Previous Article | Next Article 
Applied and Environmental Microbiology, April 2000, p. 1423-1428, Vol. 66, No. 4
0099-2240/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Quantification of Clostridium botulinum
Toxin Gene Expression by Competitive Reverse
Transcription-PCR
S.
McGrath,
J. S. G.
Dooley,* and
R. W.
Haylock
School of Applied Biological and Chemical
Science, University of Ulster, Coleraine, Co. Londonderry, Northern
Ireland, BT52 1SA
Received 24 September 1999/Accepted 7 January 2000
 |
ABSTRACT |
Clostridium botulinum produces a characteristic
botulinum neurotoxin which can cause an often fatal neuroparalytic
condition known as botulism. Although food-borne botulism is rare,
critical screening by food companies is necessary to ensure that food
products are safe. At present, the food industry assesses the risks of botulinum neurotoxin production by challenge testing to check any new
food products and to check the efficacy of new storage regimes.
Challenge testing involves artificial introduction of defined strains
of microorganisms into food, and microbial growth and possible toxin
production are then monitored. Botulinum toxin is normally analyzed by
using the mouse bioassay. However, the mouse bioassay is expensive,
slow, and politically sensitive because of animal rights issues. In
this paper we describe adaptation of a new assay, competitive reverse
transcription-PCR (RT-PCR), to monitor botulinum neurotoxin production.
This method accurately measures the level of toxin-encoding mRNA in
C. botulinum cells. Measurement of mRNA should provide a
good indication of gene expression as mRNA is turned over rapidly in
bacterial cells. In addition, the method is rapid, specific, and
sensitive. The competitive RT-PCR method was developed to examine
C. botulinum E VH toxin gene expression and was used to
investigate the level of toxin production by C. botulinum E
VH when the organism was grown in two different types of broth. The
results which we obtained with the competitive RT-PCR method
demonstrated that this method is more rapid and more sensitive than the
mouse bioassay.
 |
INTRODUCTION |
Clostridium botulinum
produces a characteristic botulinum neurotoxin (BoNT) which causes a
neuroparalytic condition known as botulism (9). Botulism has
been classified into the following four categories: food borne, infant,
wound, and unknown (5, 8). The classical food-borne botulism
is primarily due to ingestion of preformed toxin in foods. The ingested
neurotoxin can survive exposure to the gastric juices, enter the blood
stream through the intestine, and cause flaccid muscle paralysis after
it blocks acetylcholine release at neuromuscular junctions (18,
21). The BoNTs are categorized on the basis of their serological
specificities into seven different types (types A through G) and are
some of the most potent toxins known to exist in nature. The lethal
dose for mice is 0.3 ng/kg, while the lethal dose for humans is thought to be 0.2 to 2.0 µg/kg (14). The organism is ubiquitous in
soils and is commonly detected in raw materials used to prepare food products. Nonetheless, outbreaks of food-borne botulism are rare due to
the rigorous application of appropriate processing techniques. Some of
the techniques used (e.g., canning) may result in complete sterilization of the food, while others keep the food under conditions that do not allow toxin production. In addition to monitoring the
efficacy of the procedures used, it is also essential that food
manufacturers verify that production of botulinal toxin in food
products can be prevented from time of production to consumption. At
present, the food industry assesses the risks of BoNT production by
challenge testing and validation. Production of toxin in challenge tests is usually analyzed by the in vivo mouse bioassay, which is the
most widely accepted and sensitive assay for detection of BoNT.
Although this bioassay can be used to distinguish all toxin types, it
has a number of disadvantages. To fully determine the toxin serotype,
neutralization tests with specific antisera must be carried out in
parallel. The mouse test is also slow, expensive, and politically
sensitive because of animal rights issues. BoNT could be detected
better and, consequently, the safety of products could be assessed
better by a rapid, sensitive, and specific in vitro assay. A number of
in vitro assays have been developed; these included enzyme-linked
immunosorbent assays, radioimmunoassays, and PCR probe identification
assays. At this time, none of these is sensitive enough to replace the
mouse bioassay (1, 8, 15, 16, 23, 25).
In this paper we describe adaptation of a new assay, competitive
reverse transcription-PCR (RT/PCR), for monitoring BoNT production as a
function of mRNA levels. Competitive RT-PCR is a quantitative version
of the RT-PCR method in which a known number of copies of an
exogenously synthesized control RNA are introduced together with a test
RNA sample into a reaction mixture. The basis of the competitive RT-PCR
technique is coamplification of a nucleic acid of interest and the
control cDNA. This is possible if the target and control have almost
the same DNA sequence and, in particular, have identical primer binding
sites. Both targets compete for the common primers and reagents in the
same reaction tube. Quantification is then accomplished by comparing
the PCR signal of the specific template with the PCR signals obtained
with known concentrations of the competitor. The amplified control and
the target derived from the cDNA of interest can be distinguished by
size by constructing standards having the same sequence as the specific
target but containing a deletion or an insertion (6, 22).
We describe a competitive RT-PCR method that was designed to quantify
toxin production by C. botulinum E VH dolman when it was
grown in two different types of broth.
 |
MATERIALS AND METHODS |
Bacterial strain and growth conditions.
C. botulinum E
VH dolman was used in this study and was chosen because the toxin gene
has been sequenced (3). This strain was maintained in cooked
meat medium at room temperature. Cultures that were used for RNA
extraction were routinely grown in brain heart infusion (BHI) broth
(Oxoid) and type E broth (40.0 g of NZ Amine [casein enzyme
hydrolysate], 5.0 g of yeast extract, 1.0 g of
L-cysteine-HCl monohydrate, 10.0 g of
D-glucose [anhydrous], 1 liter of distilled water; pH
adjusted to 7.2 with NaOH). Flasks containing 180 ml of broth were each
inoculated with 20 ml of an overnight culture and incubated at 33°C
in an anaerobic workstation (Don Whitley, Shipley, United Kingdom). The
atmosphere inside the cabinet contained nitrogen, carbon dioxide, and
hydrogen (80:10:10). Cultures were monitored by monitoring the
absorbance at 660 nm, by preparing serial dilutions and then
determining viable counts on BHI agar spread plates, and by direct
counting with an improved Neubauer counting chamber.
Extraction of total RNA from C. botulinum E VH.
A modified RNA extraction method in which we used
triisopropylnaphthalene sulfonic acid (sodium salt) (TNS) buffer
(10) was used to extract total RNA from C. botulinum E VH at different stages of growth. The extraction
buffer contained 1% TNS, 6% p-4-aminosalicylic acid
(sodium salt), 200 mM Tris-HCl, 25 mM EDTA, and 250 mM NaCl (pH 7.8).
The cells from a 200-ml culture were harvested by centrifugation (15,000 × g, 10 min, 4°C), resuspended in 1 ml of
TNS buffer, and frozen in liquid nitrogen in 1.5-ml microcentrifuge
tubes. The cells were left to thaw on ice and transferred to centrifuge tubes. Three volumes of TNS buffer was added to each sample, and the
samples were gently mixed. The samples were centrifuged at 7,500 × g for 10 min at 4°C. Each supernatant was collected,
and 1 volume of phenol followed by 0.5 volume of chloroform was added. The samples were gently mixed for 30 s and then centrifuged
(1,400 × g, 15 min, room temperature). The upper
aqueous phase of each sample was removed and placed in a Corex tube,
and the RNA was precipitated with 2 volumes of ice-cold ethanol
overnight at
20°C. The RNA was pelleted by centrifugation
(17,000 × g, 20 min, 4°C), and the remaining alcohol
was allowed to evaporate. The pellet was resuspended in 100 µl of
sterile Milli-Q water. Total RNA concentrations were determined with a
Gene Quant RNA/DNA calculator (Pharmacia). The concentration was
determined by measuring the absorbance at 260 nm and using the
following relationship: 1 optical density unit = 40 mg of RNA
ml
1. Both viable and total cell counts were determined
for each RNA preparation.
Removal of genomic DNA from extracted RNA by using RNase-free
DNase I.
Contaminating DNA was removed from total RNA by using 10 U of RNase-free DNase I (Boehringer Mannheim) in a 10-µl reaction mixture containing approximately 6 µg of total RNA per µl and 6.25 mM MgCl2. The reaction mixture was incubated for 30 min at 37°C, and the DNase I was inactivated by adding 1 µl of 20 mM EDTA
to the mixture and incubating it for 1 min at 37°C and then for 10 min at 65°C.
Developing the construct used to produce control RNA.
The
construct used to produce control DNA was designed to be shorter than
the target RNA by creating a small, 19-bp deletion in a 250-bp PCR
product. The PCR was performed with a 100-µl reaction mixture
containing 20 ng of C. botulinum E VH genomic DNA per µl,
40 pmol of each primer (primer S1 forward
[5'AGCAAATAGAAAATGAAC3'] and primer S1 reverse
[5'GGAATACTATTATTTAGGGTA3']; (Gibco BRL) per µl, each
deoxynucleoside triphosphate (dATP, dGTP, dCTP, and dTTP; Pharmacia) at
a concentration of 0.2 mM, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM
MgCl2, and 2.5 U of Taq DNA polymerase (Gibco
BRL). The PCR mixture was overlaid with 1 drop of mineral oil before
amplification with a Biometra Trio-Thermoblock apparatus. Each PCR
cycle consisted of denaturation for 1 min at 94°C, annealing for
30 s at 40°C, and extension for 30 s at 72°C; 31 such
cycles were followed by a final extension cycle consisting of 72°C
for 10 min. A 600-ng portion of the 250-bp PCR product was digested with restriction enzyme VspI (Gibco BRL) as recommended by
the manufacturer. The restriction digest was incubated overnight at 37°C, and then 0.5 M EDTA was added to a final concentration of 10 mM
to inactivate the restriction enzyme. The restriction digest of the
250-bp PCR product from C. botulinum E VH was analyzed on a
1.5% agarose gel, which produced three fragments (137, 94, and 19 bp).
The two largest fragments were separated from the 19-bp fragment by
cutting them from the gel with a scalpel under short-wavelength UV
light. The DNA was recovered from the agarose gel slice by using
GenElute agarose spin columns (Supelco). The agarose gel slice
containing DNA was placed in a washed GenElute column and centrifuged
(10 min, 12,000 × g). DNA from the 94-bp fragment and
DNA from the 137-bp fragment were collected in a 1.5-ml microcentrifuge
tube. The 94- and 137-bp fragments were ligated to produce a 231-bp
construct in a 10-µl (final volume) reaction mixture containing 1 U
of T4 DNA ligase and 2.5× ligation buffer (Boehringer Mannheim). The
ligation mixture was incubated overnight at 14°C, and then the ligase
was inactivated (65°C, 10 min). The products were washed by passing
the preparation through a Microcon 30 Microconcentrator sterile filter
(Amicon) and using sterile water to remove the buffer. The ligated
products were resuspended in 10 µl of sterile water.
Construction of the control RNA construct with the T7 promoter
for in vitro production of RNA.
A T7 promoter was attached to the
231-bp construct by using a pCR-Script Amp SK(+) cloning kit as
recommended by the manufacturer (Stratagene). The resulting
plasmid-containing colonies were screened by performing a PCR with a T7
primer (5'GTAATACGACTCACTATAGGGC3') and the S1 reverse
primer to determine if the 231-bp fragment was inserted downstream of
the T7 promoter. The PCR conditions and cycles were the same as those
used to amplify the 250-bp PCR product. Agarose gel electrophoresis was
used to screen for the presence of inserts, and successful recombinants
were purified by using large-scale plasmid preparations. Prior to in
vitro transcription, the plasmid template was linearized with a
restriction enzyme that cleaved downstream of the RNA polymerase
promoter and the insert in the multiple cloning site. The plasmid was
cut with 20 U of HaeII (Gibco BRL) as recommended by the
manufacturer. The restriction digest was incubated (3 h, 37°C) and
then inactivated at 65°C for 10 min. Following restriction digestion
of the DNA with HaeII, the DNA was purified by adding 50 µg of proteinase K per µl to the restriction buffer (30 min,
37°C), followed by two phenol-chloroform (1:1, vol/vol) extractions
and ethanol precipitation prior to the transcription reaction. The
digested DNA was resuspended in diethyl pyrocarbonate-treated water
(Sigma) to a final concentration of 1 mg ml
1.
Production of control RNA by using an in vitro transcription
reaction.
A transcription reaction was performed with a 25-µl
reaction mixture containing 1 µg of restricted, proteinase K-treated
DNA template, 40 mM Tris-HCl (pH 8.0), 8 mM MgCl2, 2 mM
spermidine, 50 mM NaCl, each deoxynucleoside triphosphate (ATP, GTP,
CTP, and UTP) at a concentration of 0.4 mM, and 10 U of T7 RNA
polymerase (Stratagene). The reaction mixture was incubated for 30 min
at 37°C. The DNA template was removed after the transcription
reaction by incubating the mixture with 10 U of RNase-free DNase I for 1 h at 37°C. The DNase I was inactivated by adding 1 µl of 20 mM EDTA and incubating the preparation for 1 min at 37°C and then for
10 min at 65°C.
Competitive RT-PCR.
mRNA from C. botulinum E VH
grown to the mid-log phase (3 h) and the early stationary phase (5 h)
in BHI broth and type E broth were quantified by using the competitive
RT-PCR. RT was carried out in a 20-µl reaction mixture containing
approximately 2 µg of target RNA and a known amount of control RNA.
To quantify C. botulinum mRNA, the control RNA was
introduced by using a 1:2 dilution series (4.6 × 10
10 to 9.2 × 10
13 g). Each RT
reaction mixture contained (final concentrations) 50 mM Tris-HCl (pH
8.3), 75 mM KCl, 3 mM MgCl2 (Gibco BRL), a deoxynucleoside
triphosphate mixture (Gibco BRL) containing each deoxynucleoside
triphosphate at a concentration of 1 mM, 100 pmol of S1 reverse primer
per µl, 0.5 U of RNase Out (Gibco BRL), 2 µl target of RNA, 1 µl
of control RNA, and 20 U of Superscript reverse transcriptase (Gibco
BRL). The reaction mixture was incubated at 37°C for 1 h, and
then the reverse transcriptase was inactivated (95°C, 5 min). A
5-µl portion of the resulting cDNA was amplified by PCR by using a
100-µl mixture which contained 100 pmol of S1 forward primer per
µl, 100 pmol of S1 reverse primer per µl, each deoxynucleoside
triphosphate (dATP, dGTP, dCTP, and dTTP; Pharmacia) at a concentration
of 0.2 mM, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM
MgCl2, and 2.5 U of Taq DNA polymerase (Gibco
BRL). Each PCR cycle consisted of denaturation for 1 min at 94°C,
annealing for 30 s at 40°C, and extension for 30 s at
72°C; 31 such cycles were followed by a final extension cycle
consisting of 72°C for 10 min. The competitive products were analyzed
on a 1.5% Metaphore agarose gel (Flowgen). Duplicate samples were
examined, and in the control no reverse transcriptase was added to
ensure that only mRNA, not the genomic DNA, was amplified. The
densities of the competitively amplified 250- and 231-bp bands at each
dilution were measured by using the image analysis software Phoretix 1 D, version 3.0 (Phoretix International Ltd).
Mouse bioassay.
Expression of the C. botulinum E
VH toxin gene was detected by the mouse bioassay in the early
stationary phase when the organism was grown in BHI broth and type E
broth. Extraction and the assay for botulinal toxin were performed as
described by Malizo et al. (13). Cells from 200-ml broth
cultures were concentrated by centrifugation at 7,500 × g for 30 min at 4°C. The supernatant was decanted and
stored at 4°C for further use. The pelleted cells were resuspended in
10 ml of ultrapure water, and lysozyme was added at a concentration of
1 mg ml
1. The cells were incubated on ice for 15 min and
then transferred to 37°C and incubated at this temperature for 15 min. The cell debris was collected by centrifugation at 6,000 × g for 20 min at 4°C, the supernatant containing 10 ml of
cell lysate was decanted into a sterile universal bottle, and the cell
debris was discarded. The 200 ml of cell-free supernatant that was
collected previously was added to the 10 ml of cell lysate to make up
the toxin sample. By using a Sartorious ultrafiltration cell with a
100-kDa cutoff membrane, four 50-ml portions of each sample were
concentrated to a volume of 10 ml. Each 10-ml portion was centrifuged
(1,400 × g) by using an Amicon syringe filter (10-kDa
cutoff), and the preparation was concentrated to a volume of 1 ml. A
portion of each sample was treated with trypsin; 100 µl of extract
was added to 350 µl of trypsin buffer (0.1 M sodium phosphate, pH
6.0), and 25 µl of trypsin (100 mg ml
1) was then added.
The mixture was incubated at 37°C for 30 min, and the reaction was
stopped with 25 µl of soybean trypsin inhibitor (10 mg
ml
1; Sigma). Portions (200 µl) of each extract were
injected intraperitoneally into duplicate mice and the mice were
observed for the onset of classical botulism symptoms, such as
lethargy, collapsed rib cages, and paralysis. Neutralization
experiments were performed to verify that the toxin was neutralized by
its antitoxin (type E antitoxin; reference no. BS0613; Centers for
Disease Control and Prevention).
 |
RESULTS |
Target RNA extraction from C. botulinum E VH.
Isolation of RNA requires an effective means of cell disruption, a
procedure for separating the nucleic acid from the protein, and a
method for purifying the RNA from contaminating genomic DNA. To avoid
degradation or denaturation, the RNA must be protected throughout the
process from liberated nucleases, strong mechanical forces, high
temperatures, and extremes of pH and ionic strength. The RNA extraction
method used here was a modification of the method devised by Parish and
Kirby, and it involved an extraction buffer containing two detergents
(TNS and p-aminosalicylic acid) which effectively extracts
RNA and rapidly inactivates nucleases. The secondary structure of the
RNA was maintained by the relatively high ionic strength of the
extraction buffer and was rendered less liable to degradation by
residual nucleases. Several methods of extracting total RNA from
C. botulinum E VH were tested; these included performing the
TNS extraction procedure at various temperatures (0 to 50°C) and
homogenization with glass beads. The most reproducible results were
obtained when cells were rapidly lysed with TNS buffer at 0°C (data
not shown). The quality of total cellular RNA extracted from BHI
broth-grown cells was monitored by agarose gel electrophoresis (Fig.
1), which resulted in sharp, undegraded
3-kb (23S RNA) and 1.5-kb (16S RNA) bands. Unlike commercial kits, the
extraction system used here could be used to extract RNA from cells in
the stationary phase, and good band formation was observed with
extracts obtained during the stationary phase (12 h of growth).

View larger version (108K):
[in this window]
[in a new window]
|
FIG. 1.
Extraction of total RNA from C. botulinum E
VH at different growth phases in BHI broth. Lane 1, 100-bp molecular
weight marker; lane 2, RNA extracted at the early mid-log phase (3 h);
lane 3, RNA extracted at the mid-log phase (5 h); lane 4, RNA extracted
at the early stationary phase (7 h); lane 5, RNA extracted at the
stationary phase (12 h); lane 6, RNA extracted at the late stationary
phase (24 h).
|
|
Detection of C. botulinum E VH toxin gene expression by
RT-PCR following DNase I treatment.
A total cellular RNA extract
was used in an RT-PCR assay to detect C. botulinum E VH
toxin-specific mRNA (Fig. 2). An analysis of the gel showed that RT-PCR amplified a 250-bp fragment from C. botulinum E VH target mRNA, as expected. The controls on this gel
(Fig. 2, lanes 2, 4, and 5) demonstrated that it was the mRNA, not any
contaminating genomic DNA that was coextracted with the total cellular
RNA, which was amplified. Lane 3 shows that the 250-bp product was
amplified by RT-PCR following treatment with 10 U of DNase I, as the
control system in lane 2 did not give false-positive results;
therefore, the DNase I removed all trace amounts of contaminating DNA.
These results can be compared to the false-positive results shown in
lane 4, in which there was no DNase I treatment and a 250-bp band is
clearly visible.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 2.
Detection of C. botulinum E VH toxin gene
expression by RT-PCR following DNase I treatment. Lane 1, molecular
weight marker (PUC 19 DNA cut with MspI); lane 2, RNA
treated with 10 U of DNase I, followed by PCR; lane 3, RNA treated with
10 U of DNase I, followed by RT-PCR; lane 4, RNA not treated with DNase
I, followed by PCR; lane 5, RNA not treated with DNase I, followed by
RT-PCR.
|
|
Production of a 231-bp fragment from control RNA and confirmation
by RT-PCR.
The in vitro transcription reaction was performed by
using the enzyme T7 polymerase, which is highly specific for the T7
promoter. After in vitro transcription, the remaining DNA template had
to be hydrolyzed with 10 U of DNase I to prevent false-positive
results. The purified copy RNA was amplified by RT-PCR to produce a
231-bp product. The original primer pair that was designed to produce the 231-bp construct was used in this RT-PCR. The results (data not
shown) demonstrated that the copy RNA was amplified to produce a 231-bp
product only when both T7 polymerase and reverse transcriptase were present.
Quantification of C. botulinum E VH toxin gene
expression.
With the competitive RT-PCR method, the control RNA
and target RNA are made so that the primer binding sites are identical and the sequences are almost identical. Consequently, the kinetics of
amplification are likely to be almost indistinguishable as both the
target and the control compete for the primers and reagents in the same
reaction. In the competitive RT-PCR analysis of C. botulinum
E VH, a dilution series of the control RNA was used, and the point at
which the concentrations of the control and target amplicons were equal
was the point at which the initial control and target template
concentrations were equivalent in the reaction mixture. For C. botulinum E VH, the amplified control RNA was 19 bp smaller than
the amplified target RNA; this difference distinguished the two
amplicons in which we were interested.
Type E broth is known to stimulate high-titer toxin production, as
determined by the mouse bioassay. Using this information,
we used the
competitive RT-PCR method to investigate expression
of the
C. botulinum E VH toxin gene when the organism was grown
in type E
broth and BHI broth. In an initial experiment, we found
that at the
stationary phase, the target RNA from a type E broth
culture
corresponded to the control RNA at a dilution of 1:2,500
(Fig.
3). However, the target RNA from a BHI
broth culture corresponded
to the control RNA at a dilution of
1:250,000 (Fig.
4). These
findings show
that there was a 100-fold difference in the amounts
of toxin produced
in the two broth preparations when the competitive
RT-PCR was used. The
competitive RT-PCR results were compared
to the results of the mouse
bioassay used to detect
C. botulinum E VH toxin production
in the two types of broth at the stationary
phase. Using the mouse
bioassay, we found that type E broth-produced
toxin killed the mice
only down to a toxin dilution of 1:100,
while the BHI broth-produced
toxin killed the mice only down to
a toxin dilution of 1:1 (Table
1). The mouse bioassay, therefore,
revealed that there was a 100-fold difference in the amount of
toxin
produced between the two types of broth, which correlated
with the
100-fold difference detected with the competitive RT-PCR
system. Thus,
there was a close correlation between the toxin-specific
mRNA levels
detected by the competitive RT-PCR method and the
actual toxin levels
detected by the mouse bioassay.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 3.
Quantification of C. botulinum E VH toxin
gene expression in type E broth by competitive RT-PCR. Lane 1, 100-bp
molecular weight marker; lane 2, 1:500 dilution of control RNA; lane 3, 1:750 dilution of control RNA; lane 4, 1:1,000 dilution of control RNA;
lane 5, 1:2,500 dilution of control RNA; lane 6, 1:5,000 dilution of
control RNA; lane 7, 1:7,500 dilution of control RNA; lane 8, 1:10,000
dilution of control RNA; lane 9, 1:50,000 dilution of control RNA; lane
10, PCR control containing no DNA.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Quantification of C. botulinum E VH toxin
gene expression in BHI broth by competitive RT-PCR. Lane 1, 100-bp
molecular weight marker; lane 2, 1:10,000 dilution of control RNA; lane
3, 1:25,000 dilution of control RNA; lane 4, 1:50,000 dilution of
control RNA; lane 5, 1:75,000 dilution of control RNA; lane 6, 1:100,000 dilution of control RNA; lane 7, 1:250,000 dilution of
control RNA; lane 8, 1:500,000 dilution of control RNA; lane 9, 1:750,000 dilution of control RNA; lane 10, PCR control containing no
DNA.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Quantification of C. botulinum E VH toxin gene
expression in BHI broth cultures and type E broth cultures, as
determined by the mouse bioassay
|
|
The competitive RT-PCR method was also used to compare toxin gene
expression in mid-log-phase and stationary-phase cultures
grown in both
BHI broth and type E broth. We found that at the
mid-log and stationary
phases, the target RNA from the type E
broth culture corresponded to
the control RNA at dilutions of
1:500,000 and 1:5,000, respectively
(Fig.
5). Thus, there was
100-times more
mRNA present at the stationary phase than at the
mid-log phase.
However, the target RNA from the BHI broth culture
corresponded to the
control RNA at a dilution of 1:100,000 for
both the mid-log and
stationary phases (Fig.
6). Therefore, no
difference in mRNA levels as a function of growth phase was apparent
for this medium.

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 5.
(A) Quantification of C. botulinum E VH toxin
gene expression in type E broth at the mid-log phase by competitive
RT-PCR. Lane 1, 100-bp molecular weight marker; lane 2, 1:1,000
dilution of control RNA; lane 3, 1:5,000 dilution of control RNA; lane
4, 1:10,000 dilution of control RNA; lane 5, 1:50,000 dilution of
control RNA; lane 6, 1:75,000 dilution of control RNA; lane 7, 1:100,000 dilution of control RNA; lane 8, 1:500,000 dilution of
control RNA; lane 9, 1:750,000 dilution of control RNA; lane 10, 1:1,000,000 dilution of control RNA; lane 11, PCR control containing no
DNA. (B) Quantification of C. botulinum E VH toxin gene
expression in type E broth at the stationary phase by competitive
RT-PCR. Lane 1, 100-bp molecular weight marker; lane 2, 1:250 dilution
of control RNA; lane 3, 1:500 dilution of control RNA; lane 4, 1:2,500
dilution of control RNA; lane 5, 1:5,000 dilution of control RNA; lane
6, 1:7,500 dilution of control RNA; lane 7, 1:10,000 dilution of
control RNA.
|
|

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 6.
Quantification of C. botulinum E VH toxin
gene expression in BHI broth at the mid-log phase (A) and stationary
phase (B) by competitive RT-PCR. Lane 1, 100-bp molecular weight
marker; lane 2, 1:50,000 dilution of control RNA; lane 3, 1:75,000
dilution of control RNA; lane 4, 1:100,000 dilution of control RNA;
lane 5, 1:250,000 dilution of control RNA; lane 6, 1:500,000 dilution
of control RNA; lane 7, 1:750,000 dilution of control RNA; lane 8, 1:1,000,000 dilution of control RNA; lane 9, PCR control containing no
DNA.
|
|
 |
DISCUSSION |
Isolating high-quality RNA is one of the most challenging tasks in
modern microbiology. In this paper we describe a modified Parish-Kirby
method for extracting intact total RNA from C. botulinum by
using a TNS extraction buffer. This powerful detergent-based buffer
allows a wide range of growth conditions to be investigated compared to
kits that are restricted to mid-log-phase cells. In only a few reports
have workers described recovery of mRNA from microbial cells in a form
that can be used for molecular analyses, such as cDNA synthesis and
RT-PCR analyses (2, 11, 12, 17, 19, 20). The main problem
with quantification of bacterial RNA by competitive RT-PCR is the
presence of contaminating genomic DNA which is coextracted with the
RNA. In eukaryotic systems, RT-PCR primers spanning one or more introns
can be designed to prevent amplification of DNA in the time allowed for
primer extension. Bacterial systems rely on the use of DNase I
treatment for removing contaminating DNA and avoiding false-positive
results. The complete removal of contaminating genomic DNA from
C. botulinum E VH described here was shown to require 10 U
of DNase I, an amount which is three times less than the amount used in
previous prokaryotic studies that used 30 U of DNase I to remove DNA
(17, 20). Furthermore, heat inactivation of 10 U of DNase I
in the presence of EDTA was found to be more reliable than using
traditional phenol-chloroform extraction procedures, which were found
to reduce the RNA yield by up to 60%.
The development of a competitive RT-PCR technique depends on efficient
methods for generating control RNA in vitro. The internal control used
in this project was less difficult to produce than the internal
controls used in some eukaryotic competitive RT-PCR systems (7,
24). Production of the control RNA involved deleting 19 bp from
the sequence of interest before insertion into the vector. Removal of
the 19-bp fragment was facilitated by excising the two larger
restriction digest fragments from the gel, collecting the DNA from the
gel slices with spin columns, and religating, which resulted in a
construct that was 19 bp smaller than the target. This technique has
been used successfully with Salmonella typhimurium in our
labs. In this technique it is also important to note the end point for
determining the point at which the amount of amplified target mRNA
matches the amount of the diluted control RNA. Observation by eye can
be subjective; therefore, the end points were all determined by using
densitometry and the image analysis software Phoretix 1 D, version 3.0.
C. botulinum E VH target RNA was successfully quantified by
using the competitive RT-PCR technique described here. This assay has
proven to be more sensitive and more rapid than the mouse bioassay.
When the competitive RT-PCR method was compared with the mouse
bioassay, both assays revealed that at the stationary phase, C. botulinum E VH grown in type E broth produced 100 times more BoNT
than C. botulinum E VH grown in BHI broth produced. This
good correlation indicates that the competitive RT-PCR technique could
be used as a more efficient method for detecting C. botulinum toxin gene expression than the mouse bioassay.
When the different growth stages were examined, the competitive RT-PCR
assay showed that at the stationary-phase the type E broth culture
produced 100 times more BoNT mRNA than the mid-log-phase type E broth
culture produced. In the BHI broth culture, there was no difference in
toxin gene expression between the two different growth stages. These
results showed that a type E broth culture produces higher mRNA levels
at the stationary phase than a BHI broth culture produces, indicating
that the culture medium affects toxin production. Our results also
showed that we could use competitive RT-PCR to focus on the effects of
different growth phases in order to investigate what signals might
affect toxin production. To date, there is limited data available
concerning the kinetics of growth and production of botulinum toxin
when factors such as temperature and storage are considered
(4). Such factors and conditions need to be fully
investigated and examined to ensure that new and existing food products
are safe.
The purpose of this project was to develop a competitive RT-PCR method
for detection of toxigenic C. botulinum. To do this, the
procedure was carried out under optimal conditions for isolating RNA
from the bacteria. This method could be used to detect C. botulinum in food samples after the minimum sensitivity is
determined. Initial testing of food samples should involve extraction
of RNA from homogenized foods that have been spiked with dilutions of C. botulinum cultures. Aranda et al. (1) have
shown that PCR can be used to detect C. botulinum types A,
B, E, and F in foods, and based on their results obtained with PCR, it
is probable that competitive RT-PCR could be used as a sensitive and
rapid technique for routine analysis of C. botulinum toxin
gene expression.
In conclusion, the competitive RT-PCR method could be a significant
development for quantification of C. botulinum toxin gene expression, especially in the food industry, and could help determine the factors that influence botulinum toxin production in foods. The
good correlation between the results of the two methods compared in
this study illustrates the effectiveness of competitive RT-PCR for
investigating C. botulinum toxin gene expression and
suggests that this method could be used to investigate prokaryotic gene expression and transcriptional control in general. Little is known about the effects of certain factors at the transcriptional level in
bacteria, and it is possible that competitive RT-PCR could be used to
provide data concerning what may switch on and off the transcription mechanism.
 |
ACKNOWLEDGMENTS |
This work was supported by grants from the Department of
Education for Northern Ireland and Campden and Chorleywood Food
Research Association.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: School of
Applied Biological and Chemical Science, University of Ulster, Cromore
Road, Coleraine, Co. Londonderry, Northern Ireland. Phone: 01265 324427. Fax: 01265 324906. E-mail:
jsg.dooley{at}ulst.ac.uk.
 |
REFERENCES |
| 1.
|
Aranada, E.,
M. M. Rodriguez, and J. J. Cordoba.
1997.
Detection of Clostridium botulinum types A, B, E and F in foods by PCR and DNA probe.
Lett. Appl. Microbiol.
25:186-190[CrossRef][Medline].
|
| 2.
|
Bej, A. K.,
N. We-yao,
S. Morgan,
D. D. Jones, and M. H. Mahbubani.
1996.
Detection of viable Vibrio cholerae by reverse transcriptase polymerase chain reaction.
Mol. Biotechnol.
5:1-10[Medline].
|
| 3.
|
Campbell, K. D.,
M. D. Collins, and A. K. East.
1993.
Gene probes for identification of the botulinal neurotoxin gene and specific identification of neurotoxin types B, E, and F.
J. Clin. Microbiol.
31:2255-2262[Abstract/Free Full Text].
|
| 4.
|
Carlin, F., and M. W. Peck.
1996.
Growth of and toxin production by nonproteolytic Clostridium botulinum in cooked pureed vegetables at refrigeration temperatures.
Appl. Environ. Microbiol.
62:3069-3072[Abstract].
|
| 5.
|
Collins, M. D., and A. K. East.
1998.
Phylogeny and taxonomy of the food-borne pathogen Clostridium botulinum and its neurotoxins.
J. Appl. Microbiol.
84:5-17[CrossRef][Medline].
|
| 6.
|
Foley, K. P.,
M. W. Leonard, and J. D. Engel.
1993.
Quantitation of RNA using the polymerase chain reaction.
Trends Genet.
9:380-384[CrossRef][Medline].
|
| 7.
|
Gebhardt, A.,
A. Peters,
D. Gerding, and A. Niendorf.
1994.
Rapid quantitation of RNA species in ethidium-bromide stained gels of competitive reverse transcription-polymerase chain reaction products.
J. Lipid Res.
35:976-981[Abstract].
|
| 8.
|
Harris, L., and M. W. Griffiths.
1992.
The detection of food-borne pathogens by the polymerase chain reaction.
Food Res. Int.
25:457-469[CrossRef].
|
| 9.
|
Hatheway, C. L.
1992.
Clostridium botulinum and other clostridia that produce botulinum toxin, p. 3-20.
In
A. H. W. Hauschild, and K. L. Dodds (ed.), Clostridium botulinum: ecology and control in foods. Marcel Dekker, Inc., New York, N.Y.
|
| 10.
|
Haylock, R., and P. Broda.
1988.
Preparation and characterization of mRNA from ligninolytic fungi.
Methods Enzymol.
161:221-227.
|
| 11.
|
Jou, N. T.,
R. B. Yoshimori,
G. R. Mason,
J. S. Louie, and M. R. Liebling.
1997.
Single-tube, nested, reverse transcriptase-polymerase chain reaction for detection of viable Mycobacterium tuberculosis.
J. Clin. Microbiol.
35:1161-1165[Abstract].
|
| 12.
|
Klein, P. G., and V. K. Juneja.
1997.
Sensitive detection of viable Listeria monocytogenes by reverse transcription-polymerase chain reaction.
Appl. Environ. Microbiol.
63:4441-4448[Abstract].
|
| 13.
|
Malizo, C.,
J. Harrod,
K. M. Kaufman, and E. A. Johnson.
1993.
Arginine promotes toxin formation in cheddar cheese by Clostridium botulinum.
J. Food Prot.
56:769-772.
|
| 14.
|
Middlebrook, J. L.
1989.
Cell surface receptors for protein toxins, p. 95-119.
In
L. L. Simpson (ed.), Botulinum neurotoxin and tetanus toxin. Academic Press, San Diego, Calif.
|
| 15.
|
Notermans, S.,
A. M. Hagenaars, and S. Kozaki.
1982.
The enzyme linked immunosorbent assay (ELISA) for the detection and determination of Clostridium botulinum toxins A, B and E.
Methods Enzymol.
84:223-238[Medline].
|
| 16.
|
Potter, M. D.,
J. Meng, and P. Kimsey.
1993.
An ELISA for detection of botulinal toxin types A, B and E in inoculated food samples.
J. Food Prot.
56:856-861.
|
| 17.
|
Sails, A. D.,
F. J. Bolton,
A. J. Fox,
D. R. A. Wareing, and D. L. A. Greenway.
1998.
A reverse transcriptase polymerase chain reaction assay for the detection of thermophilic Campylobacter spp.
Mol. Cell. Probes
12:1-6[CrossRef][Medline].
|
| 18.
|
Sakaguchi, G.
1983.
Clostridium botulinum toxins.
Pharmacol. Ther.
19:165-194.
|
| 19.
|
Selvaratnan, S.,
B. A. Schoedel,
B. L. McFarland, and C. F. Kulpa.
1995.
Application of reverse transcription-polymerase chain reaction for monitoring expression of catabolic dMPN gene in a phenol-degrading sequence batch reactor.
Appl. Environ. Microbiol.
61:3981-3985[Abstract].
|
| 20.
|
Sheridan, G. E. C.,
C. I. Masters,
J. A. Shallcross, and B. M. Mackey.
1998.
Detection of mRNA by reverse transcription-polymerase chain reaction as an indicator of viability in Escherichia coli cells.
Appl. Environ. Microbiol.
64:1313-1318[Abstract/Free Full Text].
|
| 21.
|
Simpson, L. L.
1980.
Kinetic studies on the interaction between botulinum toxin type A and the cholinergic neuromuscular junction.
J. Pharmacol. Exp. Ther.
212:16-21[Abstract/Free Full Text].
|
| 22.
|
Souaze, F.,
A. Ntodou-Thome,
C. Y. Tran,
W. Rostene, and P. Forgez.
1996.
Quantitative RT-PCR: limits and accuracy.
BioTechniques
21:280-285[Medline].
|
| 23.
|
Szabo, E. A.,
J. M. Pemberton,
A. M. Gibson,
M. J. Eyles, and P. M. Desmarchelier.
1994.
PCR for detection of Clostridium botulinum types A, B and E in food, soil and infant faeces.
J. Appl. Bacteriol.
76:539-545[Medline].
|
| 24.
|
Tsai, S., and M. C. Wiltbank.
1996.
Quantification of mRNA using competitive RT-PCR with standard curve methodology.
BioTechniques
21:862-866[Medline].
|
| 25.
|
Wictome, M., and C. C. Shone.
1998.
Botulinum neurotoxins, mode of action and detection.
J. Appl. Microbiol. Symp. Suppl.
84:875-975.
|
| 26.
|
Willems, A.,
A. K. East,
P. A. Lawson, and M. D. Collins.
1993.
Sequence of the gene coding for the neurotoxin of Clostridium botulinum type A associated with infant botulism: comparison with other clostridial neurotoxins.
Res. Microbiol.
144:547-556[Medline].
|
Applied and Environmental Microbiology, April 2000, p. 1423-1428, Vol. 66, No. 4
0099-2240/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chen, Y., Korkeala, H., Linden, J., Lindstrom, M.
(2008). Quantitative Real-Time Reverse Transcription-PCR Analysis Reveals Stable and Prolonged Neurotoxin Cluster Gene Activity in a Clostridium botulinum Type E Strain at Refrigeration Temperature. Appl. Environ. Microbiol.
74: 6132-6137
[Abstract]
[Full Text]
-
Artin, I., Carter, A. T., Holst, E., Lovenklev, M., Mason, D. R., Peck, M. W., Radstrom, P.
(2008). Effects of Carbon Dioxide on Neurotoxin Gene Expression in Nonproteolytic Clostridium botulinum Type E. Appl. Environ. Microbiol.
74: 2391-2397
[Abstract]
[Full Text]
-
Lindstrom, M., Korkeala, H.
(2006). Laboratory Diagnostics of Botulism. Clin. Microbiol. Rev.
19: 298-314
[Abstract]
[Full Text]
-
Couesnon, A., Raffestin, S., Popoff, M. R.
(2006). Expression of botulinum neurotoxins A and E, and associated non-toxin genes, during the transition phase and stability at high temperature: analysis by quantitative reverse transcription-PCR.. Microbiology
152: 759-770
[Abstract]
[Full Text]
-
Sharma, S. K., Eblen, B. S., Bull, R. L., Burr, D. H., Whiting, R. C.
(2005). Evaluation of Lateral-Flow Clostridium botulinum Neurotoxin Detection Kits for Food Analysis. Appl. Environ. Microbiol.
71: 3935-3941
[Abstract]
[Full Text]
-
Sharkey, F. H., Banat, I. M., Marchant, R.
(2004). Detection and Quantification of Gene Expression in Environmental Bacteriology. Appl. Environ. Microbiol.
70: 3795-3806
[Full Text]
-
Lovenklev, M., Holst, E., Borch, E., Radstrom, P.
(2004). Relative Neurotoxin Gene Expression in Clostridium botulinum Type B, Determined Using Quantitative Reverse Transcription-PCR. Appl. Environ. Microbiol.
70: 2919-2927
[Abstract]
[Full Text]
-
Kimura, B., Kawasaki, S., Nakano, H., Fujii, T.
(2001). Rapid, Quantitative PCR Monitoring of Growth of Clostridium botulinum Type E in Modified-Atmosphere-Packaged Fish. Appl. Environ. Microbiol.
67: 206-216
[Abstract]
[Full Text]