established inside an anaerobic chamber with a nitrogen-hydrogen (97/3 [vol/vol]) atmosphere in 20-ml vials containing 2 g (wet weight) of aquifer or sediment material as previously described (11). One set of microcosms was flushed with sterile hydrogen-free dinitrogen to remove residual hydrogen, and then 5 mM acetate and 1.25 µl of PCE dissolved in 0.1 ml of hexadecane (resulting in a final aqueous PCE concentration of about 0.2 mM) were added by syringe. A second set of microcosms was amended with PCE dissolved in hexadecane, and 3 ml of hydrogen (30 kPa) was added as the electron donor. Hydrogen consumption and dechlorination were monitored by gas chromatography, and acetate oxidation was measured by high-performance liquid chromatography as previously described (11, 22). Negative controls included heat-treated (autoclaved on two consecutive days for 30 min) microcosms and cultures that did not receive an electron donor. Duplicate microcosms were established for each treatment.

RFLP analysis of amplified PCR products. The amplified fragments were digested with the restriction endonucleases SmaI or EcoRI (Gibco) according to the manufacturer's recommendations. The DNA fragments were resolved in 2% (wt/vol) Metaphor agarose (FMC Bioproducts, Rockland, Maine) in the presence of ethidium bromide (0.5 µg/ml) and fresh Tris-borate-EDTA buffer (15) at 4°C. Fragment sizes were estimated by using the DNA Molecular Weight Marker V (Boehringer).

Sequencing. 16S rDNA amplicons were purified (Wizard PCR Preps; Promega, Madison, Wis.) prior to sequencing by the fluorescent Dideoxy termination method at Michigan State University's sequencing facility. Automated fluorescent Taq cycle sequencing was performed with an ABI Catalyst 800-ABI 373A sequencing system (Applied Biosystems, Foster City, Calif.) using previously described bacterial-specific primers targeted to conserved regions of the 16S rDNA gene (26).


    RESULTS AND DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Primer specificity. Specific primers directed against hypervariable regions of the 16S rRNA genes of Desulfuromonas sp. strain BB1 and Dehalococcoides sp. strain FL2 were designed. The former was developed following alignment of the selected sequences with the corresponding 16S rDNA regions of other Desulfuromonas species (Fig. 1). Direct and nested PCR performed with cell lysates of D. acetexigens, D. chloroethenica, and Desulfuromonas sp. strain BB1 yielded amplification products of the expected size and sequence, although D. acetexigens always produced only a faint band (Fig. 2). None of the other bacterial strains tested, including D. thiophila, Desulfuromonas palmitatis, D. acetoxidans, D. succinoxidans, P. acetylenicus, and G. metallireducens, resulted in amplification regardless of the template used (cell lysates or isolated genomic DNA). Hence, the primers were reasonably specific for the known PCE dechlorinators of this genus.


View larger version (27K):
[in this window]
[in a new window]
 
FIG. 1.   Alignment of parts of Desulfuromonas sp. strain BB1's 16S rRNA gene sequence with corresponding regions of phylogenetically related Desulfuromonas species. The sequences shown stem from variable regions and were used to generate Desulfuromonas dechlorinator-targeted oligonucleotide primers. A hyphen indicates a gap, and a dot indicates sequence identity to the 16S rDNA sequence of Desulfuromonas sp. strain BB1.


View larger version (56K):
[in this window]
[in a new window]
 
FIG. 2.   Primer specificity. Cell lysates of phylogenetically related Desulfuromonas species were used as templates for the Desulfuromonas dechlorinator-targeted primer pair. Lanes: 1, 1-kb ladder marker; 2, BB1 genomic DNA (positive control); 3, D. acetoxidans; 4, D. thiophila; 5, D. succinoxidans; 6, Desulfuromonas sp. strain BB1; 7, D. chloroethenica; 8, D. acetexigens; 9, no target DNA (negative control).

The genus Dehalococcoides forms a separate phylogenetic lineage, and its two known members (D. ethenogenes and strain FL2) are not closely affiliated with other known bacteria. The primer pair was designed to detect both strains and therefore be more comprehensive, yet remain specific for the group. Purified DNA from several other chlororespiring bacteria was used as template for the Dehalococcoides-targeted primers. As expected, amplification occurred only when DNA (or cell lysates) of the defined PCE-dechlorinating mixed culture or an E. coli clone containing the 16S rDNA gene of strain FL2 was used as a template.

Sensitivity. One to 10 pg of genomic DNA from strain BB1 was required to yield a visible band in direct PCR with the specific primers on ethidium bromide-stained agarose gels (data not shown). This amount corresponded to approximately 102 to 103 BB1 cells, assuming that a single BB1 cell contains about 8.8 fg of DNA (18). When whole cells were added as templates to the PCR reaction mixtures, 7 × 103 BB1 cells were required to yield a positive signal (data not shown). The nested PCR approach decreased the detection threshold by 3 orders of magnitude, and 1 to 10 BB1 cells were then sufficient to yield a visible band. The detection threshold for whole cells of strain BB1 was also evaluated by mixing a known number of BB1 cells with sterilized sandy aquifer material. An inoculum of 1 × 103 BB1 cells per g (wet weight) of aquifer material was required to yield a reproducible amplification with the Desulfuromonas dechlorinator-targeted primers in nested PCR. In the presence of 1.2 × 108 E. coli cells, the detection limit for strain BB1 decreased to about 3 × 105 BB1 cells per g (wet weight) of aquifer material when the specific primers were used directly on extracted DNA, and 3 × 103 BB1 cells were required to yield a signal in the nested approach (data not shown). Since Dehalococcoides strain FL2 is not available in pure culture, serially diluted plasmid DNA containing strain FL2's 16S rDNA gene was used to evaluate the sensitivity of the Dehalococcoides-targeted primers. One to 10 copies of strain FL2's 16S rRNA gene were sufficient to yield the expected PCR product in the nested PCR approach. Detection thresholds depend on various factors, such as the type of target organism (gram positive or gram negative), the type and composition of the matrix (aquifer, sediment, or soil), the number of other bacteria present in the sample material (competing target DNA in initial PCR), the quality and type of DNA-dependent DNA polymerase used, the additions made to relieve inhibition in PCR amplification (e.g., bovine serum albumin [BSA]), and the DNA extraction protocol used. The detection thresholds obtained with the methodology used in this study are consistent with the detection limits observed in other studies when 16S rDNA-based PCR approaches were used (3, 4, 5, 10, 21, 23, 24).

Detection in environmental samples. The specific primers were used to detect PCE-dechlorinating Desulfuromonas and Dehalococcoides species in six different aquifer samples and three Michigan river sediment samples. (i) River sediments. Initial PCR with universal bacterial-specific primers yielded products of the expected size from all river sediment samples. Most interestingly, all river sediment samples yielded amplification products with the Desulfuromonas dechlorinator-targeted (Fig. 3A) and the Dehalococcoides-targeted (Fig. 3B) primer sets. These results were independent of the sampling season (spring, summer, fall and winter) and were not influenced by a storage period of up to 4 years at 4°C. The activities of one or more hydrogenotrophic PCE-to-ethene dechlorinating populations, as well as acetate-oxidizing PCE-to-cis-1,2-dichloroethene dechlorinating populations, were confirmed in the microcosm experiments (Table 1). In the direct PCR approach with the BB1- and Dehalococcoides-targeted primers, only two sediment samples collected from the Père Marquette River (locations PM 1 and PM 2) resulted in positive signals. (ii) Aquifer materials. In contrast to the sediment materials, the Jacksonville MW510 sample was the only aquifer material that resulted in visible amplification in the initial PCR with the universal primers. To ensure that the samples that did not yield a visible band of amplified product were suitable for a second round of PCR, a second pair of universal primers (342F [5'CTACGGG(AG)(GC)GCAGCAG3', E. coli 16S rRNA positions 342 to 357] and 1115R [5'AGGGTTGCGCTCGTTG3', positions 1115 to 1100]) was used to amplify an internal region of the 16S rDNA fragments amplified in the initial PCR. Amplicons from all samples, including those that did not yield a visible band in the initial PCR with the universal primers 8F and 1541R, were amplified in this control experiment (data not shown). Hence, the initial PCR yielded DNA fragments from all samples that were suitable for PCR amplification with the specific primers. Nested PCR with the Dehalococcoides-targeted primers yielded a positive signal with the Jacksonville MW510 sample, but no amplification occurred with any other aquifer material (Fig. 3B). The microcosm studies confirmed the results obtained with the molecular approach. The Jacksonville MW510 microcosms were the only aquifer material-based microcosms that indicated the presence of a hydrogenothrophic PCE-dechlorinating population. Vinyl chloride and ethene accumulated in hydrogen-fed microcosms, whereas acetate-amended cultures showed only negligible dechlorination. Such dechlorination patterns are expected for Dehalococcoides species that depend on hydrogen as the electron donor and cannot couple PCE dechlorination to acetate oxidation. Amplification with the Desulfuromonas dechlorinator-targeted primers was observed in one aquifer sample and occurred with the DNA preparation extracted from aquifer material collected at location 1Bb of the Bachman Road site (Fig. 3A). No amplification, however, was seen with DNA isolated from Bachman locations 1At, 2At, and 2Bb, even though the microcosm experiments indicated the activity of acetate-oxidizing, PCE-dechlorinating populations at all locations inside the plume (Table 1). With an alternate DNA extraction method (27) that used a larger amount of fresh aquifer solids (5 g), an additional sample (location 2Bb) tested positive with the Desulfuromonas dechlorinator-targeted primers prior to enrichment. After 4 months of incubation with acetate and PCE, the microcosms established with Bachman material were sacrificed and the extracted DNA was used as a template in nested PCR. Again, PCR with the universal primers did not yield visible amplification products on agarose gels; however, three out of four PCE-dechlorinating microcosms tested positive with the Desulfuromonas dechlorinator-targeted primers, indicating the presence of a BB1-like population (Table 1). Samples A and D, which were collected upstream of the plume, did not show PCE-dechlorinating activity and never yielded amplification products in PCR. None of the other aquifer samples yielded amplification products with the Desulfuromonas dechlorinator-targeted primers. With the exception of the enrichments obtained from the Cape Canaveral site material, this observation agreed with the microcosm studies. Microcosms established with Cape Canaveral aquifer material dechlorinated PCE to cis-DCE with acetate as the only electron donor, but no amplification was observed with the Desulfuromonas dechlorinator-targeted primers. The false negative results obtained with Cape Canaveral aquifer material could be explained by the presence of other, as-yet-unidentified, acetate-oxidizing, PCE-dechlorinating populations.


View larger version (61K):
[in this window]
[in a new window]
 
FIG. 3.   Detection of PCE dechlorinators in environmental samples. Total DNA was isolated from 0.25 g of aquifer or sediment material and used as template DNA in a first-round amplification with universal bacterial-specific primers. The Desulfuromonas dechlorinator- and Dehalococcoides-targeted primers were then used in a second amplification phase (nested PCR approach). (A) Nested PCR with the Desulfuromonas dechlorinator-targeted primer pair. (B) Nested PCR with the Dehalococcoides-targeted primer pair. Lanes 1, 1-kb ladder markers; lanes 2 to 6, Bachman aquifer samples 1Bb, 1At, 2Bb, 2At, and 4A, respectively; lanes 7 to 12, aquifer samples from Cape Canaveral, Jacksonville MW510 and IW001, B&J Industrial site C and D, Schoolcraft, respectively; lanes 13, sandy aquifer material used in E. coli experiment; lanes 14 to 19, freshwater sediment samples from Red Cedar River (collected July 1995, May 1998, and November 1998), Père Marquette River (collected April 1995 and September 1998), and Au Sable River, respectively; lanes 20, negative controls.

RFLP analysis of amplicons. RFLP analysis performed on the amplicons obtained with the Desulfuromonas dechlorinator-targeted primers could distinguish between Desulfuromonas sp. strain BB1, D. chloroethenica, and D. acetexigens. According to published sequence data for D. chloroethenica (GenBank accession no. U49748), the amplified fragments of strain BB1 and D. chloroethenica should be distinguishable by their unique RFLP patterns generated by SmaI or EcoRI digestion. RFLP patterns of SmaI-digested amplicons, however, failed to distinguish the two strains (data not shown). Partial sequencing of the 16S rDNA of D. chloroethenica revealed two SmaI sites which were also present in strain BB1's 16S rDNA gene. No EcoRI sites, however, were present in the D. chloroethenica and D. acetexigens amplicons, and RFLP patterns obtained with EcoRI could distinguish strain BB1 from D. chloroethenica and D. acetexigens (Fig. 4). Figure 4 shows the RFLP patterns after EcoRI digestion of the amplicons obtained with the Desulfuromonas dechlorinator-targeted primers from the different river sediments. All EcoRI-digested amplicons yielded RFLP patterns identical to those of Desulfuromonas sp. strain BB1, suggesting that this type of organism is more commonly distributed in the environment. As expected from computational analysis, the amplicons obtained with the Dehalococcoides-targeted primers could not be distinguished by RFLP analysis. Computer alignment of the amplicons from both strains revealed a 9-bp duplication at the 5' end in the D. ethenogenes 16S rDNA fragment. If this duplication is not a sequencing error, it would result in a 9-bp-longer 443-bp amplicon with 16S rDNA from D. ethenogenes.


View larger version (60K):
[in this window]
[in a new window]
 
FIG. 4.   RFLP analysis of amplicons obtained with the Desulfuromonas dechlorinator-targeted primers. Amplicons were digested with the restriction endonuclease EcoRI, and fragments were separated on a 2% metaphor agarose gel. Lane 1, DNA marker V; lanes 2 to 9, digested amplicons obtained from Desulfuromonas sp. strain BB1, D. chloroethenica, the Red Cedar River (collected July 1995, May 1998, and November 1998), the Père Marquette River (locations PM 0 and PM 1, collected September 1998), and the Au Sable River, respectively; lane 10, undigested PCR product obtained from D. chloroethenica.

The results obtained with the BB1- and Dehalococcoides-targeted primers were supported by the microcosm studies, and no false positive results were obtained with the nested PCR approach. Hence, the primers may be useful in assessing the type of bioremediation that may be productive at contaminated sites. It remains unknown why (obligate) PCE respirers can be found in pristine river sediments. One explanation is an enzyme system with multiple functions. Another intriguing explanation would be the presence of nonanthropogenic sources of PCE in river sediments. The biotic or abiotic formation of chlorinated ethenes could explain the presence and persistence of obligately chloroethene-respiring populations, although such mechanisms have never been demonstrated in river sediments. There is, however, evidence for the abiotic (7) and biotic (2, 7) formation of PCE and TCE in other environments. Further research is required to understand how apparently obligate chlororespiring populations survive in pristine freshwater sediments.

The nested PCR methodology is useful to detect Dehalococcoides and BB1-like populations in environmental samples and to monitor their fate in bioaugmentation approaches. Since the abundance of these populations in environmental samples can be too low for detection, enrichment under appropriate conditions to increase the number of target organisms is recommended to prevent false negative results. This is especially true for samples from oligotrophic environments, such as many aquifers, which generally support a lower biomass than river sediments.


    ACKNOWLEDGMENTS

This research was supported by Department of Energy grant DE-FG07-96ER62319 to F.E.L. and J.M.T., the Michigan Department of Environmental Quality, an SBIR grant from the U.S. Air Force (no. 98WML-464), and the National Science Foundation grant DEB9120006 through the Center for Microbial Ecology.

John Urbance and James Cole are gratefully acknowledged for helpful discussions and Patricia Sobecky for the critical reading of the manuscript.


    FOOTNOTES

* Corresponding author. Mailing address: School of Civil and Environmental Engineering, 200 Bobby Dodd Way, 202 DEEL, Georgia Institute of Technology, Atlanta, GA 30332-0512. Phone: (404) 894-0279. Fax: (404) 894-8266. E-mail: frank.loeffler{at}ce.gatech.edu.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

1. Abelson, P. H. 1990. Inefficient remediation of ground-water pollution. Science 250:733[Free Full Text].
2. Abrahamson, K., A. Ekdahl, J. Collén, E. Fahlström, and M. Pedersén. 1995. The natural formation of trichloroethylene and perchloroethylene in seawater, p. 327-331. In A. Grimwall, and E. W. B. de Leer (ed.), Naturally-produced organohalogens. Kluwer Academic Publishers, Dordrecht, The Netherlands.
3. Briglia, M., R. I. L. Eggen, W. M. deVos, and J. D. van Elsas. 1996. Rapid and sensitive method for the detection of Mycobacterium chlorophenolicum PCP-1 in soil based on 16S rDNA gene-targeted PCR. Appl. Environ. Microbiol. 62:1478-1480[Abstract].
4. Degrange, V., and R. Bardin. 1995. Detection and counting of Nitrobacter populations in soil by PCR. Appl. Environ. Microbiol. 61:2093-2098[Abstract].
5. Fantroussi, S. E., J. Mahillon, H. Naveau, and S. N. Agathos. 1997. Introduction and PCR detection of Desulfomonile tiedjei in soil slurry microcosms. Biodegradation 8:125-133[CrossRef][Medline].
6. Fetzner, S. 1998. Bacterial dehalogenation. Appl. Microbiol. Biotechnol. 50:633-657[CrossRef][Medline].
7. Gribble, G. W. 1998. Naturally occurring organohalogen compounds. Acc. Chem. Res. 31:141-152[CrossRef].
8. Holliger, C., D. Hahn, H. Harmsen, W. Ludwig, W. Schumacher, B. Tindall, F. Vazquez, N. Weiss, and A. J. B. Zehnder. 1998. Dehalobacter restrictus gen. nov. and sp. nov., a strictly anaerobic bacterium that reductively dechlorinates tetra- and trichloroethene in an anaerobic respiration. Arch. Microbiol. 169:313-321[CrossRef][Medline].
9. Krumholz, L. R., R. Sharp, and S. Fishbain. 1996. A freshwater anaerobe coupling acetate oxidation to tetrachloroethene dehalogenation. Appl. Environ. Microbiol. 62:4108-4113[Abstract].
10. Lévesque, M.-J., S. L. Boissière, J.-C. Thomas, R. Beaudet, and R. Villemur. 1997. Rapid method for detecting Desulfitobacterium frappieri strain PCP-1 in soil by the polymerase chain reaction. Appl. Environ. Microbiol. 47:719-725.
11. Löffler, F. E., J. E. Champine, K. M. Ritalahti, S. J. Sprague, and J. M. Tiedje. 1997. Complete reductive dechlorination of 1,2-dichloropropane by anaerobic bacteria. Appl. Environ. Microbiol. 63:2870-2875[Abstract].
12. Löffler, F. E., K. M. Ritalahti, and J. M. Tiedje. 1997. Dechlorination of chloroethenes is inhibited by 2-bromoethanesulfonate in the absence of methanogens. Appl. Environ. Microbiol. 63:4982-4985[Abstract].
13. Löffler, F. E., J. M. Tiedje, and R. A. Sanford. 1999. Fractions of electrons consumed in electron acceptor reduction and hydrogen thresholds as indicators of halorespiratory physiology. Appl. Environ. Microbiol. 65:4049-4056[Abstract/Free Full Text].
14. Maidak, B. L., J. R. Cole, C. T. Parker, Jr., G. M. Garrity, N. Larsen, B. Li, T. G. Lilburn, M. J. McCaughey, G. J. Olsen, R. Overbeek, S. Pramanik, T. M. Schmidt, J. M. Tiedje, and C. R. Woese. 1999. A new version of the RDP (Ribosomal Database Project). Nucleic Acids Res. 27:171-173[Abstract/Free Full Text].
15. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
16. Maymó-Gatell, X., Y.-T. Chien, J. M. Gossett, and S. H. Zinder. 1997. Isolation of a bacterium that reductively dechlorinates tetrachloroethene to ethene. Science 276:1568-1571[Abstract/Free Full Text].
17. Maymó-Gatell, X., T. Anguish, and S. H. Zinder. 1999. Reductive dechlorination of chlorinated ethenes and 1,2-dichloroethane by "Dehalococcoides ethenogenes" 195. Appl. Environ. Microbiol. 65:3108-3113[Abstract/Free Full Text].
18. Neidhardt, C. F., and E. Umbarger. 1996. Chemical composition of Escherichia coli, p. 13-16. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. American Society for Microbiology, Washington, D.C.
19. Nüsslein, K., and J. M. Tiedje. 1998. Characterization of the dominant and rare members of a young Hawaiian soil bacterial community with small-subunit ribosomal DNA amplified from DNA fractionated on the basis of its guanine and cytosine composition. Appl. Environ. Microbiol. 64:1283-1289[Abstract/Free Full Text].
20. Paul, E. A., D. Harris, M. Klug, and R. Ruess. 1999. The determination of microbial biomass, p. 291-317. In G. P. Robertson, C. S. Bledsoe, D. C. Coleman, and P. Sollins (ed.), Standard soil methods for long term ecological research. Oxford University Press, New York, N.Y.
21. Picard, C., C. Ponsonnet, E. Paget, X. Nesme, and P. Simonet. 1992. Detection and enumeration of bacteria in soil by direct DNA extraction and polymerase chain reaction. Appl. Environ. Microbiol. 58:2717-2722[Abstract/Free Full Text].
22. Sanford, R. A., J. R. Cole, F. E. Löffler, and J. M. Tiedje. 1996. Characterization of Desulfitobacterium chlororespirans sp. nov., which grows by coupling the oxidation of lactate to the reductive dechlorination of 3-chloro-4-hydroxybenzoate. Appl. Environ. Microbiol. 62:3800-3808[Abstract].
23. Smalla, K., N. Cresswell, L. C. Mendonce-Hagler, A. Wolters, and J. D. van Elsas. 1993. Rapid DNA extraction protocol from soil for polymerase chain reaction-mediated amplification. J. Appl. Bacteriol. 74:78-85.
24. Tsai, Y.-L., and B. H. Olsen. 1992. Detection of low numbers of bacterial cells in soils and sediments by polymerase chain reaction. Appl. Environ. Microbiol. 58:754-757[Abstract/Free Full Text].
25. Volossiouk, T., I. J. Robb, and R. N. Nazar. 1995. Direct DNA extraction for PCR-mediated assays of soil organisms. Appl. Environ. Microbiol. 61:3972-3976[Abstract].
26. Zhou, J., M. R. Fries, R. A. Sanford, and J. M. Tiedje. 1995. Phylogenetic analysis of a new group of denitrifiers capable of anaerobic growth on toluene and description of Azoarcus tolulyticus sp. nov. Int. J. Syst. Bacteriol. 45:500-506[Abstract/Free Full Text].
27. Zhou, J., M. A. Bruns, and J. M. Tiedje. 1996. DNA recovery from soils of diverse composition. Appl. Environ. Microbiol. 62:316-322[Abstract].


Applied and Environmental Microbiology, April 2000, p. 1369-1374, Vol. 66, No. 4
0099-2240/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Cheng, D., He, J. (2009). Isolation and Characterization of "Dehalococcoides" sp. Strain MB, Which Dechlorinates Tetrachloroethene to trans-1,2-Dichloroethene. Appl. Environ. Microbiol. 75: 5910-5918 [Abstract] [Full Text]  
  • Tas, N., van Eekert, M. H. A., Schraa, G., Zhou, J., de Vos, W. M., Smidt, H. (2009). Tracking Functional Guilds: "Dehalococcoides" spp. in European River Basins Contaminated with Hexachlorobenzene. Appl. Environ. Microbiol. 75: 4696-4704 [Abstract] [Full Text]  
  • Amos, B. K., Sung, Y., Fletcher, K. E., Gentry, T. J., Wu, W.-M., Criddle, C. S., Zhou, J., Loffler, F. E. (2007). Detection and Quantification of Geobacter lovleyi Strain SZ: Implications for Bioremediation at Tetrachloroethene- and Uranium-Impacted Sites. Appl. Environ. Microbiol. 73: 6898-6904 [Abstract] [Full Text]  
  • Yum, J. H., Kim, C. K., Yong, D., Lee, K., Chong, Y., Kim, C. M., Kim, J. M., Ro, S., Cho, J. M. (2007). In Vitro Activities of CG400549, a Novel FabI Inhibitor, against Recently Isolated Clinical Staphylococcal Strains in Korea. Antimicrob. Agents Chemother. 51: 2591-2593 [Abstract] [Full Text]  
  • Nevin, K. P., Holmes, D. E., Woodard, T. L., Covalla, S. F., Lovley, D. R. (2007). Reclassification of Trichlorobacter thiogenes as Geobacter thiogenes comb. nov.. Int. J. Syst. Evol. Microbiol. 57: 463-466 [Abstract] [Full Text]  
  • Dahle, H., Birkeland, N.-K. (2006). Thermovirga lienii gen. nov., sp. nov., a novel moderately thermophilic, anaerobic, amino-acid-degrading bacterium isolated from a North Sea oil well.. Int. J. Syst. Evol. Microbiol. 56: 1539-1545 [Abstract] [Full Text]  
  • Ritalahti, K. M., Amos, B. K., Sung, Y., Wu, Q., Koenigsberg, S. S., Loffler, F. E. (2006). Quantitative PCR Targeting 16S rRNA and Reductive Dehalogenase Genes Simultaneously Monitors Multiple Dehalococcoides Strains. Appl. Environ. Microbiol. 72: 2765-2774 [Abstract] [Full Text]  
  • Sung, Y., Fletcher, K. E., Ritalahti, K. M., Apkarian, R. P., Ramos-Hernandez, N., Sanford, R. A., Mesbah, N. M., Loffler, F. E. (2006). Geobacter lovleyi sp. nov. Strain SZ, a Novel Metal-Reducing and Tetrachloroethene-Dechlorinating Bacterium. Appl. Environ. Microbiol. 72: 2775-2782 [Abstract] [Full Text]  
  • Sung, Y., Ritalahti, K. M., Apkarian, R. P., Loffler, F. E. (2006). Quantitative PCR Confirms Purity of Strain GT, a Novel Trichloroethene-to-Ethene-Respiring Dehalococcoides Isolate.. Appl. Environ. Microbiol. 72: 1980-1987 [Abstract] [Full Text]  
  • Lee, K., Yum, J. H., Yong, D., Lee, H. M., Kim, H. D., Docquier, J.-D., Rossolini, G. M., Chong, Y. (2005). Novel Acquired Metallo-{beta}-Lactamase Gene, blaSIM-1, in a Class 1 Integron from Acinetobacter baumannii Clinical Isolates from Korea. Antimicrob. Agents Chemother. 49: 4485-4491 [Abstract] [Full Text]  
  • Yoshida, N., Takahashi, N., Hiraishi, A. (2005). Phylogenetic Characterization of a Polychlorinated-Dioxin- Dechlorinating Microbial Community by Use of Microcosm Studies. Appl. Environ. Microbiol. 71: 4325-4334 [Abstract] [Full Text]  
  • Watts, J. E. M., Fagervold, S. K., May, H. D., Sowers, K. R. (2005). A PCR-based specific assay reveals a population of bacteria within the Chloroflexi associated with the reductive dehalogenation of polychlorinated biphenyls. Microbiology 151: 2039-2046 [Abstract] [Full Text]  
  • Seshadri, R., Adrian, L., Fouts, D. E., Eisen, J. A., Phillippy, A. M., Methe, B. A., Ward, N. L., Nelson, W. C., Deboy, R. T., Khouri, H. M., Kolonay, J. F., Dodson, R. J., Daugherty, S. C., Brinkac, L. M., Sullivan, S. A., Madupu, R., Nelson, K. E., Kang, K. H., Impraim, M., Tran, K., Robinson, J. M., Forberger, H. A., Fraser, C. M., Zinder, S. H., Heidelberg, J. F. (2005). Genome Sequence of the PCE-Dechlorinating Bacterium Dehalococcoides ethenogenes. Science 307: 105-108 [Abstract] [Full Text]  
  • Krajmalnik-Brown, R., Holscher, T., Thomson, I. N., Saunders, F. M., Ritalahti, K. M., Loffler, F. E. (2004). Genetic Identification of a Putative Vinyl Chloride Reductase in Dehalococcoides sp. Strain BAV1. Appl. Environ. Microbiol. 70: 6347-6351 [Abstract] [Full Text]  
  • Holscher, T., Krajmalnik-Brown, R., Ritalahti, K. M., von Wintzingerode, F., Gorisch, H., Loffler, F. E., Adrian, L. (2004). Multiple Nonidentical Reductive-Dehalogenase-Homologous Genes Are Common in Dehalococcoides. Appl. Environ. Microbiol. 70: 5290-5297 [Abstract] [Full Text]  
  • Duhamel, M., Mo, K., Edwards, E. A. (2004). Characterization of a Highly Enriched Dehalococcoides-Containing Culture That Grows on Vinyl Chloride and Trichloroethene. Appl. Environ. Microbiol. 70: 5538-5545 [Abstract] [Full Text]  
  • Holmes, D. E., Nevin, K. P., Lovley, D. R. (2004). Comparison of 16S rRNA, nifD, recA, gyrB, rpoB and fusA genes within the family Geobacteraceae fam. nov.. Int. J. Syst. Evol. Microbiol. 54: 1591-1599 [Abstract] [Full Text]  
  • Muller, J. A., Rosner, B. M., von Abendroth, G., Meshulam-Simon, G., McCarty, P. L., Spormann, A. M. (2004). Molecular Identification of the Catabolic Vinyl Chloride Reductase from Dehalococcoides sp. Strain VS and Its Environmental Distribution. Appl. Environ. Microbiol. 70: 4880-4888 [Abstract] [Full Text]  
  • Labrenz, M., Brettar, I., Christen, R., Flavier, S., Botel, J., Hofle, M. G. (2004). Development and Application of a Real-Time PCR Approach for Quantification of Uncultured Bacteria in the Central Baltic Sea. Appl. Environ. Microbiol. 70: 4971-4979 [Abstract] [Full Text]  
  • Ritalahti, K. M., Loffler, F. E. (2004). Populations Implicated in Anaerobic Reductive Dechlorination of 1,2-Dichloropropane in Highly Enriched Bacterial Communities. Appl. Environ. Microbiol. 70: 4088-4095 [Abstract] [Full Text]  
  • Yang, Y., Zeyer, J. (2003). Specific Detection of Dehalococcoides Species by Fluorescence In Situ Hybridization with 16S rRNA-Targeted Oligonucleotide Probes. Appl. Environ. Microbiol. 69: 2879-2883 [Abstract] [Full Text]  
  • Sung, Y., Ritalahti, K. M., Sanford, R. A., Urbance, J. W., Flynn, S. J., Tiedje, J. M., Loffler, F. E. (2003). Characterization of Two Tetrachloroethene-Reducing, Acetate-Oxidizing Anaerobic Bacteria and Their Description as Desulfuromonas michiganensis sp. nov.. Appl. Environ. Microbiol. 69: 2964-2974 [Abstract] [Full Text]  
  • He, J., Ritalahti, K. M., Aiello, M. R., Loffler, F. E. (2003). Complete Detoxification of Vinyl Chloride by an Anaerobic Enrichment Culture and Identification of the Reductively Dechlorinating Population as a Dehalococcoides Species. Appl. Environ. Microbiol. 69: 996-1003 [Abstract] [Full Text]  
  • Rossetti, S., Blackall, L. L., Majone, M., Hugenholtz, P., Plumb, J. J., Tandoi, V. (2003). Kinetic and phylogenetic characterization of an anaerobic dechlorinating microbial community. Microbiology 149: 459-469 [Abstract] [Full Text]  
  • Hendrickson, E. R., Payne, J. A., Young, R. M., Starr, M. G., Perry, M. P., Fahnestock, S., Ellis, D. E., Ebersole, R. C. (2002). Molecular Analysis of Dehalococcoides 16S Ribosomal DNA from Chloroethene-Contaminated Sites throughout North America and Europe. Appl. Environ. Microbiol. 68: 485-495 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Löffler, F. E.
Right arrow Articles by Tiedje, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Löffler, F. E.
Right arrow Articles by Tiedje, J. M.
Agricola
Right arrow Articles by Löffler, F. E.
Right arrow Articles by Tiedje, J. M.