Previous Article | Next Article ![]()
Applied and Environmental Microbiology, April 2000, p. 1680-1684, Vol. 66, No. 4
Virginia Tech Center for Genomics (VIGEN),
Fralin Biotechnology Center, Virginia Polytechnic Institute and State
University, Blacksburg, Virginia 24061,1 and
Department of Molecular and Cell Biology, University of
California-Davis, Davis, California 956162
Received 12 October 1999/Accepted 16 January 2000
Recombinant sucrose-6-phosphate synthase (SpsA) was synthesized in
Escherichia coli BL21DE3 by using the spsA gene
of the cyanobacterium Synechocystis sp. strain PCC 6803. Transformants exhibited a 10,000-fold increase in survival compared to
wild-type cells following either freeze-drying, air drying, or
desiccation over phosphorus pentoxide. The phase transition
temperatures and vibration frequencies (P==O stretch) in phospholipids
suggested that sucrose maintained membrane fluidity during cell dehydration.
Loss of even a small fraction of
intracellular water is lethal for most cells. Nevertheless, some cells,
including many microbial pathogens of humans, survive extreme
desiccation, often for protracted periods (1, 22). The
maximal longevity of microorganisms in a metabolically inactive,
desiccated state is unknown (16, 22, 25), but there have
been controversial (10, 21, 24) reports of ancient, yet
viable bacteria in 25 million- to 40-million-year-old Dominican amber
(2, 17).
Understanding the mechanisms that some organisms use to withstand the
removal of virtually all of their water is an important problem in cell
biology. The nonreducing disaccharides sucrose and trehalose protect
membranes and proteins in vitro from dehydration damage, as described
by the "water replacement hypothesis" (3). Survival of
dehydration damage in a variety of organisms is correlated with
intracellular accumulation of one of these disaccharides, and even the
addition of exogenous trehalose or sucrose to cells that are sensitive
to drying can increase survival (18, 22).
It has been proposed that the ability to survive desiccation may be
conferred by transfection of desiccation-sensitive cells with genes
which permit synthesis of trehalose or sucrose (4). This
seems eminently practical since synthesis of either disaccharide requires only two steps, involves only two gene products, a synthase (reaction 1) and a phosphatase (reaction 2), and requires substrates found in all cells:
0099-2240/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Engineering Desiccation Tolerance in
Escherichia coli
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
(1)
An attempt to develop this approach in plants (13) was
challenged because in this system survival of dehydration is not easily
estimated and direct effects of a disaccharide on physical properties
of dry tissue cannot be detected readily (9). In addition,
trehalases are widespread in plants, which complicates the issue
further (20). In the present study we used
desiccation-sensitive Escherichia coli as a model to address
these problems.
(2)
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Bacterial strains, plasmids, and media.
E. coli
BL21DE3 (Invitrogen, Carlsbad, Calif.) has a chromosomal copy of the T7
RNA polymerase gene under control of the
isopropyl-
-D-thiogalactopyranoside (IPTG)-inducible
lacUV5 promoter. Derivative strain BL21DE3(pT7-7) contains
expression vector pT7-7, which has a T7 promoter that permits
high-level gene expression after induction with IPTG. Strain
BL21DE3(pSpsA) contains the sucrose-6-phosphate synthase (spsA) gene from the cyanobacterium Synechocystis
sp. strain PCC 6803 cloned in pT7-7.
Cloning of spsA. The following two primers were used to amplify spsA from genomic DNA of Synechocystis sp. strain PCC 6803 (7, 15): 5' AGAGCGCATATGAGCTATTCATCAAAATACA 3' (the translation start codon is in boldface type) and 5' GAGACGGTCGACTTAAACGGGGTCTAACAACTCA 3' (the translation stop codon is in boldface type). These primers had 5'-terminal NdeI and SalI sites, respectively, which aided subcloning in pT7-7. Assays were performed in 50-µl mixtures containing pH 9.0 buffer (Promega, Madison, Wis.), 12.5 nmol of each deoxynucleoside triphosphate (final concentration of each deoxynucleoside triphosphate, 250 µM), 1 mM Mg2+, and 2.5 U of Taq DNA polymerase (Promega). The annealing temperature used for the first cycle (60 s) was 72°C, and the annealing temperature was then decreased 0.8C° per cycle for the next nine cycles (to 65°C) and was kept constant at 65°C for the remaining 30 cycles. Each cycle included denaturation at 95°C for 1 min and elongation at 72°C for 90 s. The assay began with denaturation at 95°C for 2 min and ended with elongation for 10 min at 72°C. A 2,184-bp DNA amplification product was purified, ligated to pCRR2.1-TOP (Invitrogen) to obtain pDWSPS1, and subcloned in E. coli TOP10. A DNA sequence analysis was performed to confirm the identity of spsA (data not shown). pDWSPS1 was digested with NdeI and SalI to remove the spsA fragment, which was then cloned in pT7-7 (which had been digested previously with NdeI and SalI) to obtain pSpsA.
Growth of strains and expression of spsA.
Strain
BL21DE3 was grown in Luria-Bertani (LB) medium, while strains
BL21DE3(pT7-7) and BL21DE3(pSpsA) were grown in LB medium containing ampicillin (final concentration, 100 µg
ml
1). For each experiment single colonies of the
different strains were grown in 3 ml of LB medium or LB medium
containing 100 µg of ampicillin per ml for 3 h at 37°C. The
3-ml cultures were used to inoculate 50-ml portions of fresh medium
(with 100 µg of ampicillin per ml), and after 2 h the optical
density at 600 nm (OD600) of each cell suspension was
adjusted to 0.08 with LB medium. Cells were harvested by low-speed
centrifugation, resuspended to a final concentration of about
107 cells ml
1 in 100 ml of M9 medium (with
ampicillin), and, after 0.1 mM (final concentration) IPTG was added,
incubated for an additional 3 h. The relationships between
OD600 and cell densities of the strains used in this study
were determined empirically by performing multiple trials in which we
counted colonies after cultures were serially diluted. The cell density
of BL21DE3(pSpsA) used for calculations in the series of experiments
described here was 5 × 107 cells ml
1.
M9 medium contained (per liter) 6 g of
Na2HPO4, 3 g of
KH2PO4, 0.5 g of NaCl, and 1 g of
NH4Cl as the basal salts. The basal medium was autoclaved
and the pH was adjusted to 7.4, after which 2 ml of MgSO4
(1 M stock solution), 0.1 ml of CaCl2 (1 M stock solution),
and 10 ml of glucose (20% [wt/vol], filter sterilized) were added.
In replicate experiments glucose was omitted from M9 medium.
Cell extracts.
To detect sucrose 6-phosphate (sucrose-6-P),
cell extracts were prepared by the method of Germer et al.
(11). Cell pellets obtained from 200-ml cultures of strains
BL21DE3(pSpsA) and BL21DE3(pT7-7) after induction in M9 medium (see
above) were freeze-dried (5 µm of Hg,
75°C) by using a Labconco
model 8 system, resuspended in 800 µl of ice-cold 15 mM
trichloroacetic acid (TCA), and incubated on ice for 20 min. After
centrifugation at 10,000 × g for 5 min, the total
(350-µl) supernatant fraction was recovered for analysis (note that
the dried cells imbibed water during rehydration). Cell pellets
obtained from 500-ml cultures of BL21DE3(pSpsA) and BL21DE3(pT7-7)
induced in M9 medium without glucose were resuspended in 800 µl of
ice-cold 15 mM TCA as described above, and after centrifugation the
total (250-µl) supernatant fraction was recovered.
Identification of sucrose-6-P in BL21DE3(pSpsA). The presence of sucrose-6-P in cell extracts was first evaluated by thin-layer chromatography (TLC). Two-microliter aliquots of cell extracts from 200-ml cultures of BL21DE3(pSpsA) and BL21DE3(pT7-7) induced in M9 medium and 20-µl aliquots of cell extracts from 500-ml cultures of the same strains induced in M9 medium without glucose were separated on silica gel plates (type G/UV; Whatman International Ltd., Maidstone, Kent, England). The solvent system used was acetonitrile-water-ethyl acetate-isopropyl alcohol-acetic acid (85:20:30:30:10, vol/vol/vol/vol/vol). The sugars were visualized by dipping the plates in a naphthoresorcinol-ethanol-sulfuric acid solution (200 mg of naphthoresorcinol, 100 ml of 95% [vol/vol] ethanol, 4 ml of concentrated sulfuric acid) for a few seconds and drying the plates with gentle heating. Solutions of sucrose and sucrose 6-P (3 mM each) were used as standards. After drying, the TLC plates were scanned with the digital television camera of a model 4000 AlphaInnotech ChemiImager low-light imaging system operated with AlphaEase 3.3 software, a Dell Pentium computer, and an Optiquest color monitor. Spot densities were then determined for samples of interest with automatic background correction.
To confirm the identity of sucrose-6-P in recombinant E. coli, 100-µl aliquots of cell extracts (see above) prepared from BL21DE3(pSPsA) and BL21DE3(pT7-7) cells were incubated with 4 U of calf intestinal alkaline phosphatase (CIP) (Sigma Chemical Co., St. Louis, Mo.) in 50 mM Tris-HCl (pH 9.0)-1 mM MgCl2-0.1 mM ZnCl2 at 37°C overnight.Enzyme assay for sucrose and sucrose-6-P. The amounts of sucrose and sucrose-6-P in induced BL21DE3(pSPsA) were determined by a discontinuous spectrophotometric assay based on coupling invertase-catalyzed sucrose hydrolysis with oxidation of the liberated fructose catalyzed by fructose dehydrogenase. The reaction generated reducing equivalents that were transferred to a tetrazolium salt with a concomitant increase in the absorbance at 570 nm (12). After CIP treatment of the BL21DE3(pSPsA) and BL21DE3(pT7-7) cell extracts, 20-µl aliquots were incubated with 100 µl of test reagent and 100 µl of blank reagent prepared as previously described (12). Solutions containing 0.5, 5, and 25 mM sucrose were used as standards. Samples were incubated at 37°C, and absorbance at 570 mn was monitored every 15 min over a 30-min incubation period; after this the volumes of the samples were adjusted to 1 ml.
Subjecting cells to water stress.
After induction in M9
medium or M9 medium without glucose (see above), cell suspensions were
subjected to acute water stress by using three techniques. For
freeze-drying, 100-µl samples were frozen in liquid nitrogen and
dried with a freeze-drier (5 µm of Hg,
75°C) for 24 h. For
air drying, 100-µl samples were dried under sterile air at room
temperature at a water activity (aw) of 0.25 (
200 MPa)
for 72 h. For chemical desiccation, 10-µl samples were
equilibrated under matric conditions (22, 23) in a nitrogen atmosphere over phosphorus pentoxide (aw, 0) for 72 h.
Replicates were dried in the light and in the dark.
Immobilization and storage of clones.
Cultures of
BL21DE3(pT7-7) and BL21DE3(pSpsA) were grown to an OD600 of
0.155 and diluted 1:1.5 with LB medium, and cells were harvested from
3-ml aliquots. Cell pellets were resuspended in M9 medium containing
ampicillin (100 µg ml
1) and were induced with 0.1 mM
IPTG for 4 h at 37°C. Uncharged microporous Nylon66 membranes
(pore size, 1.5 µm) with a surface coating consisting of 50% amino
groups and 50% carboxyl groups on a polyester support (Boehringer
GmbH, Mannheim, Germany) were used for immobilization studies. The
membranes either were used directly or were first wetted with a
filter-sterilized 100 mM trehalose solution and blotted to dampness
between sterile filter paper. Aliquots (2 µl) of cell suspensions
were spotted onto the membranes in replicate, dried overnight at room
temperature in the dark under a stream of sterile air, and then stored
frozen in the dark at
20°C. After 72 h the desiccated cells
were rehydrated by placing the membranes on fresh LB agar plates
containing ampicillin (100 µg ml
1) and then incubating
the plates at 37°C overnight in the light.
Determination of phase transitions.
Phase transitions were
measured by Fourier transform infrared (FTIR) spectroscopy as described
previously (5, 8). This method directly monitors changes in
the frequency of CH2 bands, which correspond to the
conformation of the acyl chains of membrane lipids. Spectra were
obtained by using a Perkin-Elmer model 2000 optical bench, a
microcomputer, and Perkin-Elmer Spectrum 2000 software. Data processing
consisted of baseline flattening of the 3,000- to
2,800-cm
1 region by using three fixed points for each
spectrum and normalization of absorbance by using the abex routine in
the Spectrum software. The temperature was controlled with a Peltier
device and was monitored with a fine thermocouple on the FTIR
spectroscope window, as described previously (5, 8).
| |
RESULTS |
|---|
|
|
|---|
Expression of spsA in E. coli. A prominent, approximately 75-kDa polypeptide was present in total-protein extracts obtained from BL21DE3(pSpsA) induced with 0.1 mM IPTG for 3 h. The polypeptide was synthesized in BL21DE3(pSpsA) after induction in either M9 medium or M9 medium without glucose. The 75-kDa peptide was not detected in BL21DE3(pT7-7) following induction under the same conditions, nor was it detected in extracts of BL21DE3(pSpsA) obtained prior to induction (data not shown). The sucrose phosphate synthase of Synechocystis sp. strain PCC6803 has a 750-amino-acid sequence (15).
Synthesis of sucrose.
The sucrose-6-P standard produced a
characteristic comet-shaped band at and above the origin on TLC plates
(Fig. 1, lanes H and I). Cell extracts of
BL21DE3(pSpsA) induced for SpsA synthesis produced a band like the
sucrose-6-P standard band on TLC plates (Fig. 1, lanes B and E).
Resolution of cell extracts obtained from induced BL21DE3(pSpsA)
resulted in a faint spot (Fig. 1, lane B, arrow) with an
Rf value (0.64) identical to that of the sucrose
standard (Fig. 1, lane I). When the same extracts were treated with CIP
prior to TLC, the intensity of the spot increased significantly
concomitant with disappearance of sucrose-6-P (Fig. 1, lane G). The
spot was not produced when we used extracts obtained from
BL21DE3(pSpsA) that was induced in the absence of glucose but contained
sucrose-6-P (Fig. 1, lane E), and it was not produced when the
BL21DE3(pT7-7) extracts were used. When BL21DE3(pSpsA) was induced in
the absence of glucose, it was necessary to increase the concentration
of cell extract loaded onto TLC plates 30-fold in order to detect
sucrose-6-P (Fig. 1, lane E). Sucrose-6-P was not detected in cell
extracts obtained from BL21DE3(pT7-7) induced in the presence or
absence of glucose (Fig. 1, lanes A and D). One transformant, which was
constructed by using independent PCR amplification of spsA,
was not able to synthesize sucrose-6-P (Fig. 1, lane C) and did not
survive desiccation or freeze-drying (see below).
|
1).
Because 350 µl of cell extract was obtained from each 200-ml culture
(1010 cells) of BL21DE3(pSpsA) (see above), the sucrose
content was therefore approximately 1.4 × 108 sucrose
molecules per cell. This value included sucrose molecules which were
derived from sucrose-6-P after CIP treatment prior to the assay (see
above). From scanning and direct quantification of standards and
samples on TLC plates before and after CIP treatment (e.g., a
comparison of the sucrose bands in Fig. 1, lanes B and G), the ratio of
sucrose to sucrose-6-P in cell extracts was calculated to be
approximately 1:3.3, which was equivalent to 2.3 × 107 and 7.7 × 107 molecules of sucrose
and sucrose-6-P, respectively, per cell.
Survival of E. coli during water stress.
The
ability of bacteria to survive freeze-drying or desiccation is enhanced
at high cell densities and in stationary-phase cells (1,
22). Therefore, to study the specific contribution of
spsA to desiccation tolerance, cell densities were kept low (107 cells ml
1; OD600, 0.08) and
only cells in the exponential phase of growth were used in the
experiments described below.
1 of
the original 107 cells ml
1), while the level
of survival of BL21DE3(pT7-7) was 104-fold lower (0.0003%;
approximately 30 viable cells ml
1 of the original
107 cells ml
1). After desiccation and 3 days
of storage in air in the light, the survival values for BL21DE3(pSpsA)
and BL21DE3(pT7-7) were 0.001 and 0.0001%, respectively. Survival of
BL21DE3(pSpsA) increased 103-fold (to 1%) if desiccated
cells were stored in the dark prior to rehydration. Survival of
BL21DE3(pSpsA) was enhanced further when desiccated cells were stored
over phosphorus pentoxide (aw, 0) for 3 days prior to
rehydration. In this case the survival values for cells stored in the
light and in the dark were 1.2 and 2.3%, respectively. These values
were 104-fold higher than the values obtained with
BL21DE3(pT7-7). The presence of glucose during induction of
spsA did not influence the results of these experiments. In
preliminary trials light and dark did not have significant effects on
survivability following freeze-drying (data not shown); only the
responses of cells to freeze-drying in the light were investigated
subsequently and are reported below.
|
Mechanism of enhanced desiccation tolerance.
Fully hydrated
wild-type BL21DE3 cells had a characteristic melting curve (melting
temperature [Tm], 6°C) (Fig.
3a). The P==O stretch in the
phospholipids of these hydrated cells was centered at about 1,230 cm
1 (data not shown). As expected, there was a marked
increase in the Tm of BL21DE3(pT7-7) cells when
they were freeze-dried (Tm, 35°C) (Fig. 3a),
and consistent with these data, there was a P==O stretch at about
1,250 cm
1 (removal of the water around the P==O groups
increased the frequency of vibration since P was no longer H bonded to
water). The phosphate frequency was depressed in phospholipids dried
with trehalose or sucrose due to hydrogen bonding between the
OH
groups of the sugar and the phosphate of the phospholipid
(26). Because of the presence of sucrose phosphate in
BL21DE3(pSpsA), it was not possible to assign the phosphate stretch
unambiguously to the membrane phospholipids. Thus, we cannot be sure
that sucrose phosphate interacted directly with the polar head group.
However, freeze-dried cells of BL21DE3(pSpsA) exhibited clear, but
complex, depression of Tm
(Tm, 15°C) (Fig. 3a). This depression depended
on the thermal history of the cells (Fig. 3b). When desiccated
BL21DE3(pSpsA) cells were first heated, they had a high
Tm, 45°C. However, after chain melting, when
the sample was cooled rapidly (50°C min
1) to 0°C and
then immediately reheated, a complex transition with three components
was observed at a significantly lower temperature. When the same sample
was then chilled to
10°C and kept at this temperature for 45 min
before analysis, the low-temperature transition began to revert to the
high-temperature transition (Fig. 3b). The low-temperature transition
was not identified after cells were stored at
20°C overnight, and
the original high-temperature curve was restored (data not shown). The
single melting curve for freeze-dried BL21DE3(T7-7) had a high
Tm (35°C) that was not affected by the thermal
history of the cells, including repeated melting of the same sample
(Fig. 3c).
|
Storage of recombinant clones.
Strain BL21DE3(pT7-7) did not
survive immobilization on nylon membranes (with or without trehalose),
storage at
20°C for 72 h, and rehydration at 37°C (Fig. 4a
and b). Few colonies of strain
BL21DE3(pSpsA) survived the same treatment on untreated membranes (Fig.
4c), while full recovery occurred on membranes that had been pretreated
with 100 mM trehalose (Fig. 4d).
|
| |
DISCUSSION |
|---|
|
|
|---|
Desiccation and freeze-drying are severe stresses; they affect gene expression and gene regulation markedly, and multiple targets are damaged (1, 22). Different factors influence inactivation of dried cells; these factors include the growth phase, the cell concentration, the drying method, and the storage conditions (19). Also, the rates of survival for recombinant strains of E. coli following desiccation are lower than the rates of survival for their untransformed counterparts (14). Our goal was to synthesize sucrose in desiccation-sensitive cells in order to test the water replacement hypothesis. We demonstrated that in vivo sucrose synthesis had a marked protective effect in E. coli that is sensitive to drying in air. Furthermore, we did this under conditions under which any inherent capacity of the cells to offer some resistance to drying was minimized.
Sucrose and trehalose protect membranes by depressing the Tm of the phase transition when water is removed from the phospholipid bilayer and thus maintain the dry membranes in a physical state similar to that of fully hydrated membranes (3). Our FTIR data indicate that the sucrose synthesized in BL21DE3(pSpsA) protects membrane phospholipids. However, the heterogeneity of the melting curve suggests that sucrose may not be present in sufficient amounts to fully depress the Tm of all of the phospholipid (which is consistent with sucrose concentration data).
In experiments in which extracellular trehalose was used to protect E. coli from the effects of freeze-drying, Israeli et al. calculated that theoretically 5.6 × 107 molecules of trehalose per cell were needed to fully saturate the interphospholipid spaces in the outer membrane (14). This value is very similar to the value calculated in this study for the intracellular content of sucrose (2.3 × 107 molecules of sucrose per cell). However, it should be emphasized that trehalose is generally more effective than sucrose in protecting membranes from desiccation and freeze-drying (1, 18, 22).
The sucrose present in BL21DE3(pSpsA) may be in contact with only one face of the bilayer (depression of the Tm of the inner monolayer could conceivably affect the outer monolayer). An increase in the P==O stretch value similar to that observed in BL21DE3(pT7-7) was observed for dried BL21DE3(pSpsA). After heating, however, the P==O stretch value was depressed and was similar to the value obtained for hydrated BL21DE3 (data not shown). We concluded that when the phospholipid in BL21DE3(pSpsA) is stored at temperatures below the Tm, sucrose is forced out of the bilayer, an effect similar to the effect observed previously with phospholipid vesicles (6). When the chains are melted, however, the sucrose again has access to the headgroup and forms H bonds with P==O groups, and the P==O stretch value is close to the P==O stretch value for hydrated cells. The fact that the P==O stretch value for dried BL21DE3(pSpsA) was not lower than the value obtained with hydrated BL21DE3 is consistent with the proposed heterogeneous (nonsaturating) distribution of sucrose.
In general, the effects of desiccation are more pronounced in cells
stored in the light than in cells stored in the dark because of
photooxidative reactions catalyzed by residual water (1, 22). The damage occurs at the level of enzyme activity (e.g., nitrogenase), in proteins (e.g., phycobiliproteins), or in DNA (22). When cells of BL21DE3(pSpsA) were dried at
200 MPa,
the residual water, even though the water content was low, may have competed with sucrose for sites in the phospholipid membrane and may
have contributed to the light sensitivity of the cells (Fig. 2, data
set 2). In contrast, storage over phosphorus pentoxide resulted in
complete desiccation of the membranes, which enhanced the protective
effect of sucrose (Fig. 2, data sets 4 and 5). Complete desiccation
also alleviated the differential sensitivity due to light (Fig. 2, data
sets 4 and 5).
The presence of nonreducing sugars in vivo and in vitro (i.e., overexpression of spsA) and addition of 100 mM trehalose resulted in full recovery of cells following desiccation, freezing, and rehydration (Fig. 4d). Immobilization of cells in this way can be used for construction and storage of high-density clones, such as the clones in gene libraries. In vivo synthesis of sucrose may also be useful for stabilization of other cell lines, including eukaryote cell lines.
| |
ACKNOWLEDGMENTS |
|---|
This study was supported by grant N00173-98-1-G005-LOG from the
Defense Advanced Research Programs Agency
Naval Research Laboratories and by grant IBN 9513157 from the National Science Foundation.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: VIGEN, Department of Biochemistry, 205 Engel Hall, W. Campus Drive, Virginia Tech, Blacksburg, VA 24061. Phone: (540) 231-5745. Fax: (540) 231-9070. E-mail: geordie{at}vt.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Billi, D., and M. Potts. Desiccation. In K. B. Storey and J. M. Storey (ed.), Cell and molecular responses to stress, in press. Elsevier Science, Amsterdam, The Netherlands. |
| 2. |
Cano, R., and M. K. Borucki.
1995.
Revival and identification of bacterial spores in 25-million-year-old to 40-million-year-old Dominican amber.
Science
268:1060-1064 |
| 3. |
Crowe, J. H.,
L. M. Crowe, and D. Chapman.
1984.
Preservation of membranes in anhydrobiotic organisms: the role of trehalose.
Science
223:701-703 |
| 4. | Crowe, J. H., and L. M. Crowe. 1992. Membrane integrity in anhydrobiotic organisms: toward a mechanism for stabilizing dry cells, p. 87-103. In G. N. Somero, C. B. Osmond, and C. L. Bolis (ed.), Water in life: comparative analysis of water relationships at the organismic, cellular, and molecular level. Springer-Verlag, Berlin, Germany. |
| 5. | Crowe, J. H., F. A. Hoekstra, L. M. Crowe, T. J. Anchordoguy, and E. Drobnis. 1989. Lipid phase transitions measured in intact-cells with fourier-transform infrared spectroscopy. Cryobiology 26:76-78[CrossRef][Medline]. |
| 6. | Crowe, J. H., F. A. Hoekstra, K. H. N. Nguyen, and L. M. Crowe. 1996. Is vitrification involved in depression of the phase transition temperature in dry phospholipids? Biochim. Biophys. Acta 1280:187-196[Medline]. |
| 7. |
Curatti, L.,
E. Folco,
P. Desplats,
G. Abratti,
V. Limones,
L. Herrera-Estrella, and G. Salerno.
1998.
Sucrose-phosphate synthase from Synechocystis sp. strain PCC 6803: identification of the spsA gene and characterization of the enzyme expressed in Escherichia coli.
J. Bacteriol.
180:6776-6779 |
| 8. |
Drobnis, E. Z.,
L. M. Crowe,
T. Berger,
T. J. Anchordoguy,
J. W. Overstreet, and J. H. Crowe.
1993.
Cold shock damage is due to lipid phase-transitions in cell-membranes a demonstration using sperm as a model.
Exp. Zool.
265:432-437.
|
| 9. | Gaff, D. 1996. Tobacco-plant desiccation tolerance. Nature 382:502. |
| 10. | Gerhardt, P. 1998. Survival of ancient bacteria desiccated within amber: believe it or not? ASM News 64:68-69. |
| 11. |
Germer, J.,
A. Muffler, and R. Hengge-Aronis.
1998.
Trehalose is not relevant for in vivo activity of -containing RNA polymerase in Escherichia coli.
J. Bacteriol.
180:1603-1606 |
| 12. | Holmes, E. W. 1997. Coupled enzymatic assay for the determination of sucrose. Anal. Biochem. 244:103-109[CrossRef][Medline]. |
| 13. | Holmström, K.-O., E. Mäntylä, B. Welin, A. Mandal, E. T. Palva, O. E. Tunnela, and J. Londesborough. 1996. Drought tolerance in tobacco. Nature 379:683-684[CrossRef]. |
| 14. | Israeli, E., B. T. Shaffer, and B. Lighthart. 1993. Protection of freeze-dried Escherichia coli by trehalose upon exposure to environmental conditions. Cryobiology 30:519-523[CrossRef][Medline]. |
| 15. | Kaneko, T., S. Sato, H. Kotani, A. Tanaka, E. Asamizu, Y. Nakamura, N. Miyajima, M. Hiroswa, M. Sugiura, S. Sasamoto, T. Kimura, T. Hosouchi, A. Matsuno, A. Muraki, N. Nakazaki, K. Naruo, S. Osumura, S. Shimpo, C. Takeuchi, T. Wada, A. Watanabe, M. Yamada, M. Yasuda, and S. Tabata. 1996. Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC 6803. I. Sequence features in the 1 Mb region from map positions 64% to 92% of the genome. DNA Res. 3:109-136[Abstract]. |
| 16. |
Kennedy, M. J.,
S. L. Reader, and L. M. Swierczynski.
1994.
Preservation records of micro-organisms: evidence of the tenacity of life.
Microbiology
140:2513-2529 |
| 17. |
Lambert, L. H.,
T. Cox,
K. Mitchell,
R. A. Rossello-Mora,
C. Del Cueto,
D. E. Dodge,
P. Orkand, and R. J. Cano.
1998.
Staphylococcus succinus sp. nov., isolated from Dominican amber.
Int. J. Syst. Bacteriol.
48:511-518 |
| 18. | Leslie, S. B., E. Israeli, B. Lighthart, J. H. Crowe, and L. M. Crowe. 1995. Trehalose and sucrose protect both membranes and proteins in intact bacteria during drying. Appl. Environ. Microbiol. 61:3592-3597[Abstract]. |
| 19. | Lievense, L. C., and K. van't Riet. 1993. Convective drying of bacteria. II. Factors influencing survival. Adv. Biochem. Eng. 50:71-89. |
| 20. | Müller, J., T. Boller, and A. Wiemken. 1995. Trehalose and trehalase in plants: recent developments. Plant Sci. 112:1-9. |
| 21. |
Postgate, J., and F. G. Priest.
1995.
Putative oligocene spores.
Microbiology
141:2763-2764 |
| 22. |
Potts, M.
1994.
Desiccation tolerance of prokaryotes.
Microbiol. Rev.
58:755-805 |
| 23. |
Potts, M.,
M. A. Bowman, and N. S. Morrison.
1984.
Control of matric water potential ( m) in immobilized cultures of cyanobacteria.
FEMS Microbiol. Lett.
24:193-196.
|
| 24. | Priest, F. G. 1995. Age of bacteria from amber. Science 270:2015[Abstract]. |
| 25. | Sneath, P. H. A. 1962. Longevity of microorganisms. Nature 4842:643-646. |
| 26. | Tsvetkova, N. M., B. L. Phillips, L. M. Crowe, J. H. Crowe, and S. H. Risbud. 1998. Effect of sugars on headgroup mobility in freeze dried dipalmitoylphosphatidylcholine bilayers: solid state 31P NMR and FTIR studies. Biophys. J. 75:2947-2955[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»