Previous Article | Next Article ![]()
Applied and Environmental Microbiology, April 2000, p. 1759-1763, Vol. 66, No. 4
Department of Veterinary PathoBiology,
University of Minnesota, St. Paul, Minnesota
551081; Department of Microbiology and
Immunology, University of South Alabama, Mobile, Alabama
366882; and Department of Laboratory
Medicine and Pathology, University of Minnesota, Minneapolis, Minnesota
554553
Received 15 June 1999/Accepted 3 January 2000
Very little is known about the contribution of surface appendages
of Salmonella enterica serovar Enteritidis to pathogenesis in chickens. This study was designed to clarify the role of SEF14, SEF17, and SEF21 fimbriae in serovar Enteritidis pathogenesis. Stable,
single, defined sefA (SEF14), agfA (SEF17), and
fimA (SEF21) insertionally inactivated fimbrial gene
mutants of serovar Enteritidis were constructed. All mutant strains
invaded Caco-2 and HT-29 enterocytes at levels similar to that of the
wild type. Both mutant and wild-type strains were ingested equally well
by chicken macrophage cell lines HD11 and MQ-NCSU. There were no
significant differences in the abilities of these strains to colonize
chicken ceca. The SEF14 Salmonellosis is the third most
commonly reported infectious disease in the United States. Since the
middle 1980s, most human cases reported to the National
Salmonella Surveillance System administered by the Centers
for Disease Control and Prevention have been attributed to
Salmonella enterica serovar Enteritidis. More than 80% of
food-borne serovar Enteritidis outbreaks reported since 1985 are
associated with the consumption of raw or undercooked eggs
(16).
Salmonella species enter the host by invading the
gastrointestinal mucosa, a step essential for pathogenesis
(13). Fimbriae have been shown to be involved in
colonization and in adherence to specific host target tissues in the
early stages of infection (5, 14, 15). Studies involving
fimbriae have drawn considerable interest because fimbriae can serve as
potential immunogens against many pathogenic bacteria that colonize
epithelial surfaces (3-5, 20). Currently, we are exploring
the use of fimbrial antigens as vaccine candidates. However, the role
of fimbriae in pathogenesis of serovar Enteritidis is poorly
understood. More knowledge is necessary to clarify the role of serovar
Enteritidis fimbriae in vaccines designed to reduce the colonization
and prevalence of this bacterium in poultry.
Serovar Enteritidis produces at least five distinct fimbriae, namely
SEF14 and SEF17 (type 1 fimbriae) and SEF21, LPF, and PEF
(28). Of all serovar Enteritidis fimbriae, SEF14 has been studied the most. SEF14 has been shown to contribute to serovar Enteritidis adherence to mouse epithelial cells, and passive
administration of SEF14 antibodies is protective in mice
(26). However, in vitro and in vivo studies using isogenic
mutants of serovar Enteritidis have demonstrated no role for SEF14 in
pathogenesis (25, 28). Information regarding the role of
SEF17 and SEF21 fimbriae in serovar Enteritidis pathogenesis is
lacking. Because the factors which influence fimbrial phase variation
in vivo and which influence variability in the fimbriation of cells
carrying an intact fimbrial operon are not known, it is difficult to
evaluate the role of fimbriae in pathogenesis. Therefore, a genetic
approach was used in this study to investigate the role of the three
known serovar Enteritidis fimbrial operons, sefA
(7), agfA (10), and fimA (22), which encode SEF14, SEF17, and SEF21 fimbriae,
respectively. The ability of these sefA, agfA,
and fimA mutant strains to mediate colonization and invasion
was assessed in vitro and in a chicken model.
Bacterial strains, plasmids, and growth conditions.
Serovar
Enteritidis phage type 4 strain was originally isolated from the liver
of a laying chicken (18). A spontaneous
nalidixic-acid-resistant (Nalr) mutant was obtained by
plating on a nalidixic-acid-containing Luria-Bertani (LB) agar plate
and was used as the recipient strain for conjugation. Escherichia
coli S17-1/ Statistical analyses.
Statistical analyses were performed by
using StatView 4.5 (Abacus Concepts, Berkeley, Calif.). Bacterial
numbers were converted to log10 prior to statistical
analyses, and differences were analyzed by a one-way analysis of
variance followed by Fisher's test for significant difference.
Fractional data were analyzed by a chi-square test with continuity correction.
Preparation of gene knockout constructs.
Internal fragments
(lacking sequences on 5' and 3' ends) of the sefA,
agfA, and fimA genes were amplified from the
serovar Enteritidis genomic DNA by PCR by using the following primers: for sefA, forward, 5'
GGGCTCGAGCTTGCTTAAATTGCATGTGGC and reverse, 5' GGGCTCGAGGG TTGTGACAGGGACATTTAGC; for
agfA, forward, 5' GGCTCGAGATCGTAGTT TCTGGCAGTGC and reverse, 5'
GGGCTCGAGCCTGACGCACCATTACGC; and for fimA,
forward, 5' GGGCTCGAGGTCTGATGTTTGCTGGC and
reverse, 5' GGGCTCGAGATTAGCCTGGCCTGGCG. Additional bases were added to the 5' end of each primer to
confer a recognition sequence for XhoI (underlined above).
The amplification conditions were 94°C for 1.5 min, 56°C for 1 min,
and 72°C for 2 min, for 30 cycles. PCR products were purified from
1% agarose gel and cloned into pGEM-T vector. Sequences of the inserts
were confirmed by automated DNA sequencing. Finally, internal sequences of sefA, agfA, and fimA were subcloned
into XhoI-digested pKNOCK-Km suicide vector, thus
creating pKNOCK-Km/ Construction of fimbrial gene knockouts.
SEF14
0099-2240/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Pathogenic Role of SEF14, SEF17, and SEF21 Fimbriae
in Salmonella enterica Serovar Enteritidis Infection
of Chickens

![]()
ABSTRACT
Top
Abstract
Text
References
strain was isolated in lower
numbers from the livers of infected chickens and was cleared from the
spleens faster than other strains. No significant differences in fecal
shedding of these strains were observed.
![]()
TEXT
Top
Abstract
Text
References
pir was used as the donor strain.
Inactivation of fimbrial genes was carried out by using suicide plasmid
vector PKNOCK-Km (2). pGEM-T plasmid vector (Promega,
Madison, Wis.) was used for cloning PCR fragments. Bacterial strains
were grown either in LB broth, colonization factor antigen (CFA) broth
(9), or T medium (8).
sefA,
pKNOCK-Km/
agfA, and
pKNOCK-Km/
fimA, respectively. Resulting
plasmids were electroporated into E. coli
S17-1/
pir donor cells. Electroporation was performed in a
Gene Pulser apparatus according to the manufacturer's instructions (Bio-Rad Laboratories, Richmond, Calif.). Recombinant clones were selected based on restriction enzyme analysis of the plasmid DNA extracted from kanamycin-resistant (Kmr) colonies.
,
SEF17
, and SEF21
strains of serovar
Enteritidis were constructed by inactivation of the respective genes
through homologous exchange of DNA material between the wild-type
fimbrial genes and 5', 3'-truncated fimbrial genes on pKNOCK. Suicide
vector constructs pKNOCK-Km/
sefA,
pKNOCK-Km/
agfA, and pKNOCK-Km/
fimA were
mobilized from donor E. coli S17-1/
pir into
spontaneous Nalr serovar Enteritidis by conjugation as
described (1). The Kmr and Nalr
bacterial colonies were selected and analyzed by PCR, nucleotide sequence analysis, and Western blotting. For each conjugation experiment, at least 20 exconjugants were tested for the presence of
autonomously replicating pKNOCK plasmid. All exconjugants tested had
integrated the plasmid DNA into their genome (results not shown). For
PCR, regions of chromosomal DNA flanking the insertion site were
amplified by using two pairs of primers for each exconjugant tested.
One primer in each pair was specific to the chromosomal DNA flanking
the insertion site (5' or 3' sequences of the fimbrial gene absent in
the pKNOCK construct) and another was specific to the Kmr
gene (forward, 5' TTGGGTGGAGAGGCTATTCG and reverse, 5'
CACCATGATATTCGGCAAGC). The chromosomal-DNA-specific primer
sequences were as follows: for sefA, forward, 5'
ATGCGTAAATCAGCAT CTGCA and reverse, 5' TTAGTTTTGATA CTGCTGAACGTAG; for agfA, forward, 5'
ATGAAACTCCTAAAAGTGGCAGC and reverse, 5' AGCGCAGACGCTAAA
TTAATACTG; and for fimA, forward, 5'
ATGAAACATAAATTAATGACCTCTAC and reverse, 5'
TTATTCGTATTTCATGATAAAGGTGG. PCR amplification was performed as
described above, except that annealing was performed at 57°C for 1 min. PCR products were purified from a 1% agarose gel with identity
confirmed by nucleotide sequence analysis. More than 90% of the clones
tested from each conjugation had integrated the plasmid DNA site
specifically into their genome. To further support the PCR results, the
PCR products of two exconjugants from each conjugation reaction were
sequenced by automated sequencing, and the identities of products were
confirmed. However, when the same sets of primers were used, no DNA
amplification was observed with the wild-type counterpart. No evidence
for the presence of an unaltered sefA, agfA, or
fimA allele in SEF14
, SEF17
, and
SEF21
strains was observed, and PCR with
wild-type-gene-specific primers failed to amplify specific DNA
fragments from these strains.
, SEF17
, or
SEF21
strains, respectively; however, all three antigens
were detected in extracts of the wild-type serovar Enteritidis (Fig.
1).

View larger version (72K):
[in a new window]
FIG. 1.
Western immunoblot analysis of serovar Enteritidis
wild-type and mutant strains. (A) Sodium dodecyl sulfate-polyacrylamide
gel electrophoresis (SDS-PAGE) sample buffer-glycine extracts of
serovar Enteritidis wild-type and SEF14
strains. Lanes 1 and 2, serovar Enteritidis SEF14
; lanes 3 to 5, wild-type
serovar Enteritidis; lane 6, rSEF14 control. (B) SDS-PAGE sample
buffer-glycine insoluble formic acid treated extract of serovar
Enteritidis wild-type and SEF17
strains. Lanes 1 and 2, wild-type serovar Enteritidis; lanes 3 and 4, SEF17
serovar Enteritidis. (C) SDS-PAGE sample buffer-glycine extracts of
serovar Enteritidis wild-type and SEF21
strains. Lanes 1 and 2, SEF21
serovar Enteritidis; lanes 3 to 5, serovar
Enteritidis; lane 6, rSEF21 control. rSEF14 and rSEF21 are expressed as
fusion proteins.
Invasion of HT-29 and Caco-2 enterocytes.
The abilities of
wild-type serovar Enteritidis and fimbrial mutants to invade HT-29 and
Caco-2 enterocytes were compared. Individual bacterial strains were
grown in static CFA or T medium for 48 to 72 h (9, 22)
at 37°C, were washed, and were diluted to the appropriate
concentration in tissue culture medium. Bacterial concentrations were
determined by densitometry and were confirmed by serial dilution
followed by viable plate counts on MacConkey agar. One milliliter of
bacterial suspension containing either 106 or
107 viable bacteria was added to each tissue culture well
(15-mm-diameter, 24-well microtiter plates; Nunc) containing
approximately 106 enterocytes, and invasion assays were
performed as previously described (31). Each bacterial
strain was tested in at least three separate assays, each assay
representing the average of triplicate tissue culture wells. The lower
limit of assay detection was 50 bacteria; for statistical analysis,
values below this limit were assigned a value equal to the lower limit
of assay detection. Figure 2 shows the
number of viable Salmonella cells internalized by HT-29 and
Caco-2 enterocytes. In general, serovar Enteritidis strains were more
invasive in Caco-2 cells than in HT-29 cells. The mutant strains were
internalized by Caco-2 and HT-29 enterocytes as efficiently as the
wild-type serovar Enteritidis. Quantitative recovery of viable
intracellular bacteria was reproducible, as indicated by small standard
error bars (Fig. 2). Previous studies involving SEF14 and epithelial
cell monolayers have produced variable results. SEF14 fimbriae have
been shown to contribute to serovar Enteritidis adherence to mouse
epithelial cells (25, 26) but not to adherence and invasion
of human HEp-2, INT-407, Caco-2, and HeLa cells (12, 25,
28), although a SEF14
mutant derived from avirulent
serovar Enteritidis invaded HeLa cells more poorly than the wild type
(25). Because HeLa cells are of cervical epithelial origin,
they may have unique receptors for SEF14 compared to receptors on
enterocytes. It has been suggested that SEF17 and SEF21 fimbriae of
serovar Enteritidis bind basement membrane proteins (9, 21)
and may thus provide a mechanism for intestinal colonization. Recent
studies have shown that serovar Enteritidis cells lacking either SEF17
or SEF21 are less invasive in INT-407 (12). However, data
from our study suggest that neither SEF14, SEF17, nor SEF21 augmented
serovar Enteritidis internalization by enterocytes. It is possible that
cell types used in our study may not express the appropriate receptor
for fimbrial attachment or that bacteria might utilize multiple
adhesins to attach. It has recently been shown that multiple fimbrial
adhesins are required for full virulence of Salmonella
enterica serovar Typhimurium in mice (29).
|
Ingestion by chicken macrophage cell lines. Macrophage cell lines HD-11 and MQ-NCSU (6, 27) were cultivated at 41°C in 5% CO2 in either RPMI medium supplemented with 5% fetal bovine serum (HD-11) or Liebovitz-McCoy medium supplemented with 10% fetal bovine serum (MQ-NCSU). Macrophage cell suspension (107 cells/ml) was prepared in a mixture of 1% gelatin in Hank's balanced salt solution, and viability was determined by trypan blue exclusion. Wild-type serovar Enteritidis and mutant strains were cultivated in CFA broth for 24 h at 37°C with gentle shaking, were washed, and were resuspended in phosphate-buffered saline to a concentration of 108 CFU/ml. Bacterial opsonization was carried out by mixing equal volumes of bacteria with 20% (vol/vol) normal chicken serum for 15 min at 37°C with shaking. Bacteria were then centrifuged at 6,000 × g for 15 min and were resuspended to the original concentration in 1% gelatin in Hank's balanced salt solution. Ingestion of the preopsonized bacteria was measured as described (30) with modifications. Five hundred microliters of bacteria was added to 500 µl of the macrophage cell suspension, and the mixture was incubated with shaking for 45 min to compare the efficacy of bacterial ingestion of each strain. The number of bacteria in the supernatant after ingestion was verified to be at least 1 log10 fewer than the number of internalized bacteria. Each bacterial strain was tested in at least three separate assays, each assay representing the average of triplicate samples. No significant differences in the numbers of internalized bacteria were noted with both macrophage cell lines (values ranging from 6.3 to 6.8 log10 CFU/5 × 106 NCSU cells or 6.0 to 6.4 log10 CFU/5 × 106 HD-11 cells for mutant strains and 6.3 log10 CFU/5 × 106 NCSU cells or 6.0 log10 CFU/5 × 106 HD-11 cells for the wild type). Total bacterial numbers before and after phagocytosis were similar, indicating that the bacteria did not multiply during phagocytosis. Type 1 fimbriae of serovar Typhimurium have been shown to mediate attachment, internalization, and intracellular survival in murine and porcine phagocytes (17, 23). However, in the present study, wild-type serovar Enteritidis and serovar Enteritidis lacking SEF21, SEF14, or SEF17 were internalized equally well by chicken macrophages. Thorns et al. (28) have also reported that serovar Enteritidis lacking SEF14 is internalized and persists in murine peritoneal macrophages similar to the wild-type strain.
Invasion, persistence, and excretion of serovar Enteritidis fimbrial mutants in SPF chickens. Groups of 25 5-day-old, specific-pathogen-free chickens (SPAFAS Inc., Roanoke, Ill.) were orally inoculated with a pure culture of approximately 107 wild-type serovar Enteritidis cells or fimbrial mutant suspended in 1 ml of phosphate-buffered saline. At 1, 3, 7, 14, and 21 days postinoculation (p.i.), five chickens from each group were killed, and the liver, spleen, and cecum were aseptically excised. The number of viable bacteria per gram of tissue was determined as previously described (11). The lower limit of assay detection was 12 bacteria or 1.09 log10 cells per g of tissue. For statistical analysis, values below this limit were assigned a value equal to the lower limit of assay detection. Fecal excretion of Salmonella cells was monitored by culturing cloacal swabs. Stability of the mutants following reisolation from chickens was determined by plating onto LB agar with and without antibiotics and by PCR on genomic DNA from five individual colonies from each plate.
In general, no differences were observed among the serovar Enteritidis strains in their ability to colonize chicken ceca, to invade liver and spleen (Fig. 3), and to be shed in feces (data not shown). The only significant finding was that in birds inoculated with SEF14
serovar Enteritidis, fewer
Salmonella cells were isolated from the liver at all time
points compared to the other treatment groups, and this number was
significantly reduced at day 7 p.i. (Fig. 3A). Birds inoculated
with SEF17
serovar Enteritidis also had a low number of
Salmonella cells in the liver at day 7 p.i. compared to
birds inoculated with SEF21
bacteria or the wild type. In
addition, in birds inoculated with SEF14
serovar
Enteritidis, no Salmonella cells were recovered from the
spleen at day 21 p.i. Although there was no difference in colonization of chicken ceca by the SEF14
strain compared
to other strains, the lower numbers of SEF14
bacteria
recovered from livers and spleens of infected chickens suggested that
SEF14 might contribute to the persistence of serovar Enteritidis in
extraintestinal tissues. Although it was also possible that these
differences were due to an indirect effect of sefA gene
disruption, clarification of this mechanism was beyond the scope of
this study. The SEF14
, SEF17
, and
SEF21
mutants were stable even after reisolation from
chickens.
|
| |
ACKNOWLEDGMENTS |
|---|
This work was supported in part by Minnesota Agricultural Experiment Station grant AES6325 and by Public Health Service grant AI23484 from the National Institutes of Health.
We thank W. W. Kay, University of Victoria, British Columbia, Canada, for providing anti-SEF14, anti-SEF17, and anti-SEF21 antibodies and J. M. Sharma, University of Minnesota, St. Paul, for providing macrophage cell lines.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Veterinary PathoBiology, 1971 Commonwealth Ave., University of Minnesota, St. Paul, MN 55108. Phone: (612) 625-9704. Fax: (612) 625-5203. E-mail: nagar001{at}maroon.tc.umn.edu.
Present address: Department of Microbiology and Immunology, Emory
University, Atlanta, GA 30322.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Alexeyev, M. F., and I. N. Shokolenko. 1995. Mini-Tn10 transposon derivatives for insertion mutagenesis and gene delivery in the chromosome of Gram-negative bacteria. Gene 160:59-62[CrossRef][Medline]. |
| 2. | Alexeyev, M. F. 1999. The pKNOCK series of broad-host-range mobilizable suicide vectors for gene knockout and targeted DNA insertion into the chromosome of Gram's negative bacteria. BioTechniques 26:824-828[Medline]. |
| 3. | Baumler, A. J., R. M. Tsolis, F. A. Bowe, J. G. Kusters, S. Hoffmann, and F. Heffron. 1996. The pef fimbrial operon of Salmonella typhimurium mediates adhesion to murine small intestine and is necessary for fluid accumulation in the infant mouse. Infect. Immun. 64:61-68[Abstract]. |
| 4. | Baumler, A. J., R. M. Tsolis, and F. Heffron. 1996. Contribution of fimbrial operons to attachments to and invasion of epithelial cell lines by Salmonella typhimurium. Infect. Immun. 64:1862-1865[Abstract]. |
| 5. |
Baumler, A. J.,
R. M. Tsolis, and F. Heffron.
1996.
The lpf fimbrial operon mediates adhesion of Salmonella typhimurium to murine Peyer's patches.
Proc. Natl. Acad. Sci. USA
93:279-283 |
| 6. | Beug, H., A. von Kirchback, G. Doderlein, J. F. Conscience, and T. Graf. 1979. Chicken hematopoietic cells transformed by seven strains of defective avian leukemia viruses display three distinct phenotypes of differentiation. Cell 18:375-382[CrossRef][Medline]. |
| 7. |
Clouthier, S. C.,
K. H. Muller,
J. L. Doran,
S. K. Collinson, and W. W. Kay.
1993.
Characterization of three fimbrial genes of sefABC, of Salmonella enteritidis.
J. Bacteriol.
175:2523-2533 |
| 8. |
Collinson, S. K.,
L. Emody,
K. H. Muler,
T. J. Trust, and W. W. Kay.
1991.
Purification and characterization of thin, aggregative fimbriae from Salmonella enteritidis.
J. Bacteriol.
173:4773-4781 |
| 9. |
Collinson, S. K.,
P. C. Doig,
J. L. Doran,
S. Clouthier,
T. J. Trust, and W. W. Kay.
1993.
Thin aggregative fimbriae mediate binding of Salmonella enteritidis to fibronectin.
J. Bacteriol.
175:12-18 |
| 10. |
Collinson, S. K.,
S. C. Clouthier,
J. L. Doran,
P. A. Banser, and W. W. Kay.
1996.
Salmonella enteritidis agfBAC operon encoding thin, aggregative fimbriae.
J. Bacteriol.
178:662-667 |
| 11. |
Cooper, G. L.,
R. A. J. Nicholas,
G. A. Cullen, and C. E. Hormaeche.
1990.
Vaccination of chickens with a Salmonella enteritidis aroA live oral Salmonella vaccine.
Microb. Pathog.
9:255-265[CrossRef][Medline].
|
| 12. |
Dibb-Fuller, M.,
E. Allen-Vercoe,
C. J. Thorns, and M. J. Woodward.
1999.
Fimbriae- and flagella-mediated association with and invasion of cultured epithelial cells by Salmonella enteritidis.
Microbiology (New York)
145:1023-1031 |
| 13. | Finlay, B. B., and S. Falkow. 1997. Common themes in microbial pathogenicity. Microbiol. Rev. 61:136-169[Abstract]. |
| 14. |
Hohmann, A. W.,
G. Schmidt, and D. Rowley.
1978.
Intestinal colonization and virulence of Salmonella in mice.
Infect. Immun.
22:763-770 |
| 15. |
Jones, G. W., and L. A. Richardson.
1981.
The attachment to and invasion of HeLa cells by Salmonella typhimurium: the contribution of mannose-sensitive and mannose-resistant hemagglutinating activities.
J. Gen. Microbiol.
127:361-370 |
| 16. | Jordan Lin, C. T., R. A. Morales, and K. Ralston. 1997. Raw and undercooked eggs: a danger of salmonellosis. Food Rev. 20:27-32. |
| 17. |
Keith, B. R.,
S. L. Harris,
P. R. Walker, and P. E. Orndorff.
1990.
Effect of type 1 piliation on in vitro killing of Escherichia coli by mouse peritoneal macrophages.
Infect. Immun.
58:3448-3454 |
| 18. | Kinde, H., D. H. Read, A. Ardans, H. Little, D. Keri, R. Gireesh, and K. V. Nagaraja. 1996. Sewage effluent: source of Salmonella enteritidis phage type 4 infection and disease in a commercial chicken layer flock in Southern California. Avian Dis. 40:672-676[CrossRef][Medline]. |
| 19. | Koneman, E. W., S. D. Allen, W. M. Janda, P. C. Schreckenberger, and W. C. Winn. 1997. Color atlas and textbook of diagnostic microbiology, 5th ed. Lippincott, Philadelphia, Pa. |
| 20. | Krogfelt, K. A. 1991. Bacterial adhesion: genetics, biogenesis and role in pathogenesis of fimbrial adhesion of E. coli. Rev. Infect. Dis. 13:721-735[Medline]. |
| 21. | Kukkonen, M., T. Raunio, R. Virkola, K. Lahteenmaki, P. H. Makela, P. Klemm, S. Clegg, and T. K. Korhonen. 1993. Basement membrane carbohydrate as a target for bacterial adhesion: binding of type 1 fimbriae of Salmonella enterica and Escherichia coli to laminin. Mol. Microbiol. 7:229-237[CrossRef][Medline]. |
| 22. |
Muller, K. H.,
S. K. Collinson,
T. J. Trust, and W. W. Kay.
1991.
Type 1 fimbriae of Salmonella enteritidis.
J. Bacteriol.
173:4765-4772 |
| 23. |
Ngeleka, M.,
B. Marineau-Doize, and J. M. Fairbrother.
1994.
Septicemia-inducing Escherichia coli O115:K'V165'F1651 resists killing by porcine polymorphonuclear leukocytes in vitro: role of F1651 fimbriae and K'V165' O-antigen capsule.
Infect. Immun.
62:398-404 |
| 24. |
Ogunniyi, A. D.,
P. A. Manning, and I. Kotlarski.
1994.
A Salmonella enteritidis 11RX pilin induces strong T-lymphocyte responses.
Infect. Immun.
62:5376-5383 |
| 25. | Ogunniyi, A. D., I. Kotlarski, R. Morona, and P. A. Manning. 1997. Role of SefA subunit protein of SEF14 fimbriae in the pathogenesis of Salmonella enterica serovar enteritidis. Infect. Immun. 65:708-717[Abstract]. |
| 26. |
Pertala, R. C.,
H. Yokoyama,
Y. Ikemori,
M. Kuroki, and Y. Kodama.
1994.
Passive immunization against experimental salmonellosis in mice by orally administered hen egg yolk antibodies specific for 14kDa fimbriae of Salmonella enteritidis.
J. Med. Microbiol.
41:29-35 |
| 27. | Qureshi, M. A., L. Miller, H. S. Lillehoj, and M. D. Ficken. 1990. Establishment and characterization of a chicken mononuclear cell line. Vet. Immunol. Immunopathol. 26:237-250[CrossRef][Medline]. |
| 28. | Thorns, C. J., C. Turcotte, C. G. Gemmell, and M. J. Woodward. 1996. Studies into the role of the SEF14 fimbrial antigen in the pathogenesis of Salmonella enteritidis. Microb. Pathog. 20:235-246[CrossRef][Medline]. |
| 29. |
Van der Velden, A. W. M.,
A. J. Baumler,
R. M. Tsolis, and F. Heffron.
1998.
Multiple fimbrial adhesins are required for full virulence of Salmonella typhimurium in mice.
Infect. Immun.
66:2803-2808 |
| 30. | Verhoef, J., P. K. Peterson, and P. G. Quie. 1977. Kinetics of staphylococcal opsonization, attachment, ingestion and killing by human polymorphonuclear leukocytes: a quantitative assay using [3H] thymidine labeled bacteria. J. Immunol. Methods 14:303-311[CrossRef][Medline]. |
| 31. | Wells, C. L., M. A. Elisabeth, V. De Westerlo, R. P. Jechorek, B. A. Feltis, T. D. Wilkins, and S. L. Erlandsen. 1996. Bacteroides fragilis enterotoxin modulates permeability and bacterial internalization by HT-29 enterocytes. Gastroenterology 110:1429-1437[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»